Starting /dee2/code/volunteer_pipeline.sh SRR7168879 current disk space = 2820422340608 free memory = 1579173816 SRR7168879 SRAfilesize 2bd84bc1469a664d2e0922f37700ef7c SRR7168879.sra SRR7168879.sra file validated SRR7168879 is paired end SRR7168879 is conventional basespace SRR7168879 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168879_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.11425 34.0 33.0 34.0 32.0 34.0 2 33.17925 34.0 33.0 34.0 32.0 34.0 3 33.173 34.0 33.0 34.0 31.0 34.0 4 33.29525 34.0 33.0 34.0 33.0 34.0 5 33.3705 34.0 33.0 34.0 33.0 34.0 6 37.0135 38.0 37.0 38.0 36.0 38.0 7 37.25 38.0 38.0 38.0 36.0 38.0 8 37.4005 38.0 38.0 38.0 37.0 38.0 9 37.446 38.0 38.0 38.0 37.0 38.0 10-14 37.472699999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.510149999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.40839999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.36625 38.0 38.0 38.0 37.0 38.0 30-34 37.4111 38.0 38.0 38.0 37.0 38.0 35-39 37.3775 38.0 38.0 38.0 37.0 38.0 40-44 37.347950000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.28635 38.0 38.0 38.0 37.0 38.0 50-54 37.2288 38.0 38.0 38.0 36.4 38.0 55-59 37.169700000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.1016 38.0 38.0 38.0 36.0 38.0 65-69 37.04255 38.0 38.0 38.0 36.0 38.0 70-74 36.9106 38.0 38.0 38.0 35.4 38.0 75-79 36.88765 38.0 38.0 38.0 35.2 38.0 80-84 36.766749999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.7343 38.0 38.0 38.0 34.8 38.0 90-94 36.553250000000006 38.0 38.0 38.0 34.4 38.0 95-99 36.346799999999995 38.0 37.6 38.0 33.8 38.0 100-104 36.279399999999995 38.0 37.4 38.0 34.0 38.0 105-109 36.1434 38.0 37.2 38.0 33.4 38.0 110-114 35.98825000000001 38.0 37.0 38.0 32.8 38.0 115-119 35.691950000000006 38.0 36.6 38.0 31.2 38.0 120-124 35.4075 38.0 36.0 38.0 29.8 38.0 125-129 35.1271 38.0 35.4 38.0 28.2 38.0 130-134 34.9032 38.0 34.8 38.0 28.0 38.0 135-139 34.5064 38.0 34.8 38.0 25.8 38.0 140-144 33.71615 38.0 33.6 38.0 22.6 38.0 145-149 32.80935 38.0 33.0 38.0 18.4 38.0 150-151 28.094749999999998 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 3.0 19 4.0 20 2.0 21 3.0 22 3.0 23 5.0 24 9.0 25 13.0 26 22.0 27 12.0 28 36.0 29 35.0 30 43.0 31 68.0 32 81.0 33 114.0 34 175.0 35 334.0 36 812.0 37 2219.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.62679176439927 14.073494917904613 10.55512118842846 39.74459212926766 2 20.775 19.825 36.55 22.85 3 18.55 24.25 26.875 30.325000000000003 4 22.45 31.95 22.125 23.474999999999998 5 22.2972972972973 36.58658658658659 23.04804804804805 18.06806806806807 6 19.125 36.0 24.075 20.8 7 13.675 26.525 42.199999999999996 17.599999999999998 8 17.974999999999998 25.025 31.275 25.724999999999998 9 17.65 23.474999999999998 33.825 25.05 10-14 19.835 30.185000000000002 26.435 23.544999999999998 15-19 20.330000000000002 28.785 27.07 23.815 20-24 20.51 29.110000000000003 27.48 22.900000000000002 25-29 19.765 28.720000000000002 27.779999999999998 23.735 30-34 19.81 29.065 27.935 23.189999999999998 35-39 20.345 28.660000000000004 26.919999999999998 24.075 40-44 20.04 28.62 27.389999999999997 23.95 45-49 20.19 28.405 27.92 23.485 50-54 20.59 28.705000000000002 28.09 22.615 55-59 20.515 29.005 27.095000000000002 23.385 60-64 20.349999999999998 28.54 27.584999999999997 23.525 65-69 20.315 28.37 27.875 23.44 70-74 19.82 29.439999999999998 27.084999999999997 23.655 75-79 20.28 28.57 27.345000000000002 23.805 80-84 19.955000000000002 28.53 27.58 23.935000000000002 85-89 20.605 28.275 27.465 23.655 90-94 20.79 27.860000000000003 27.765 23.585 95-99 20.845 28.515 27.0 23.64 100-104 20.630000000000003 28.194999999999997 27.72 23.455000000000002 105-109 21.09 28.315 27.11 23.485 110-114 20.78 28.325 27.485 23.41 115-119 20.435 29.43 27.02 23.115 120-124 21.275 27.815 26.44 24.47 125-129 21.735 28.38 26.275 23.61 130-134 21.245 29.310000000000002 25.77 23.674999999999997 135-139 20.965 28.720000000000002 26.745 23.57 140-144 20.765 28.494999999999997 26.045 24.695 145-149 20.674999999999997 28.175 26.395000000000003 24.755 150-151 20.70953992729096 29.321800175504574 25.623668045631188 24.344991851573273 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 3.5 24 4.5 25 5.5 26 6.0 27 7.0 28 13.5 29 19.5 30 21.5 31 26.0 32 40.0 33 55.0 34 64.5 35 72.0 36 88.0 37 103.0 38 129.5 39 162.0 40 187.5 41 223.0 42 234.0 43 242.5 44 272.5 45 275.0 46 251.5 47 239.0 48 212.0 49 191.5 50 175.0 51 136.0 52 114.0 53 100.0 54 85.0 55 64.5 56 47.0 57 36.5 58 26.0 59 20.5 60 18.0 61 11.5 62 4.0 63 2.0 64 2.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.0375 0.0 0.0 0.0 0.0 104-105 2.2750000000000004 0.0 0.0 0.0 0.0 106-107 2.7 0.0 0.0 0.0 0.0 108-109 3.125 0.0 0.0 0.0 0.0 110-111 3.5125 0.0 0.0 0.0 0.0 112-113 3.9124999999999996 0.0 0.0 0.0 0.0 114-115 4.35 0.0 0.0 0.0 0.0 116-117 4.8375 0.0 0.0 0.0 0.0 118-119 5.375 0.0 0.0 0.0 0.0 120-121 5.85 0.0 0.0 0.0 0.0 122-123 6.1875 0.0 0.0 0.0 0.0 124-125 6.5875 0.0 0.0 0.0 0.0 126-127 7.2125 0.0 0.0 0.0 0.0 128-129 7.800000000000001 0.0 0.0 0.0 0.0 130-131 8.3625 0.0 0.0 0.0 0.0 132-133 8.875 0.0 0.0 0.0 0.0 134-135 9.5875 0.0 0.0 0.0 0.0 136-137 10.225000000000001 0.0 0.0 0.0 0.0 138-139 10.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCTT 10 0.0068396386 144.9375 5 TGTTTCT 10 0.0068396386 144.9375 4 GAAGAGC 40 0.007674091 18.117188 140-144 >>END_MODULE SRR7168879 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168879_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9615 33.0 33.0 34.0 32.0 34.0 2 33.12775 34.0 33.0 34.0 33.0 34.0 3 33.125 34.0 33.0 34.0 33.0 34.0 4 33.1185 34.0 33.0 34.0 33.0 34.0 5 33.12775 34.0 33.0 34.0 33.0 34.0 6 37.31 38.0 38.0 38.0 37.0 38.0 7 37.27825 38.0 38.0 38.0 37.0 38.0 8 37.221 38.0 38.0 38.0 37.0 38.0 9 37.2775 38.0 38.0 38.0 37.0 38.0 10-14 37.290800000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.29755 38.0 38.0 38.0 37.0 38.0 20-24 37.22645 38.0 38.0 38.0 37.0 38.0 25-29 37.24245 38.0 38.0 38.0 37.0 38.0 30-34 37.16555 38.0 38.0 38.0 37.0 38.0 35-39 37.17614999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.1531 38.0 38.0 38.0 37.0 38.0 45-49 37.1215 38.0 38.0 38.0 37.0 38.0 50-54 37.024100000000004 38.0 38.0 38.0 36.2 38.0 55-59 36.933949999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.929 38.0 38.0 38.0 36.0 38.0 65-69 36.90525 38.0 38.0 38.0 36.0 38.0 70-74 36.84625 38.0 38.0 38.0 36.0 38.0 75-79 36.713499999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.5079 38.0 38.0 38.0 34.2 38.0 85-89 36.40065 38.0 38.0 38.0 34.0 38.0 90-94 36.3005 38.0 38.0 38.0 34.0 38.0 95-99 36.205 38.0 38.0 38.0 33.8 38.0 100-104 36.11085 38.0 38.0 38.0 33.6 38.0 105-109 35.951 38.0 37.4 38.0 33.0 38.0 110-114 35.6665 38.0 37.0 38.0 31.4 38.0 115-119 35.424 38.0 36.8 38.0 31.0 38.0 120-124 35.00905 38.0 36.0 38.0 28.2 38.0 125-129 34.7002 38.0 35.6 38.0 27.4 38.0 130-134 34.2618 38.0 35.0 38.0 23.8 38.0 135-139 33.64145 38.0 33.8 38.0 21.8 38.0 140-144 32.75235 38.0 33.0 38.0 15.4 38.0 145-149 31.6073 38.0 31.6 38.0 10.2 38.0 150-151 26.974625000000003 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 3.0 11 0.0 12 1.0 13 2.0 14 4.0 15 5.0 16 7.0 17 5.0 18 5.0 19 10.0 20 5.0 21 8.0 22 10.0 23 15.0 24 27.0 25 22.0 26 26.0 27 22.0 28 30.0 29 29.0 30 48.0 31 56.0 32 72.0 33 98.0 34 169.0 35 309.0 36 755.0 37 2250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.625 18.975 15.4 30.0 2 25.6064016004001 23.905976494123532 34.208552138034506 16.27906976744186 3 20.460230115057527 28.114057028514257 32.24112056028014 19.18459229614807 4 22.486243121560783 34.642321160580295 23.08654327163582 19.78489244622311 5 23.686843421710854 36.94347173586793 22.211105552776388 17.158579289644823 6 20.68017004251063 38.03450862715679 22.58064516129032 18.704676169042262 7 19.479869967491872 18.904726181545385 41.53538384596149 20.080020005001252 8 21.76088044022011 23.911955977988995 27.863931965982992 26.463231615807903 9 22.53063265816454 24.781195298824706 29.232308077019255 23.455863965991497 10-14 23.004201680672267 29.416766706682672 26.365546218487395 21.213485394157665 15-19 23.071921576472942 28.02840852255677 27.738321496448936 21.16134840452136 20-24 23.22393436061637 28.091855113067844 27.356413848308986 21.327796678006806 25-29 22.92146073036518 28.169084542271133 28.129064532266135 20.78039019509755 30-34 22.57128564282141 28.224112056028016 28.16408204102051 21.040520260130066 35-39 22.83370022013208 27.831699019411648 28.08184910946568 21.252751650990596 40-44 23.206603301650823 27.598799399699853 28.214107053526767 20.98049024512256 45-49 22.814125650260102 27.591036414565828 28.19127651060424 21.40356142456983 50-54 22.905307388324747 27.60242108949027 28.332749737381825 21.15952178480316 55-59 23.594437775110045 26.965786314525808 28.346338535414166 21.093437374949982 60-64 22.327814735157308 27.114490071525033 28.830090531686093 21.727604661631574 65-69 23.121560780390197 27.838919459729865 27.538769384692348 21.500750375187593 70-74 22.821410705352676 27.848924462231118 28.119059529764883 21.210605302651324 75-79 22.839135654261707 27.43097238895558 28.241296518607445 21.48859543817527 80-84 22.996097268087663 27.469228459921947 28.379865906134295 21.1548083658561 85-89 23.213928357014208 27.7416449869922 28.387032219331598 20.657394436661995 90-94 22.808685211126676 28.53712227336402 27.80168100860516 20.852511506904143 95-99 24.046011502875718 28.107026756689173 27.73693423355839 20.11002750687672 100-104 23.761880940470235 27.46873436718359 28.0040020010005 20.765382691345675 105-109 23.67710313093928 28.39851955586676 27.54326297889367 20.38111433430029 110-114 23.822146643993197 27.838351505451637 27.80334100230069 20.536160848254475 115-119 24.25712856428214 27.6288144072036 27.483741870935468 20.630315157578792 120-124 24.512256128064035 27.883941970985493 27.5687843921961 20.035017508754375 125-129 24.843664015208365 27.10991045074791 27.695232377807795 20.35119315623593 130-134 24.79111422424576 27.45784760094061 27.813078501025668 19.93795967378796 135-139 25.2576288144072 27.913956978489246 26.993496748374184 19.834917458729365 140-144 25.196299074768692 27.4368592148037 27.696924231057764 19.669917479369843 145-149 26.021709769396228 27.527387324295933 26.466910109549296 19.98399279675854 150-151 25.724999999999998 28.625 26.5375 19.112499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 2.5 26 6.0 27 5.5 28 6.5 29 15.0 30 14.5 31 17.0 32 27.0 33 37.5 34 55.5 35 71.5 36 92.5 37 116.5 38 130.5 39 158.0 40 188.0 41 212.5 42 235.5 43 257.0 44 271.0 45 276.0 46 279.0 47 257.0 48 231.5 49 211.0 50 167.5 51 133.0 52 116.0 53 99.5 54 82.0 55 56.5 56 41.5 57 38.5 58 29.0 59 17.5 60 14.0 61 9.5 62 6.0 63 3.0 64 1.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.05 4 0.05 5 0.05 6 0.025 7 0.025 8 0.05 9 0.025 10-14 0.04 15-19 0.03 20-24 0.06 25-29 0.05 30-34 0.05 35-39 0.06 40-44 0.05 45-49 0.04 50-54 0.045 55-59 0.04 60-64 0.034999999999999996 65-69 0.05 70-74 0.05 75-79 0.04 80-84 0.06999999999999999 85-89 0.06 90-94 0.06 95-99 0.025 100-104 0.05 105-109 0.03 110-114 0.03 115-119 0.05 120-124 0.05 125-129 0.055 130-134 0.065 135-139 0.05 140-144 0.025 145-149 0.045 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.45271629778672035 0.8999999999999999 3 0.07545271629778671 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.05 0.0 0.0 0.0 0.0 104-105 2.3 0.0 0.0 0.0 0.0 106-107 2.7249999999999996 0.0 0.0 0.0 0.0 108-109 3.1375 0.0 0.0 0.0 0.0 110-111 3.5125 0.0 0.0 0.0 0.0 112-113 3.9124999999999996 0.0 0.0 0.0 0.0 114-115 4.35 0.0 0.0 0.0 0.0 116-117 4.8125 0.0 0.0 0.0 0.0 118-119 5.35 0.0 0.0 0.0 0.0 120-121 5.85 0.0 0.0 0.0 0.0 122-123 6.1875 0.0 0.0 0.0 0.0 124-125 6.5625 0.0 0.0 0.0 0.0 126-127 7.1625 0.0 0.0 0.0 0.0 128-129 7.7375 0.0 0.0 0.0 0.0 130-131 8.25 0.0 0.0 0.0 0.0 132-133 8.75 0.0 0.0 0.0 0.0 134-135 9.45 0.0 0.0 0.0 0.0 136-137 10.0875 0.0 0.0 0.0 0.0 138-139 10.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAC 20 3.5877043E-4 108.75 1 GAAAACA 30 1.4118372E-5 96.666664 2 >>END_MODULE Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733225 spots for SRR7168879.sra Written 733225 spots for SRR7168879.sra Read 733238 spots for SRR7168879.sra Written 733238 spots for SRR7168879.sra SRR ids: ['SRR7168879.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_960v9gxe SRR7168879.sra spots: 14664513 blocks: [[1, 733225], [733226, 1466450], [1466451, 2199675], [2199676, 2932900], [2932901, 3666125], [3666126, 4399350], [4399351, 5132575], [5132576, 5865800], [5865801, 6599025], [6599026, 7332250], [7332251, 8065475], [8065476, 8798700], [8798701, 9531925], [9531926, 10265150], [10265151, 10998375], [10998376, 11731600], [11731601, 12464825], [12464826, 13198050], [13198051, 13931275], [13931276, 14664513]] SRR7168879 file size 4947621 SRR7168879 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168879 SRR7168879_1.fastq SRR7168879_2.fastq Input file: SRR7168879_1.fastq Paired file: SRR7168879_2.fastq trimmed: SRR7168879-trimmed-pair1.fastq, SRR7168879-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:16:53 2025 >> started Thu Apr 10 15:17:17 2025 >> done (23.599s) 14664513 read pairs processed; of these: 14066 ( 0.10%) short read pairs filtered out after trimming by size control 27949 ( 0.19%) empty read pairs filtered out after trimming by size control 14622498 (99.71%) read pairs available; of these: 8248817 (56.41%) trimmed read pairs available after processing 6373681 (43.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 11 0.00% 21 5 0.00% 22 9 0.00% 23 5 0.00% 24 6 0.00% 25 8 0.00% 26 6 0.00% 27 8 0.00% 28 12 0.00% 29 15 0.00% 30 16 0.00% 31 12 0.00% 32 14 0.00% 33 18 0.00% 34 18 0.00% 35 22 0.00% 36 16 0.00% 37 32 0.00% 38 35 0.00% 39 35 0.00% 40 53 0.00% 41 75 0.00% 42 91 0.00% 43 90 0.00% 44 100 0.00% 45 118 0.00% 46 108 0.00% 47 119 0.00% 48 159 0.00% 49 163 0.00% 50 221 0.00% 51 300 0.00% 52 275 0.00% 53 322 0.00% 54 302 0.00% 55 334 0.00% 56 414 0.00% 57 493 0.00% 58 525 0.00% 59 608 0.00% 60 661 0.00% 61 817 0.01% 62 925 0.01% 63 1041 0.01% 64 1160 0.01% 65 1212 0.01% 66 1323 0.01% 67 1458 0.01% 68 1648 0.01% 69 2002 0.01% 70 2253 0.02% 71 2573 0.02% 72 2879 0.02% 73 3213 0.02% 74 3679 0.03% 75 3872 0.03% 76 4266 0.03% 77 4600 0.03% 78 4859 0.03% 79 5538 0.04% 80 6059 0.04% 81 6768 0.05% 82 7764 0.05% 83 8231 0.06% 84 9773 0.07% 85 10415 0.07% 86 10907 0.07% 87 11472 0.08% 88 12191 0.08% 89 13015 0.09% 90 13834 0.09% 91 14702 0.10% 92 16137 0.11% 93 17306 0.12% 94 18277 0.12% 95 19473 0.13% 96 20095 0.14% 97 20464 0.14% 98 20948 0.14% 99 21889 0.15% 100 22970 0.16% 101 23542 0.16% 102 25351 0.17% 103 26154 0.18% 104 27844 0.19% 105 28752 0.20% 106 30124 0.21% 107 30030 0.21% 108 30604 0.21% 109 31450 0.22% 110 32130 0.22% 111 33031 0.23% 112 34781 0.24% 113 36332 0.25% 114 37711 0.26% 115 39516 0.27% 116 40275 0.28% 117 41030 0.28% 118 41810 0.29% 119 41787 0.29% 120 43480 0.30% 121 44658 0.31% 122 45974 0.31% 123 48281 0.33% 124 49808 0.34% 125 52047 0.36% 126 53707 0.37% 127 55473 0.38% 128 55785 0.38% 129 58033 0.40% 130 59576 0.41% 131 61190 0.42% 132 64230 0.44% 133 67147 0.46% 134 69954 0.48% 135 74099 0.51% 136 77495 0.53% 137 81123 0.55% 138 85587 0.59% 139 90482 0.62% 140 95893 0.66% 141 102873 0.70% 142 112604 0.77% 143 125506 0.86% 144 144380 0.99% 145 170359 1.17% 146 210639 1.44% 147 283416 1.94% 148 424850 2.91% 149 818724 5.60% 150 3531338 24.15% 151 6373681 43.59% 14622498 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=13 prefix-density=0.64 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=505.49 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.62 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=11.04 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.0 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7168879 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:18:03 Started mapping on | Apr 10 15:18:03 Finished on | Apr 10 15:19:47 Mapping speed, Million of reads per hour | 506.16 Number of input reads | 14622498 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13540696 Uniquely mapped reads % | 92.60% Average mapped length | 289.30 Number of splices: Total | 12287098 Number of splices: Annotated (sjdb) | 12041839 Number of splices: GT/AG | 12052199 Number of splices: GC/AG | 196369 Number of splices: AT/AC | 6640 Number of splices: Non-canonical | 31890 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379738 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 40138 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.45% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 712450 712450 712450 N_multimapping 379738 379738 379738 N_noFeature 526319 13222517 746500 N_ambiguous 182152 1469 82966 UnstrandedReadsAssigned:12832225 PositiveStrandReadsAssigned:316710 NegativeStrandReadsAssigned:12711230 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168879 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168879-trimmed-pair1.fastq SRR7168879-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,622,498 reads, 12,760,896 reads pseudoaligned [quant] estimated average fragment length: 229.151 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR7168879.ke.tsv 34699 SRR7168879.se.tsv 87100 total ==> SRR7168879.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.85 322 15.3674 Potri.005G024800.1.v4.1 1035 806.849 152 16.0921 Potri.004G059700.1.v4.1 961 732.875 5 0.582776 Potri.007G009000.2.v4.1 1416 1187.85 0 0 Potri.003G141000.2.v4.1 2943 2714.85 652.328 20.5249 Potri.016G087400.1.v4.1 270 90.9105 499 468.866 Potri.015G069301.1.v4.1 564 340.013 0 0 Potri.010G195200.1.v4.1 1773 1544.85 5 0.276469 Potri.012G127500.1.v4.1 977 748.865 286 32.623 ==> SRR7168879.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 291 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 26 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7168879 completed mapping pipeline successfully