Starting /dee2/code/volunteer_pipeline.sh SRR7168880 current disk space = 3092220153856 free memory = 1575663568 SRR7168880 SRAfilesize 2c68925b85fb4744869f798dd47997fe SRR7168880.sra SRR7168880.sra file validated SRR7168880 is paired end SRR7168880 is conventional basespace SRR7168880 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168880_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14125 34.0 33.0 34.0 32.0 34.0 2 33.02775 34.0 33.0 34.0 32.0 34.0 3 33.216 34.0 33.0 34.0 32.0 34.0 4 33.26225 34.0 33.0 34.0 32.0 34.0 5 33.22925 34.0 33.0 34.0 33.0 34.0 6 36.976 38.0 37.0 38.0 36.0 38.0 7 37.159 38.0 38.0 38.0 36.0 38.0 8 37.33325 38.0 38.0 38.0 37.0 38.0 9 37.347 38.0 38.0 38.0 37.0 38.0 10-14 37.37955 38.0 38.0 38.0 37.0 38.0 15-19 37.3765 38.0 38.0 38.0 37.0 38.0 20-24 37.37195 38.0 38.0 38.0 37.0 38.0 25-29 37.3419 38.0 38.0 38.0 37.0 38.0 30-34 37.3361 38.0 38.0 38.0 37.0 38.0 35-39 37.27785 38.0 38.0 38.0 37.0 38.0 40-44 37.269850000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.1907 38.0 38.0 38.0 36.4 38.0 50-54 37.15395 38.0 38.0 38.0 36.2 38.0 55-59 37.11045 38.0 38.0 38.0 36.0 38.0 60-64 37.0942 38.0 38.0 38.0 36.2 38.0 65-69 36.995450000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.99255 38.0 38.0 38.0 36.0 38.0 75-79 36.8988 38.0 38.0 38.0 35.8 38.0 80-84 36.8573 38.0 38.0 38.0 35.4 38.0 85-89 36.764950000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.63590000000001 38.0 38.0 38.0 34.6 38.0 95-99 36.491049999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.3882 38.0 38.0 38.0 34.0 38.0 105-109 36.147149999999996 38.0 37.4 38.0 33.4 38.0 110-114 36.081649999999996 38.0 37.2 38.0 33.4 38.0 115-119 35.72355 38.0 37.0 38.0 31.4 38.0 120-124 35.592650000000006 38.0 36.2 38.0 31.0 38.0 125-129 35.324200000000005 38.0 36.0 38.0 30.2 38.0 130-134 34.817150000000005 38.0 35.8 38.0 27.8 38.0 135-139 34.393299999999996 38.0 34.0 38.0 26.2 38.0 140-144 33.62825 38.0 33.0 38.0 21.4 38.0 145-149 32.69495 38.0 33.0 38.0 13.4 38.0 150-151 27.90325 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 0.0 16 1.0 17 0.0 18 4.0 19 3.0 20 2.0 21 8.0 22 9.0 23 17.0 24 13.0 25 11.0 26 21.0 27 30.0 28 35.0 29 31.0 30 43.0 31 77.0 32 78.0 33 98.0 34 167.0 35 260.0 36 677.0 37 2409.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.83268482490273 13.09987029831388 11.569390402075227 36.49805447470817 2 21.175 17.925 33.875 27.025 3 20.05 24.175 25.624999999999996 30.15 4 24.2 30.475 22.0 23.325000000000003 5 22.325 34.849999999999994 22.825 20.0 6 18.55 36.675000000000004 25.3 19.475 7 14.625 24.474999999999998 42.575 18.325 8 17.9 24.575 30.45 27.075 9 17.2 25.324999999999996 32.175 25.3 10-14 19.81 29.955 26.979999999999997 23.255 15-19 20.549999999999997 28.34 27.6 23.51 20-24 20.45 28.384999999999998 27.62 23.544999999999998 25-29 20.145 28.51 27.92 23.425 30-34 20.150000000000002 28.4 27.994999999999997 23.455000000000002 35-39 20.435 28.395 27.555000000000003 23.615 40-44 19.82 28.735 28.055000000000003 23.39 45-49 20.365 28.360000000000003 27.455000000000002 23.82 50-54 19.955000000000002 28.58 27.51 23.955000000000002 55-59 20.200000000000003 27.900000000000002 28.09 23.810000000000002 60-64 20.225 28.485 27.805000000000003 23.485 65-69 20.165 28.134999999999998 28.005000000000003 23.695 70-74 20.115 28.155 28.04 23.69 75-79 20.65 27.625 28.055000000000003 23.669999999999998 80-84 19.93 28.285 27.76 24.025 85-89 20.405 28.139999999999997 27.415 24.04 90-94 20.585 28.244999999999997 27.63 23.54 95-99 20.380000000000003 28.305000000000003 27.644999999999996 23.669999999999998 100-104 20.9 28.38 26.995 23.724999999999998 105-109 20.880000000000003 27.965 27.975 23.18 110-114 20.515 28.32 27.73 23.435 115-119 20.72 28.389999999999997 27.450000000000003 23.44 120-124 20.95 28.26 27.35 23.44 125-129 20.815 28.065 27.534999999999997 23.585 130-134 20.905 28.725 27.01 23.36 135-139 21.529999999999998 28.155 27.005000000000003 23.31 140-144 20.455000000000002 28.485 26.685 24.375 145-149 20.919999999999998 28.785 26.465 23.830000000000002 150-151 20.7875 28.425 26.737499999999997 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 2.5 25 6.0 26 8.0 27 4.5 28 6.0 29 9.5 30 12.5 31 21.5 32 28.0 33 36.0 34 51.5 35 79.0 36 104.5 37 114.0 38 140.5 39 177.5 40 192.0 41 212.0 42 238.0 43 250.0 44 265.0 45 260.0 46 247.5 47 239.0 48 236.5 49 218.0 50 169.5 51 133.0 52 113.0 53 95.0 54 78.0 55 58.0 56 48.0 57 42.5 58 25.0 59 21.5 60 19.0 61 11.0 62 5.0 63 2.0 64 1.0 65 1.0 66 1.5 67 1.0 68 1.0 69 2.0 70 1.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6249999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.9749999999999999 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.8375 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.35 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.1375 0.0 0.0 0.0 0.0 136-137 6.8 0.0 0.0 0.0 0.0 138-139 7.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATAGTG 10 0.006836113 144.9625 7 TTTTTTT 30 0.0014459731 24.160418 110-114 >>END_MODULE SRR7168880 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168880_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6295 33.0 33.0 34.0 32.0 34.0 2 32.79975 33.0 33.0 34.0 32.0 34.0 3 32.81575 34.0 33.0 34.0 32.0 34.0 4 32.71625 33.0 33.0 34.0 32.0 34.0 5 32.74875 33.0 33.0 34.0 32.0 34.0 6 36.9195 38.0 38.0 38.0 36.0 38.0 7 36.931 38.0 38.0 38.0 36.0 38.0 8 36.97525 38.0 38.0 38.0 37.0 38.0 9 36.988 38.0 38.0 38.0 36.0 38.0 10-14 36.900200000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.927 38.0 38.0 38.0 36.2 38.0 20-24 36.92495 38.0 38.0 38.0 36.0 38.0 25-29 36.90919999999999 38.0 38.0 38.0 36.2 38.0 30-34 36.922900000000006 38.0 38.0 38.0 36.4 38.0 35-39 36.8743 38.0 38.0 38.0 36.2 38.0 40-44 36.86215 38.0 38.0 38.0 36.0 38.0 45-49 36.8208 38.0 38.0 38.0 36.0 38.0 50-54 36.77785 38.0 38.0 38.0 36.0 38.0 55-59 36.7077 38.0 38.0 38.0 35.8 38.0 60-64 36.70934999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.609300000000005 38.0 38.0 38.0 35.4 38.0 70-74 36.58095 38.0 38.0 38.0 35.0 38.0 75-79 36.46084999999999 38.0 38.0 38.0 34.8 38.0 80-84 36.3464 38.0 38.0 38.0 34.2 38.0 85-89 36.217 38.0 38.0 38.0 34.0 38.0 90-94 36.2032 38.0 38.0 38.0 34.0 38.0 95-99 36.1645 38.0 38.0 38.0 34.0 38.0 100-104 36.079899999999995 38.0 38.0 38.0 33.8 38.0 105-109 35.9658 38.0 38.0 38.0 33.4 38.0 110-114 35.63099999999999 38.0 37.0 38.0 31.4 38.0 115-119 35.5299 38.0 37.0 38.0 31.2 38.0 120-124 35.305499999999995 38.0 36.8 38.0 29.8 38.0 125-129 35.1126 38.0 36.2 38.0 29.4 38.0 130-134 34.61375 38.0 35.6 38.0 26.6 38.0 135-139 34.16335 38.0 34.6 38.0 24.6 38.0 140-144 33.53805 38.0 33.0 38.0 20.8 38.0 145-149 32.26115 38.0 33.0 38.0 10.6 38.0 150-151 27.33775 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 1.0 5 3.0 6 3.0 7 2.0 8 2.0 9 2.0 10 4.0 11 2.0 12 6.0 13 0.0 14 4.0 15 5.0 16 10.0 17 1.0 18 6.0 19 7.0 20 8.0 21 7.0 22 15.0 23 14.0 24 15.0 25 11.0 26 27.0 27 35.0 28 42.0 29 37.0 30 49.0 31 59.0 32 67.0 33 80.0 34 148.0 35 240.0 36 570.0 37 2507.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.425 19.175 15.25 25.15 2 25.525 26.400000000000002 30.375000000000004 17.7 3 20.375 29.075 32.0 18.55 4 23.525 34.625 22.25 19.6 5 24.625 37.1 21.725 16.55 6 20.855213803450862 38.33458364591148 22.705676419104776 18.104526131532882 7 19.075 20.349999999999998 40.1 20.474999999999998 8 21.125 24.925 27.35 26.6 9 23.175 24.125 29.025000000000002 23.674999999999997 10-14 23.474999999999998 28.525 26.064999999999998 21.935 15-19 23.125 27.675 28.265 20.935000000000002 20-24 23.401170058502927 28.646432321616082 27.461373068653433 20.49102455122756 25-29 22.862286228622864 28.637863786378638 27.912791279127912 20.587058705870586 30-34 22.81614080704035 28.32141607080354 28.201410070503524 20.661033051652584 35-39 23.584716943388678 27.690538107621528 28.020604120824167 20.70414082816563 40-44 23.248487273090966 28.039205880882136 27.509126368955343 21.203180477071562 45-49 23.081154057702886 28.331416570828544 27.67138356917846 20.916045802290114 50-54 23.06 28.365000000000002 27.74 20.835 55-59 23.163474521178177 27.849177376606495 28.084212631894783 20.903135470320546 60-64 23.275000000000002 27.85 27.815 21.060000000000002 65-69 23.25465093018604 27.70554110822164 27.70554110822164 21.33426685337067 70-74 23.849769953990798 27.665533106621325 27.430486097219443 21.054210842168434 75-79 23.170792698174544 27.806951737934483 28.042010502625658 20.980245061265315 80-84 23.338500775116266 28.104215632344854 27.53413011951793 21.023153473020955 85-89 23.931965982991496 27.768884442221108 27.158579289644823 21.14057028514257 90-94 23.983394187965786 27.494623118091333 27.284549592357326 21.237433101585555 95-99 23.44555049772398 28.082637186734033 27.22225001250563 21.249562303036367 100-104 23.318161356474768 28.10983844345521 27.73970889811434 20.832291301955685 105-109 23.507052115634693 28.22846854056217 28.048414524357305 20.216064819445833 110-114 23.840728327747488 27.807513381021458 27.502376069231154 20.8493822219999 115-119 24.087226167850357 28.128438531559468 27.6332899869961 20.15104531359408 120-124 24.592377713313994 28.258477543262977 27.283184955486643 19.86595978793638 125-129 24.36609152288072 27.781945486371594 27.29682420605151 20.555138784696176 130-134 24.79487692615569 27.836702021212727 26.95117070242145 20.417250350210125 135-139 24.757378689344673 27.823911955977987 27.26863431715858 20.150075037518757 140-144 25.01750525157547 27.91337401220366 27.193157947384215 19.875962788836652 145-149 25.780312124849942 27.74109643857543 26.755702280912363 19.722889155662266 150-151 25.512756378189096 27.301150575287643 27.388694347173587 19.797398699349674 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 0.5 23 0.0 24 1.5 25 2.5 26 1.5 27 1.5 28 2.0 29 4.0 30 10.5 31 15.5 32 22.0 33 31.0 34 37.0 35 47.0 36 72.5 37 108.5 38 142.5 39 177.0 40 215.5 41 242.0 42 267.5 43 276.0 44 268.0 45 273.5 46 269.5 47 240.5 48 228.0 49 209.5 50 172.5 51 136.0 52 98.5 53 86.5 54 82.5 55 69.0 56 51.0 57 38.5 58 27.0 59 19.5 60 12.0 61 9.0 62 8.5 63 6.5 64 4.5 65 1.0 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.01 30-34 0.005 35-39 0.02 40-44 0.015 45-49 0.005 50-54 0.0 55-59 0.015 60-64 0.0 65-69 0.02 70-74 0.02 75-79 0.025 80-84 0.015 85-89 0.05 90-94 0.034999999999999996 95-99 0.045 100-104 0.034999999999999996 105-109 0.03 110-114 0.045 115-119 0.03 120-124 0.03 125-129 0.025 130-134 0.06 135-139 0.05 140-144 0.03 145-149 0.04 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7824331145885917 1.55 3 0.05047955577990913 0.15 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.175 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.2125 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 5.9875 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAGA 10 0.006830828 145.0 145 TTAATTC 10 0.006830828 145.0 7 >>END_MODULE Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967175 spots for SRR7168880.sra Written 967175 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra Read 967170 spots for SRR7168880.sra Written 967170 spots for SRR7168880.sra SRR ids: ['SRR7168880.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sk0jaw0m SRR7168880.sra spots: 19343405 blocks: [[1, 967170], [967171, 1934340], [1934341, 2901510], [2901511, 3868680], [3868681, 4835850], [4835851, 5803020], [5803021, 6770190], [6770191, 7737360], [7737361, 8704530], [8704531, 9671700], [9671701, 10638870], [10638871, 11606040], [11606041, 12573210], [12573211, 13540380], [13540381, 14507550], [14507551, 15474720], [15474721, 16441890], [16441891, 17409060], [17409061, 18376230], [18376231, 19343405]] SRR7168880 file size 6533144 SRR7168880 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168880 SRR7168880_1.fastq SRR7168880_2.fastq Input file: SRR7168880_1.fastq Paired file: SRR7168880_2.fastq trimmed: SRR7168880-trimmed-pair1.fastq, SRR7168880-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 20:00:50 2025 >> started Sat Feb 15 20:11:47 2025 >> done (657.945s) 19343405 read pairs processed; of these: 32525 ( 0.17%) short read pairs filtered out after trimming by size control 39688 ( 0.21%) empty read pairs filtered out after trimming by size control 19271192 (99.63%) read pairs available; of these: 10639598 (55.21%) trimmed read pairs available after processing 8631594 (44.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 7 0.00% 22 9 0.00% 23 8 0.00% 24 16 0.00% 25 5 0.00% 26 12 0.00% 27 7 0.00% 28 7 0.00% 29 10 0.00% 30 13 0.00% 31 11 0.00% 32 12 0.00% 33 19 0.00% 34 19 0.00% 35 22 0.00% 36 26 0.00% 37 27 0.00% 38 24 0.00% 39 25 0.00% 40 40 0.00% 41 42 0.00% 42 41 0.00% 43 57 0.00% 44 61 0.00% 45 66 0.00% 46 69 0.00% 47 81 0.00% 48 79 0.00% 49 94 0.00% 50 103 0.00% 51 110 0.00% 52 119 0.00% 53 143 0.00% 54 157 0.00% 55 172 0.00% 56 191 0.00% 57 212 0.00% 58 242 0.00% 59 303 0.00% 60 319 0.00% 61 402 0.00% 62 420 0.00% 63 471 0.00% 64 546 0.00% 65 622 0.00% 66 703 0.00% 67 838 0.00% 68 1012 0.01% 69 2247 0.01% 70 1849 0.01% 71 1389 0.01% 72 1500 0.01% 73 1693 0.01% 74 1960 0.01% 75 2087 0.01% 76 2361 0.01% 77 2490 0.01% 78 2873 0.01% 79 3123 0.02% 80 3680 0.02% 81 4115 0.02% 82 4777 0.02% 83 5400 0.03% 84 6763 0.04% 85 7750 0.04% 86 8210 0.04% 87 9055 0.05% 88 9625 0.05% 89 9969 0.05% 90 10553 0.05% 91 11430 0.06% 92 12491 0.06% 93 13730 0.07% 94 14835 0.08% 95 15824 0.08% 96 16345 0.08% 97 17306 0.09% 98 18163 0.09% 99 18932 0.10% 100 20268 0.11% 101 21126 0.11% 102 23009 0.12% 103 24439 0.13% 104 26100 0.14% 105 27339 0.14% 106 28511 0.15% 107 29837 0.15% 108 30945 0.16% 109 31981 0.17% 110 32895 0.17% 111 34156 0.18% 112 36071 0.19% 113 38298 0.20% 114 40223 0.21% 115 42005 0.22% 116 43258 0.22% 117 44852 0.23% 118 45703 0.24% 119 46954 0.24% 120 47904 0.25% 121 50176 0.26% 122 51973 0.27% 123 54796 0.28% 124 57897 0.30% 125 60088 0.31% 126 62587 0.32% 127 64929 0.34% 128 66874 0.35% 129 68827 0.36% 130 71316 0.37% 131 74664 0.39% 132 77699 0.40% 133 82338 0.43% 134 86613 0.45% 135 91982 0.48% 136 97167 0.50% 137 103470 0.54% 138 109863 0.57% 139 115945 0.60% 140 124686 0.65% 141 136350 0.71% 142 150160 0.78% 143 169565 0.88% 144 197772 1.03% 145 234395 1.22% 146 294144 1.53% 147 390210 2.02% 148 581556 3.02% 149 1116400 5.79% 150 4828754 25.06% 151 8631594 44.79% 19271192 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=14 prefix-density=0.51 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=301.82 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=18 prefix-density=0.90 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=45.59 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.6 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGT SRR7168880 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 21:02:21 Started mapping on | Feb 15 21:02:35 Finished on | Feb 15 23:04:24 Mapping speed, Million of reads per hour | 9.49 Number of input reads | 19271192 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17886559 Uniquely mapped reads % | 92.82% Average mapped length | 291.94 Number of splices: Total | 17459740 Number of splices: Annotated (sjdb) | 17075225 Number of splices: GT/AG | 17127035 Number of splices: GC/AG | 275387 Number of splices: AT/AC | 9880 Number of splices: Non-canonical | 47438 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 531624 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 209984 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 876711 876711 876711 N_multimapping 531624 531624 531624 N_noFeature 623850 17523218 787357 N_ambiguous 326885 1563 125986 UnstrandedReadsAssigned:16935824 PositiveStrandReadsAssigned:361778 NegativeStrandReadsAssigned:16973216 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168880 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168880-trimmed-pair1.fastq SRR7168880-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,271,192 reads, 17,105,039 reads pseudoaligned [quant] estimated average fragment length: 235.8 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52401 SRR7168880.ke.tsv 34699 SRR7168880.se.tsv 87100 total ==> SRR7168880.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.2 990 28.2446 Potri.005G024800.1.v4.1 1035 800.2 203 12.9062 Potri.004G059700.1.v4.1 961 726.221 13 0.9107 Potri.007G009000.2.v4.1 1416 1181.2 0 0 Potri.003G141000.2.v4.1 2943 2708.2 1283.44 24.1099 Potri.016G087400.1.v4.1 270 84.5084 1271 765.15 Potri.015G069301.1.v4.1 564 333.759 0 0 Potri.010G195200.1.v4.1 1773 1538.2 76 2.51363 Potri.012G127500.1.v4.1 977 742.211 90 6.16902 ==> SRR7168880.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 708 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 333 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 35 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7168880 completed mapping pipeline successfully