Starting /dee2/code/volunteer_pipeline.sh SRR7168878 current disk space = 3091885117440 free memory = 1461311176 SRR7168878 SRAfilesize f18e7b48bcbb20351a51fc6eb4734d57 SRR7168878.sra SRR7168878.sra file validated SRR7168878 is paired end SRR7168878 is conventional basespace SRR7168878 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168878_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9905 34.0 33.0 34.0 32.0 34.0 2 33.16525 34.0 33.0 34.0 32.0 34.0 3 33.13875 34.0 33.0 34.0 31.0 34.0 4 33.2275 34.0 33.0 34.0 33.0 34.0 5 33.3115 34.0 33.0 34.0 33.0 34.0 6 36.985 38.0 37.0 38.0 36.0 38.0 7 37.2985 38.0 38.0 38.0 37.0 38.0 8 37.36025 38.0 38.0 38.0 37.0 38.0 9 37.4535 38.0 38.0 38.0 37.0 38.0 10-14 37.453799999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.4336 38.0 38.0 38.0 37.0 38.0 20-24 37.4029 38.0 38.0 38.0 37.0 38.0 25-29 37.2892 38.0 38.0 38.0 37.0 38.0 30-34 37.327 38.0 38.0 38.0 37.0 38.0 35-39 37.3361 38.0 38.0 38.0 37.0 38.0 40-44 37.277100000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.23915 38.0 38.0 38.0 36.8 38.0 50-54 37.1742 38.0 38.0 38.0 36.2 38.0 55-59 37.11035 38.0 38.0 38.0 36.0 38.0 60-64 37.0966 38.0 38.0 38.0 36.0 38.0 65-69 37.0501 38.0 38.0 38.0 36.0 38.0 70-74 36.9169 38.0 38.0 38.0 35.2 38.0 75-79 36.81484999999999 38.0 38.0 38.0 35.2 38.0 80-84 36.622800000000005 38.0 38.0 38.0 34.2 38.0 85-89 36.6296 38.0 38.0 38.0 34.2 38.0 90-94 36.4895 38.0 38.0 38.0 34.0 38.0 95-99 36.351549999999996 38.0 37.6 38.0 34.0 38.0 100-104 36.184999999999995 38.0 37.0 38.0 33.2 38.0 105-109 36.054899999999996 38.0 37.0 38.0 33.0 38.0 110-114 35.81105 38.0 37.0 38.0 31.8 38.0 115-119 35.6185 38.0 36.6 38.0 31.0 38.0 120-124 35.4091 38.0 36.0 38.0 30.6 38.0 125-129 35.052350000000004 38.0 35.8 38.0 28.0 38.0 130-134 34.6554 38.0 34.8 38.0 26.8 38.0 135-139 34.32275 38.0 34.8 38.0 24.6 38.0 140-144 33.54055 38.0 33.4 38.0 21.4 38.0 145-149 32.697449999999996 38.0 33.0 38.0 15.2 38.0 150-151 27.893375 34.5 17.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 8.0 19 5.0 20 4.0 21 5.0 22 6.0 23 10.0 24 8.0 25 15.0 26 8.0 27 33.0 28 31.0 29 50.0 30 49.0 31 71.0 32 77.0 33 126.0 34 164.0 35 308.0 36 775.0 37 2242.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.238493723849366 12.081589958158997 12.395397489539748 38.28451882845189 2 22.275 18.475 33.525 25.724999999999998 3 19.625 24.175 24.25 31.95 4 22.675 32.05 21.975 23.3 5 22.311155577788895 36.61830915457729 23.13656828414207 17.933966983491743 6 18.725 35.775 25.4 20.1 7 14.549999999999999 23.65 43.925 17.875 8 18.35 24.175 31.7 25.775 9 17.7 24.224999999999998 33.275 24.8 10-14 20.31 29.035 26.939999999999998 23.715 15-19 19.99 28.405 27.57 24.035 20-24 20.25 28.455000000000002 27.884999999999998 23.41 25-29 20.075000000000003 28.845 27.650000000000002 23.43 30-34 20.305 28.835 27.77 23.09 35-39 19.925 28.76 27.779999999999998 23.535 40-44 20.135 29.044999999999998 27.495000000000005 23.325000000000003 45-49 20.16 28.549999999999997 27.54 23.75 50-54 20.11 28.27 28.125 23.494999999999997 55-59 20.49 28.235 27.665 23.61 60-64 20.565 28.449999999999996 28.075 22.91 65-69 20.375 28.505000000000003 27.750000000000004 23.369999999999997 70-74 20.595 28.455000000000002 27.339999999999996 23.61 75-79 20.315 27.805000000000003 28.244999999999997 23.635 80-84 20.095 28.065 28.12 23.72 85-89 20.849999999999998 28.044999999999998 27.834999999999997 23.27 90-94 20.674999999999997 28.325 27.18 23.82 95-99 20.630000000000003 28.199999999999996 27.525 23.645 100-104 21.035 28.060000000000002 27.839999999999996 23.064999999999998 105-109 21.025 27.915 27.68 23.380000000000003 110-114 21.295 28.875 27.034999999999997 22.795 115-119 21.265 28.084999999999997 27.36 23.29 120-124 20.94 28.08 27.889999999999997 23.09 125-129 21.335 28.115000000000002 26.979999999999997 23.57 130-134 21.154999999999998 28.335 26.945000000000004 23.565 135-139 21.385 28.610000000000003 26.295 23.71 140-144 21.32 28.355000000000004 26.57 23.755000000000003 145-149 21.345 27.71 26.889999999999997 24.055 150-151 20.99849473156046 29.014049172102357 25.752634219769195 24.234821876567988 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 2.0 20 2.0 21 5.0 22 6.5 23 3.5 24 2.0 25 5.5 26 8.5 27 12.5 28 17.0 29 18.5 30 23.0 31 31.0 32 36.5 33 49.5 34 65.5 35 72.5 36 92.5 37 111.0 38 129.0 39 151.5 40 175.0 41 208.5 42 233.0 43 243.0 44 254.0 45 238.0 46 231.0 47 252.5 48 240.5 49 205.5 50 164.5 51 134.5 52 119.0 53 91.5 54 72.0 55 67.5 56 51.5 57 37.5 58 34.0 59 31.5 60 19.5 61 10.0 62 11.5 63 10.5 64 5.5 65 2.5 66 1.5 67 1.5 68 2.5 69 1.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3999999999999995 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5032712632108707 1.0 3 0.0754906894816306 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.725 0.0 0.0 0.0 0.0 122-123 4.175 0.0 0.0 0.0 0.0 124-125 4.5625 0.0 0.0 0.0 0.0 126-127 4.949999999999999 0.0 0.0 0.0 0.0 128-129 5.575 0.0 0.0 0.0 0.0 130-131 6.125 0.0 0.0 0.0 0.0 132-133 6.612500000000001 0.0 0.0 0.0 0.0 134-135 7.1375 0.0 0.0 0.0 0.0 136-137 7.737500000000001 0.0 0.0 0.0 0.0 138-139 8.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAGC 10 0.0056249425 154.6 1 AACAAGG 10 0.0056249425 154.6 1 >>END_MODULE SRR7168878 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168878_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.933 33.0 33.0 34.0 32.0 34.0 2 33.05225 34.0 33.0 34.0 32.0 34.0 3 33.13125 34.0 33.0 34.0 33.0 34.0 4 33.03825 34.0 33.0 34.0 33.0 34.0 5 33.0965 34.0 33.0 34.0 33.0 34.0 6 37.254 38.0 38.0 38.0 37.0 38.0 7 37.25425 38.0 38.0 38.0 37.0 38.0 8 37.2125 38.0 38.0 38.0 37.0 38.0 9 37.19775 38.0 38.0 38.0 37.0 38.0 10-14 37.2416 38.0 38.0 38.0 37.0 38.0 15-19 37.23545 38.0 38.0 38.0 37.0 38.0 20-24 37.197700000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.1845 38.0 38.0 38.0 37.0 38.0 30-34 37.16054999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.20155 38.0 38.0 38.0 37.0 38.0 40-44 37.15695 38.0 38.0 38.0 37.0 38.0 45-49 37.057 38.0 38.0 38.0 37.0 38.0 50-54 36.973400000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.878750000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.86745 38.0 38.0 38.0 36.0 38.0 65-69 36.75840000000001 38.0 38.0 38.0 35.8 38.0 70-74 36.70635 38.0 38.0 38.0 35.6 38.0 75-79 36.6149 38.0 38.0 38.0 35.0 38.0 80-84 36.471599999999995 38.0 38.0 38.0 34.2 38.0 85-89 36.278499999999994 38.0 38.0 38.0 33.8 38.0 90-94 36.1409 38.0 38.0 38.0 33.4 38.0 95-99 36.027 38.0 38.0 38.0 33.2 38.0 100-104 35.933049999999994 38.0 37.6 38.0 33.2 38.0 105-109 35.71795000000001 38.0 37.0 38.0 31.4 38.0 110-114 35.5553 38.0 37.0 38.0 31.0 38.0 115-119 35.328700000000005 38.0 36.6 38.0 29.8 38.0 120-124 34.9282 38.0 36.2 38.0 27.6 38.0 125-129 34.57695 38.0 35.4 38.0 26.0 38.0 130-134 34.2445 38.0 34.8 38.0 23.6 38.0 135-139 33.6687 38.0 34.0 38.0 22.2 38.0 140-144 32.662749999999996 38.0 32.8 38.0 14.6 38.0 145-149 31.7281 38.0 32.2 38.0 8.4 38.0 150-151 26.924999999999997 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 1.0 5 2.0 6 2.0 7 2.0 8 1.0 9 0.0 10 1.0 11 3.0 12 4.0 13 4.0 14 1.0 15 6.0 16 5.0 17 9.0 18 4.0 19 10.0 20 17.0 21 11.0 22 19.0 23 7.0 24 9.0 25 16.0 26 21.0 27 23.0 28 26.0 29 35.0 30 51.0 31 67.0 32 98.0 33 109.0 34 161.0 35 328.0 36 664.0 37 2281.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.925000000000004 17.375 17.724999999999998 27.975 2 26.825 23.724999999999998 32.4 17.05 3 20.525 28.65 30.725 20.1 4 23.925 34.1 21.5 20.474999999999998 5 24.474999999999998 36.1 21.099999999999998 18.325 6 20.45 38.2 22.45 18.9 7 19.35 19.7 40.325 20.625 8 23.200000000000003 23.775 26.05 26.974999999999998 9 22.425 25.35 29.275000000000002 22.95 10-14 23.28 28.365000000000002 26.525 21.83 15-19 23.187318731873187 27.562756275627564 28.352835283528353 20.8970897089709 20-24 22.88915566226491 28.06622649059624 28.08623449379752 20.958383353341336 25-29 23.485 28.13 27.495000000000005 20.89 30-34 22.774554910982197 27.805561112222442 28.005601120224043 21.414282856571315 35-39 22.49237080394217 28.215518535194356 28.055430486767722 21.236680174095753 40-44 23.374674934987 27.575515103020603 27.495499099819966 21.554310862172436 45-49 23.169999999999998 28.125 27.24 21.465 50-54 22.895 27.334999999999997 28.275 21.495 55-59 22.935 27.834999999999997 27.71 21.52 60-64 23.035 27.165 28.17 21.63 65-69 23.014602920584117 27.485497099419888 28.030606121224245 21.469293858771753 70-74 23.30699209762929 27.778333500050017 27.503250975292588 21.411423427028108 75-79 23.75093773443361 27.431857964491122 27.571892973243312 21.24531132783196 80-84 23.60888710968775 27.847277822257805 27.346877502001597 21.196957566052845 85-89 23.81071482166975 27.39732879795908 27.587414336451406 21.204542043919762 90-94 23.319663932786558 27.225445089017803 28.180636127225444 21.274254850970195 95-99 23.355 27.57 28.03 21.044999999999998 100-104 23.435 28.16 27.395000000000003 21.01 105-109 23.380000000000003 27.165 28.54 20.915 110-114 23.215 28.26 27.68 20.845 115-119 24.005000000000003 27.529999999999998 27.465 21.0 120-124 23.78332416345721 28.234882208773072 27.42459860951333 20.557195018256387 125-129 24.013404691642073 27.80473165607963 27.589656379732908 20.59220727254539 130-134 24.23090390675804 27.86754039317693 27.31229053073883 20.589265169326197 135-139 24.833691792127244 27.269544340519182 27.759715900565197 20.137047966788376 140-144 25.069999999999997 27.93 26.685 20.315 145-149 25.52 27.82 26.88 19.78 150-151 25.9875 27.85 26.6 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.5 16 1.0 17 1.0 18 1.0 19 1.5 20 2.0 21 2.5 22 2.5 23 2.0 24 4.5 25 4.5 26 2.0 27 5.5 28 13.0 29 12.0 30 19.0 31 26.5 32 25.0 33 41.5 34 60.0 35 69.5 36 76.0 37 92.5 38 119.5 39 155.0 40 193.0 41 210.0 42 226.0 43 242.5 44 245.0 45 249.5 46 245.0 47 232.5 48 235.0 49 213.5 50 171.5 51 138.0 52 108.5 53 96.5 54 93.0 55 81.0 56 66.0 57 52.0 58 39.0 59 27.0 60 15.5 61 15.0 62 18.0 63 14.0 64 5.5 65 3.5 66 5.0 67 3.5 68 2.5 69 1.5 70 2.0 71 2.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.04 25-29 0.0 30-34 0.02 35-39 0.055 40-44 0.02 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.02 70-74 0.03 75-79 0.025 80-84 0.08 85-89 0.045 90-94 0.02 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.034999999999999996 130-134 0.045 135-139 0.034999999999999996 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.5875000000000004 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.4625 0.0 0.0 0.0 0.0 126-127 4.925000000000001 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.125 0.0 0.0 0.0 0.0 132-133 6.5625 0.0 0.0 0.0 0.0 134-135 7.1 0.0 0.0 0.0 0.0 136-137 7.6875 0.0 0.0 0.0 0.0 138-139 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAATCC 10 0.006830828 145.0 8 >>END_MODULE Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780152 spots for SRR7168878.sra Written 780152 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra Read 780150 spots for SRR7168878.sra Written 780150 spots for SRR7168878.sra SRR ids: ['SRR7168878.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f58ff07n SRR7168878.sra spots: 15603002 blocks: [[1, 780150], [780151, 1560300], [1560301, 2340450], [2340451, 3120600], [3120601, 3900750], [3900751, 4680900], [4680901, 5461050], [5461051, 6241200], [6241201, 7021350], [7021351, 7801500], [7801501, 8581650], [8581651, 9361800], [9361801, 10141950], [10141951, 10922100], [10922101, 11702250], [11702251, 12482400], [12482401, 13262550], [13262551, 14042700], [14042701, 14822850], [14822851, 15603002]] SRR7168878 file size 5265645 SRR7168878 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168878 SRR7168878_1.fastq SRR7168878_2.fastq Input file: SRR7168878_1.fastq Paired file: SRR7168878_2.fastq trimmed: SRR7168878-trimmed-pair1.fastq, SRR7168878-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 18:17:39 2025 >> started Sat Feb 15 18:23:22 2025 >> done (343.143s) 15603002 read pairs processed; of these: 18817 ( 0.12%) short read pairs filtered out after trimming by size control 36593 ( 0.23%) empty read pairs filtered out after trimming by size control 15547592 (99.64%) read pairs available; of these: 8480960 (54.55%) trimmed read pairs available after processing 7066632 (45.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 5 0.00% 24 1 0.00% 25 7 0.00% 26 11 0.00% 27 8 0.00% 28 8 0.00% 29 8 0.00% 30 8 0.00% 31 9 0.00% 32 14 0.00% 33 11 0.00% 34 11 0.00% 35 16 0.00% 36 13 0.00% 37 17 0.00% 38 17 0.00% 39 22 0.00% 40 25 0.00% 41 29 0.00% 42 36 0.00% 43 41 0.00% 44 34 0.00% 45 54 0.00% 46 50 0.00% 47 46 0.00% 48 62 0.00% 49 66 0.00% 50 65 0.00% 51 77 0.00% 52 88 0.00% 53 111 0.00% 54 142 0.00% 55 121 0.00% 56 132 0.00% 57 176 0.00% 58 224 0.00% 59 222 0.00% 60 263 0.00% 61 272 0.00% 62 323 0.00% 63 343 0.00% 64 402 0.00% 65 468 0.00% 66 522 0.00% 67 622 0.00% 68 730 0.00% 69 1380 0.01% 70 1227 0.01% 71 1024 0.01% 72 1081 0.01% 73 1160 0.01% 74 1370 0.01% 75 1456 0.01% 76 1702 0.01% 77 1920 0.01% 78 2018 0.01% 79 2388 0.02% 80 2622 0.02% 81 2873 0.02% 82 3236 0.02% 83 3810 0.02% 84 4672 0.03% 85 5242 0.03% 86 5644 0.04% 87 6277 0.04% 88 6705 0.04% 89 7199 0.05% 90 7898 0.05% 91 8463 0.05% 92 9131 0.06% 93 9947 0.06% 94 10888 0.07% 95 11620 0.07% 96 12241 0.08% 97 13152 0.08% 98 13870 0.09% 99 14504 0.09% 100 15771 0.10% 101 16629 0.11% 102 17811 0.11% 103 19329 0.12% 104 20113 0.13% 105 21508 0.14% 106 22465 0.14% 107 23175 0.15% 108 24568 0.16% 109 26023 0.17% 110 26951 0.17% 111 28430 0.18% 112 29523 0.19% 113 30941 0.20% 114 32787 0.21% 115 34672 0.22% 116 35349 0.23% 117 36735 0.24% 118 38019 0.24% 119 38803 0.25% 120 40709 0.26% 121 42323 0.27% 122 44204 0.28% 123 46443 0.30% 124 47932 0.31% 125 50318 0.32% 126 52736 0.34% 127 54165 0.35% 128 55873 0.36% 129 58345 0.38% 130 60168 0.39% 131 62517 0.40% 132 65332 0.42% 133 68522 0.44% 134 72040 0.46% 135 75571 0.49% 136 80281 0.52% 137 84460 0.54% 138 89362 0.57% 139 94302 0.61% 140 100695 0.65% 141 107846 0.69% 142 119056 0.77% 143 133309 0.86% 144 153008 0.98% 145 181148 1.17% 146 223036 1.43% 147 301787 1.94% 148 449844 2.89% 149 873958 5.62% 150 3869400 24.89% 151 7066632 45.45% 15547592 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=39 prefix-density=0.60 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=93.16 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.4 sequence=TTCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCTTAAGGCCCTAACAGAT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=5.22 fanout-score-rank=17 prefix-density=0.90 prefix-fanout=1.6 sequence=ATGGCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCACCCCGGTACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=43.91 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.0 sequence=CACAGAGAACACATTCATAC SRR7168878 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 19:01:23 Started mapping on | Feb 15 19:01:45 Finished on | Feb 15 21:38:26 Mapping speed, Million of reads per hour | 5.95 Number of input reads | 15547592 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13515521 Uniquely mapped reads % | 86.93% Average mapped length | 292.03 Number of splices: Total | 12638751 Number of splices: Annotated (sjdb) | 12371455 Number of splices: GT/AG | 12385913 Number of splices: GC/AG | 212124 Number of splices: AT/AC | 6772 Number of splices: Non-canonical | 33942 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404699 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 151774 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.28% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1641061 1641061 1641061 N_multimapping 404699 404699 404699 N_noFeature 476251 13252581 632310 N_ambiguous 209601 1430 101543 UnstrandedReadsAssigned:12829669 PositiveStrandReadsAssigned:261510 NegativeStrandReadsAssigned:12781668 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168878 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168878-trimmed-pair1.fastq SRR7168878-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,547,592 reads, 12,935,537 reads pseudoaligned [quant] estimated average fragment length: 234.814 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,005 rounds 52401 SRR7168878.ke.tsv 34699 SRR7168878.se.tsv 87100 total ==> SRR7168878.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.19 428 18.5435 Potri.005G024800.1.v4.1 1035 801.186 186 17.946 Potri.004G059700.1.v4.1 961 727.224 4 0.425186 Potri.007G009000.2.v4.1 1416 1182.19 0 0 Potri.003G141000.2.v4.1 2943 2709.19 414.215 11.8188 Potri.016G087400.1.v4.1 270 85.3286 524 474.705 Potri.015G069301.1.v4.1 564 334.961 0 0 Potri.010G195200.1.v4.1 1773 1539.19 13 0.652889 Potri.012G127500.1.v4.1 977 743.213 288 29.9548 ==> SRR7168878.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 129 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7168878 completed mapping pipeline successfully