Starting /dee2/code/volunteer_pipeline.sh SRR7168877 current disk space = 3091590520832 free memory = 1472560388 SRR7168877 SRAfilesize e4ed8ee798bef81f9cc666d3e35c6f13 SRR7168877.sra SRR7168877.sra file validated SRR7168877 is paired end SRR7168877 is conventional basespace SRR7168877 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168877_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.248 34.0 33.0 34.0 32.0 34.0 2 33.12525 34.0 33.0 34.0 32.0 34.0 3 33.1185 34.0 33.0 34.0 31.0 34.0 4 33.228 34.0 33.0 34.0 31.0 34.0 5 33.3165 34.0 33.0 34.0 33.0 34.0 6 36.86475 38.0 37.0 38.0 35.0 38.0 7 37.243 38.0 38.0 38.0 36.0 38.0 8 37.33625 38.0 38.0 38.0 37.0 38.0 9 37.445 38.0 38.0 38.0 37.0 38.0 10-14 37.43470000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.45035 38.0 38.0 38.0 37.0 38.0 20-24 37.33390000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.282650000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.340999999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.31445 38.0 38.0 38.0 37.0 38.0 40-44 37.17715 38.0 38.0 38.0 36.2 38.0 45-49 37.16305 38.0 38.0 38.0 36.2 38.0 50-54 37.09525 38.0 38.0 38.0 36.0 38.0 55-59 37.08385 38.0 38.0 38.0 36.0 38.0 60-64 37.00984999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.92475 38.0 38.0 38.0 35.4 38.0 70-74 36.8714 38.0 38.0 38.0 35.0 38.0 75-79 36.67085 38.0 38.0 38.0 34.6 38.0 80-84 36.574250000000006 38.0 38.0 38.0 34.0 38.0 85-89 36.54234999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.3461 38.0 37.8 38.0 33.8 38.0 95-99 36.1454 38.0 37.0 38.0 33.0 38.0 100-104 36.11665 38.0 37.0 38.0 33.0 38.0 105-109 35.904700000000005 38.0 37.0 38.0 32.0 38.0 110-114 35.6517 38.0 36.6 38.0 31.0 38.0 115-119 35.48955000000001 38.0 36.0 38.0 30.2 38.0 120-124 35.2529 38.0 36.0 38.0 29.2 38.0 125-129 34.902 38.0 35.0 38.0 28.0 38.0 130-134 34.512950000000004 38.0 34.8 38.0 25.8 38.0 135-139 34.016400000000004 38.0 34.0 38.0 23.2 38.0 140-144 33.41025 38.0 33.4 38.0 21.4 38.0 145-149 32.403800000000004 38.0 32.2 38.0 15.0 38.0 150-151 27.827875 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 3.0 16 3.0 17 1.0 18 2.0 19 3.0 20 1.0 21 3.0 22 7.0 23 9.0 24 18.0 25 12.0 26 21.0 27 20.0 28 40.0 29 48.0 30 53.0 31 65.0 32 96.0 33 130.0 34 176.0 35 355.0 36 841.0 37 2089.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.76165803108808 12.176165803108809 12.357512953367875 38.70466321243523 2 22.85 16.150000000000002 33.275 27.725 3 20.7 21.525 25.3 32.475 4 22.1 30.325000000000003 22.125 25.45 5 22.411205602801402 34.567283641820914 22.36118059029515 20.66033016508254 6 20.3 35.125 24.925 19.650000000000002 7 14.85 24.275 42.875 18.0 8 19.650000000000002 23.9 30.275000000000002 26.174999999999997 9 18.55 23.875 32.65 24.925 10-14 20.044999999999998 29.054999999999996 27.185 23.715 15-19 20.52 28.349999999999998 28.01 23.119999999999997 20-24 19.99 29.14 27.265 23.605 25-29 19.93 28.355000000000004 27.505000000000003 24.21 30-34 20.36 28.939999999999998 27.139999999999997 23.56 35-39 20.73 28.03 27.644999999999996 23.595 40-44 20.04 28.49 27.575 23.895 45-49 20.055 28.415000000000003 27.58 23.95 50-54 20.685000000000002 28.485 27.089999999999996 23.74 55-59 20.294999999999998 28.549999999999997 27.43 23.724999999999998 60-64 20.21 28.165000000000003 27.67 23.955000000000002 65-69 20.23 28.065 27.584999999999997 24.12 70-74 20.044999999999998 28.975 27.08 23.9 75-79 20.29 27.955000000000002 27.62 24.135 80-84 20.215 27.73 27.79 24.265 85-89 20.345 28.18 27.785 23.69 90-94 21.01 27.43 28.360000000000003 23.200000000000003 95-99 20.66 27.83 27.62 23.89 100-104 20.974999999999998 28.49 26.584999999999997 23.95 105-109 20.955 28.08 27.295 23.669999999999998 110-114 20.560000000000002 27.685 27.815 23.94 115-119 21.29 28.095 26.965 23.65 120-124 21.235 28.095 26.99 23.68 125-129 21.145 27.889999999999997 26.915 24.05 130-134 21.065 27.975 26.51 24.45 135-139 21.26 27.72 26.995 24.025 140-144 21.395 28.189999999999998 26.715 23.7 145-149 20.825 28.21 26.135 24.83 150-151 21.66980539861896 28.85122410546139 25.48650345260515 23.992467043314498 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 2.0 25 3.0 26 3.5 27 5.5 28 7.0 29 10.5 30 16.5 31 22.5 32 24.5 33 36.5 34 55.0 35 57.0 36 81.5 37 115.5 38 132.0 39 158.5 40 179.5 41 212.5 42 241.5 43 246.5 44 265.0 45 278.0 46 261.0 47 256.0 48 243.5 49 211.0 50 176.5 51 143.0 52 125.5 53 98.5 54 75.5 55 56.5 56 42.0 57 40.5 58 32.5 59 26.0 60 21.5 61 12.5 62 7.0 63 4.5 64 2.0 65 1.5 66 2.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5000000000000004 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.43750000000000006 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.6375 0.0 0.0 0.0 0.0 126-127 5.1 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 6.1125 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 7.025 0.0 0.0 0.0 0.0 136-137 7.5125 0.0 0.0 0.0 0.0 138-139 8.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168877 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168877_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9255 33.0 33.0 34.0 32.0 34.0 2 33.0415 34.0 33.0 34.0 32.0 34.0 3 33.067 34.0 33.0 34.0 32.0 34.0 4 33.00375 34.0 33.0 34.0 32.0 34.0 5 33.07025 34.0 33.0 34.0 33.0 34.0 6 37.253 38.0 38.0 38.0 37.0 38.0 7 37.231 38.0 38.0 38.0 37.0 38.0 8 37.165 38.0 38.0 38.0 37.0 38.0 9 37.21725 38.0 38.0 38.0 37.0 38.0 10-14 37.150400000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.117200000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.049850000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.0736 38.0 38.0 38.0 37.0 38.0 30-34 37.01885 38.0 38.0 38.0 37.0 38.0 35-39 36.986 38.0 38.0 38.0 37.0 38.0 40-44 37.054899999999996 38.0 38.0 38.0 37.0 38.0 45-49 36.953450000000004 38.0 38.0 38.0 36.2 38.0 50-54 36.9024 38.0 38.0 38.0 36.0 38.0 55-59 36.790800000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.7654 38.0 38.0 38.0 36.0 38.0 65-69 36.691199999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.66675 38.0 38.0 38.0 35.0 38.0 75-79 36.53065 38.0 38.0 38.0 34.8 38.0 80-84 36.36165 38.0 38.0 38.0 34.0 38.0 85-89 36.2293 38.0 38.0 38.0 33.8 38.0 90-94 36.12665 38.0 38.0 38.0 33.4 38.0 95-99 35.96294999999999 38.0 37.8 38.0 33.0 38.0 100-104 35.90355 38.0 37.4 38.0 33.0 38.0 105-109 35.726800000000004 38.0 37.0 38.0 32.4 38.0 110-114 35.53975 38.0 37.0 38.0 31.0 38.0 115-119 35.23675 38.0 36.4 38.0 29.4 38.0 120-124 34.7789 38.0 35.6 38.0 26.8 38.0 125-129 34.346199999999996 38.0 35.0 38.0 24.0 38.0 130-134 34.0326 38.0 34.8 38.0 22.8 38.0 135-139 33.516400000000004 38.0 33.8 38.0 21.0 38.0 140-144 32.633300000000006 38.0 32.6 38.0 15.0 38.0 145-149 31.63825 38.0 32.0 38.0 8.4 38.0 150-151 27.06025 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 3.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 2.0 11 3.0 12 4.0 13 2.0 14 1.0 15 5.0 16 7.0 17 8.0 18 8.0 19 10.0 20 7.0 21 5.0 22 15.0 23 8.0 24 16.0 25 21.0 26 23.0 27 33.0 28 44.0 29 39.0 30 46.0 31 56.0 32 86.0 33 111.0 34 173.0 35 284.0 36 738.0 37 2228.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.658664666166544 18.00450112528132 18.854713678419603 28.482120530132534 2 26.463231615807903 25.56278139069535 30.86543271635818 17.10855427713857 3 21.585792896448226 27.738869434717362 30.84042021010505 19.834917458729365 4 24.618463847885916 33.75031273455092 22.81711283462597 18.8141105829372 5 25.062531265632813 35.66783391695848 21.135567783891947 18.13406703351676 6 20.860430215107552 36.09304652326163 24.387193596798397 18.659329664832416 7 19.009504752376188 19.759879939969984 39.74487243621811 21.48574287143572 8 21.98599299649825 24.537268634317158 27.01350675337669 26.463231615807903 9 22.961480740370185 25.212606303151574 28.489244622311155 23.336668334167083 10-14 23.551775887943972 28.844422211105552 25.967983991995997 21.635817908954476 15-19 23.24394636782069 28.372023213928355 27.211326796077646 21.1727036221733 20-24 23.34484311664915 28.824500825701847 27.188109893409397 20.642546164239604 25-29 23.330164606994547 28.308400460299193 27.25771751638565 21.10371741632061 30-34 22.98453685632788 28.529249862383026 27.283190712105288 21.20302256918381 35-39 23.409580059062016 27.964362580709746 27.318684618849794 21.307372741378448 40-44 23.88171720204143 27.349144401080753 27.33913739617733 21.43000100070049 45-49 23.05383229937963 27.636581949169504 27.416449869921955 21.893135881528917 50-54 23.532943118715295 28.150482765521033 27.25499024463455 21.061583871129123 55-59 23.85311921556856 27.500125068787835 27.650207614187806 20.9965481014558 60-64 23.352844064235327 27.645204862674472 27.725248886887787 21.276702186202414 65-69 23.62035322959924 27.75303947565918 27.672987441837194 20.95361985290439 70-74 23.346342439707797 27.894526168317824 27.514259981987394 21.24487140998699 75-79 23.4837870296237 27.481985588470774 27.607085668534825 21.427141713370695 80-84 23.366544835527964 27.507134631752866 27.43203324488059 21.69428728783858 85-89 23.52234622891747 27.08072669035584 27.97657774886142 21.42034933186527 90-94 23.512634475856892 27.080310232674503 27.660745559169374 21.746309732299224 95-99 23.581790895447725 27.903951975987994 27.71385692846423 20.80040020010005 100-104 23.778077942868578 27.80029015958777 27.28000400220121 21.141627895342438 105-109 23.336668334167083 28.039019509754876 27.32866433216608 21.295647823911956 110-114 23.6368184092046 27.94897448724362 27.838919459729865 20.57528764382191 115-119 24.115675188872768 28.09326061940261 27.127632961424926 20.663431230299693 120-124 24.477029326393755 27.589830847762986 27.14943449104194 20.783705334801322 125-129 24.863620439417446 27.696311495921126 26.730393874180468 20.709674190480957 130-134 24.66966966966967 28.31831831831832 26.72172172172172 20.29029029029029 135-139 25.232709438494645 28.385546992293065 26.20858772895606 20.17315584025623 140-144 24.988743809095002 27.885336935314424 27.034869178047927 20.09105007754265 145-149 26.045627376425855 27.836702021212727 26.630978587152292 19.486692015209126 150-151 26.2875 28.3375 25.837500000000002 19.537499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.0 25 0.5 26 0.5 27 4.5 28 6.5 29 7.5 30 11.0 31 14.5 32 21.0 33 28.5 34 35.0 35 55.0 36 76.0 37 91.0 38 122.0 39 153.5 40 185.0 41 216.5 42 237.5 43 269.0 44 272.5 45 281.0 46 289.5 47 269.0 48 236.0 49 206.0 50 183.0 51 146.5 52 124.5 53 103.0 54 81.5 55 63.5 56 46.5 57 38.5 58 30.5 59 18.5 60 16.5 61 12.5 62 11.0 63 10.5 64 4.0 65 2.0 66 1.0 67 0.0 68 2.5 69 4.0 70 1.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.05 4 0.075 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.06 20-24 0.08499999999999999 25-29 0.065 30-34 0.08499999999999999 35-39 0.105 40-44 0.06999999999999999 45-49 0.06 50-54 0.055 55-59 0.055 60-64 0.055 65-69 0.065 70-74 0.06999999999999999 75-79 0.08 80-84 0.135 85-89 0.095 90-94 0.075 95-99 0.05 100-104 0.055 105-109 0.05 110-114 0.05 115-119 0.065 120-124 0.09 125-129 0.095 130-134 0.1 135-139 0.09 140-144 0.055 145-149 0.06 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.503651473180559 1.0 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.02518257365902795 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.5499999999999998 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.775 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.6375 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.4875 0.0 0.0 0.0 0.0 126-127 5.0 0.0 0.0 0.0 0.0 128-129 5.324999999999999 0.0 0.0 0.0 0.0 130-131 6.0125 0.0 0.0 0.0 0.0 132-133 6.3375 0.0 0.0 0.0 0.0 134-135 6.9375 0.0 0.0 0.0 0.0 136-137 7.4625 0.0 0.0 0.0 0.0 138-139 8.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGATG 10 0.006830828 145.0 145 >>END_MODULE Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760482 spots for SRR7168877.sra Written 760482 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra Read 760466 spots for SRR7168877.sra Written 760466 spots for SRR7168877.sra SRR ids: ['SRR7168877.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m521soi3 SRR7168877.sra spots: 15209336 blocks: [[1, 760466], [760467, 1520932], [1520933, 2281398], [2281399, 3041864], [3041865, 3802330], [3802331, 4562796], [4562797, 5323262], [5323263, 6083728], [6083729, 6844194], [6844195, 7604660], [7604661, 8365126], [8365127, 9125592], [9125593, 9886058], [9886059, 10646524], [10646525, 11406990], [11406991, 12167456], [12167457, 12927922], [12927923, 13688388], [13688389, 14448854], [14448855, 15209336]] SRR7168877 file size 5132244 SRR7168877 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168877 SRR7168877_1.fastq SRR7168877_2.fastq Input file: SRR7168877_1.fastq Paired file: SRR7168877_2.fastq trimmed: SRR7168877-trimmed-pair1.fastq, SRR7168877-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 17:43:13 2025 >> started Sat Feb 15 17:49:39 2025 >> done (385.484s) 15209336 read pairs processed; of these: 23888 ( 0.16%) short read pairs filtered out after trimming by size control 50011 ( 0.33%) empty read pairs filtered out after trimming by size control 15135437 (99.51%) read pairs available; of these: 8320688 (54.97%) trimmed read pairs available after processing 6814749 (45.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 6 0.00% 21 3 0.00% 22 4 0.00% 23 10 0.00% 24 8 0.00% 25 6 0.00% 26 5 0.00% 27 8 0.00% 28 5 0.00% 29 5 0.00% 30 10 0.00% 31 8 0.00% 32 11 0.00% 33 9 0.00% 34 13 0.00% 35 12 0.00% 36 12 0.00% 37 8 0.00% 38 12 0.00% 39 19 0.00% 40 12 0.00% 41 25 0.00% 42 29 0.00% 43 31 0.00% 44 35 0.00% 45 39 0.00% 46 46 0.00% 47 55 0.00% 48 60 0.00% 49 71 0.00% 50 63 0.00% 51 88 0.00% 52 89 0.00% 53 114 0.00% 54 111 0.00% 55 117 0.00% 56 134 0.00% 57 151 0.00% 58 179 0.00% 59 211 0.00% 60 206 0.00% 61 255 0.00% 62 280 0.00% 63 333 0.00% 64 371 0.00% 65 548 0.00% 66 508 0.00% 67 580 0.00% 68 775 0.01% 69 1985 0.01% 70 1566 0.01% 71 999 0.01% 72 976 0.01% 73 1116 0.01% 74 1314 0.01% 75 1398 0.01% 76 1587 0.01% 77 1772 0.01% 78 1969 0.01% 79 2187 0.01% 80 2524 0.02% 81 2811 0.02% 82 3222 0.02% 83 3692 0.02% 84 4697 0.03% 85 5478 0.04% 86 5730 0.04% 87 6320 0.04% 88 6792 0.04% 89 7255 0.05% 90 7649 0.05% 91 8226 0.05% 92 8961 0.06% 93 9771 0.06% 94 10363 0.07% 95 11295 0.07% 96 11865 0.08% 97 12508 0.08% 98 13254 0.09% 99 13997 0.09% 100 15027 0.10% 101 15491 0.10% 102 16681 0.11% 103 17573 0.12% 104 18839 0.12% 105 20528 0.14% 106 21204 0.14% 107 21861 0.14% 108 23232 0.15% 109 24236 0.16% 110 25236 0.17% 111 26199 0.17% 112 27195 0.18% 113 28644 0.19% 114 30440 0.20% 115 32297 0.21% 116 33322 0.22% 117 34942 0.23% 118 36328 0.24% 119 37023 0.24% 120 38253 0.25% 121 40236 0.27% 122 41176 0.27% 123 43419 0.29% 124 45776 0.30% 125 48236 0.32% 126 50876 0.34% 127 52076 0.34% 128 54101 0.36% 129 55932 0.37% 130 58494 0.39% 131 59832 0.40% 132 63202 0.42% 133 66466 0.44% 134 69999 0.46% 135 74251 0.49% 136 78486 0.52% 137 82634 0.55% 138 87647 0.58% 139 93230 0.62% 140 99492 0.66% 141 107361 0.71% 142 118575 0.78% 143 132282 0.87% 144 150984 1.00% 145 179062 1.18% 146 223427 1.48% 147 301181 1.99% 148 452005 2.99% 149 878971 5.81% 150 3787751 25.03% 151 6814749 45.03% 15135437 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=24 prefix-density=0.71 prefix-fanout=1.1 sequence=TGCACTTGACGCGTGTTGTCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=321.84 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=29 prefix-density=0.75 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=110.04 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.7 sequence=AAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7168877 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 19:05:06 Started mapping on | Feb 15 19:06:51 Finished on | Feb 15 21:37:00 Mapping speed, Million of reads per hour | 6.05 Number of input reads | 15135437 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13977221 Uniquely mapped reads % | 92.35% Average mapped length | 292.11 Number of splices: Total | 13107646 Number of splices: Annotated (sjdb) | 12798227 Number of splices: GT/AG | 12830794 Number of splices: GC/AG | 229123 Number of splices: AT/AC | 7504 Number of splices: Non-canonical | 40225 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 439545 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 68220 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.19% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 735623 735623 735623 N_multimapping 439545 439545 439545 N_noFeature 448011 13712419 587637 N_ambiguous 238419 1531 112130 UnstrandedReadsAssigned:13290791 PositiveStrandReadsAssigned:263271 NegativeStrandReadsAssigned:13277454 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168877 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168877-trimmed-pair1.fastq SRR7168877-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,135,437 reads, 13,344,489 reads pseudoaligned [quant] estimated average fragment length: 231.922 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR7168877.ke.tsv 34699 SRR7168877.se.tsv 87100 total ==> SRR7168877.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.08 555 22.1921 Potri.005G024800.1.v4.1 1035 804.078 348 30.9264 Potri.004G059700.1.v4.1 961 730.105 26 2.5447 Potri.007G009000.2.v4.1 1416 1185.08 0 0 Potri.003G141000.2.v4.1 2943 2712.08 632.668 16.6695 Potri.016G087400.1.v4.1 270 84.0645 820 697.028 Potri.015G069301.1.v4.1 564 336.422 0 0 Potri.010G195200.1.v4.1 1773 1542.08 10 0.463386 Potri.012G127500.1.v4.1 977 746.089 177 16.9524 ==> SRR7168877.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 395 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 192 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR7168877 completed mapping pipeline successfully