Starting /dee2/code/volunteer_pipeline.sh SRR7168881 current disk space = 3092125097984 free memory = 1570544116 SRR7168881 SRAfilesize 4b05f82b782d6c335ff713b3b8034e24 SRR7168881.sra SRR7168881.sra file validated SRR7168881 is paired end SRR7168881 is conventional basespace SRR7168881 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168881_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43975 34.0 34.0 34.0 33.0 34.0 2 33.43675 34.0 34.0 34.0 33.0 34.0 3 33.55525 34.0 34.0 34.0 33.0 34.0 4 33.55925 34.0 34.0 34.0 33.0 34.0 5 33.583 34.0 34.0 34.0 33.0 34.0 6 37.40025 38.0 38.0 38.0 37.0 38.0 7 37.5095 38.0 38.0 38.0 37.0 38.0 8 37.6145 38.0 38.0 38.0 38.0 38.0 9 37.69475 38.0 38.0 38.0 38.0 38.0 10-14 37.6922 38.0 38.0 38.0 38.0 38.0 15-19 37.67755 38.0 38.0 38.0 38.0 38.0 20-24 37.6579 38.0 38.0 38.0 38.0 38.0 25-29 37.6115 38.0 38.0 38.0 38.0 38.0 30-34 37.63145 38.0 38.0 38.0 38.0 38.0 35-39 37.59285 38.0 38.0 38.0 38.0 38.0 40-44 37.5538 38.0 38.0 38.0 38.0 38.0 45-49 37.5305 38.0 38.0 38.0 38.0 38.0 50-54 37.55395 38.0 38.0 38.0 38.0 38.0 55-59 37.475699999999996 38.0 38.0 38.0 37.8 38.0 60-64 37.4482 38.0 38.0 38.0 37.2 38.0 65-69 37.36735 38.0 38.0 38.0 37.0 38.0 70-74 37.32535 38.0 38.0 38.0 37.0 38.0 75-79 37.25085 38.0 38.0 38.0 37.0 38.0 80-84 37.16515 38.0 38.0 38.0 36.6 38.0 85-89 37.05085 38.0 38.0 38.0 36.0 38.0 90-94 37.02825 38.0 38.0 38.0 36.0 38.0 95-99 36.90925 38.0 38.0 38.0 35.8 38.0 100-104 36.787850000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.6869 38.0 38.0 38.0 35.0 38.0 110-114 36.4659 38.0 38.0 38.0 34.2 38.0 115-119 36.28520000000001 38.0 37.8 38.0 33.8 38.0 120-124 36.08725 38.0 37.4 38.0 33.2 38.0 125-129 35.83540000000001 38.0 37.0 38.0 32.6 38.0 130-134 35.5736 38.0 36.0 38.0 31.0 38.0 135-139 35.21115 38.0 35.8 38.0 30.4 38.0 140-144 34.6965 38.0 35.0 38.0 28.8 38.0 145-149 33.958999999999996 38.0 33.0 38.0 25.4 38.0 150-151 29.43625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 3.0 17 2.0 18 5.0 19 2.0 20 4.0 21 2.0 22 3.0 23 7.0 24 5.0 25 9.0 26 9.0 27 9.0 28 16.0 29 23.0 30 33.0 31 42.0 32 58.0 33 79.0 34 114.0 35 203.0 36 584.0 37 2785.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.847572059205405 12.749935081796938 11.867047520124643 38.53544533887302 2 22.525000000000002 16.525000000000002 33.675 27.275 3 20.25 21.15 25.75 32.85 4 23.425 29.375 21.925 25.275 5 22.316737553164874 34.32574430823117 23.842882161621215 19.514635976982735 6 19.025 36.625 24.474999999999998 19.875 7 13.25 25.724999999999998 42.225 18.8 8 17.474999999999998 26.450000000000003 29.375 26.700000000000003 9 17.05 24.425 35.3 23.225 10-14 19.88 29.544999999999998 27.189999999999998 23.385 15-19 19.505 28.935 27.575 23.985 20-24 19.900000000000002 28.999999999999996 27.305 23.794999999999998 25-29 19.465 28.84 28.08 23.615 30-34 19.67188515980593 29.045165808032813 27.669684389536336 23.613264642624916 35-39 19.720986049302468 28.981449072453625 27.406370318515926 23.891194559727985 40-44 20.055 29.635 27.425 22.884999999999998 45-49 20.064999999999998 28.73 27.584999999999997 23.62 50-54 19.650000000000002 28.389999999999997 27.725 24.235 55-59 19.805 28.57 27.72 23.905 60-64 20.345 28.03 28.035 23.59 65-69 20.015 28.24 28.095 23.65 70-74 19.885 28.965000000000003 27.425 23.724999999999998 75-79 19.61 28.665000000000003 27.915 23.810000000000002 80-84 20.13 28.955 27.534999999999997 23.380000000000003 85-89 20.285 28.105000000000004 27.57 24.04 90-94 20.145 28.08 27.450000000000003 24.325 95-99 20.535 28.57 27.67 23.225 100-104 20.150000000000002 28.49 27.595 23.765 105-109 20.64 28.02 27.48 23.86 110-114 20.979999999999997 28.34 27.800000000000004 22.88 115-119 20.575 28.57 27.284999999999997 23.57 120-124 21.12 28.325 26.99 23.565 125-129 20.84 28.265 26.36 24.535 130-134 20.849999999999998 28.299999999999997 26.895000000000003 23.955000000000002 135-139 20.87 28.884999999999998 26.595000000000002 23.65 140-144 21.060000000000002 27.944999999999997 26.355 24.64 145-149 20.525 28.315 26.834999999999997 24.325 150-151 20.7428786547873 28.83674237670975 26.389760321244825 24.030618647258127 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 1.5 24 2.0 25 3.0 26 6.0 27 8.5 28 9.0 29 13.5 30 18.5 31 25.0 32 35.0 33 44.0 34 54.5 35 67.5 36 95.0 37 129.5 38 147.0 39 165.5 40 190.5 41 213.5 42 229.5 43 264.0 44 275.0 45 257.5 46 273.0 47 260.0 48 212.0 49 188.5 50 177.5 51 146.0 52 111.5 53 86.0 54 68.0 55 60.0 56 47.5 57 31.0 58 22.5 59 17.0 60 10.5 61 9.0 62 8.5 63 5.0 64 2.0 65 1.0 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.7249999999999996 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.034999999999999996 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39516129032258 98.6 2 0.4788306451612903 0.95 3 0.05040322580645161 0.15 4 0.07560483870967742 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.2 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.575 0.0 0.0 0.0 0.0 118-119 3.85 0.0 0.0 0.0 0.0 120-121 4.237500000000001 0.0 0.0 0.0 0.0 122-123 4.550000000000001 0.0 0.0 0.0 0.0 124-125 4.95 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 6.1375 0.0 0.0 0.0 0.0 130-131 6.7125 0.0 0.0 0.0 0.0 132-133 7.1 0.0 0.0 0.0 0.0 134-135 7.5125 0.0 0.0 0.0 0.0 136-137 8.125 0.0 0.0 0.0 0.0 138-139 8.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168881 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168881_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0935 33.0 33.0 34.0 32.0 34.0 2 33.15725 34.0 33.0 34.0 33.0 34.0 3 33.18775 34.0 33.0 34.0 33.0 34.0 4 33.196 34.0 33.0 34.0 33.0 34.0 5 33.212 34.0 33.0 34.0 33.0 34.0 6 37.36575 38.0 38.0 38.0 38.0 38.0 7 37.4405 38.0 38.0 38.0 38.0 38.0 8 37.2965 38.0 38.0 38.0 38.0 38.0 9 37.4115 38.0 38.0 38.0 38.0 38.0 10-14 37.3697 38.0 38.0 38.0 38.0 38.0 15-19 37.396550000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.373 38.0 38.0 38.0 38.0 38.0 25-29 37.342549999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.3463 38.0 38.0 38.0 37.8 38.0 35-39 37.3178 38.0 38.0 38.0 38.0 38.0 40-44 37.317699999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.3298 38.0 38.0 38.0 38.0 38.0 50-54 37.2723 38.0 38.0 38.0 37.8 38.0 55-59 37.28875 38.0 38.0 38.0 37.2 38.0 60-64 37.24565 38.0 38.0 38.0 37.2 38.0 65-69 37.1586 38.0 38.0 38.0 37.0 38.0 70-74 37.10209999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.0697 38.0 38.0 38.0 37.0 38.0 80-84 36.95334999999999 38.0 38.0 38.0 36.6 38.0 85-89 36.83290000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.813 38.0 38.0 38.0 36.0 38.0 95-99 36.73975 38.0 38.0 38.0 36.0 38.0 100-104 36.67065 38.0 38.0 38.0 35.6 38.0 105-109 36.62355 38.0 38.0 38.0 35.0 38.0 110-114 36.4472 38.0 38.0 38.0 34.4 38.0 115-119 36.284850000000006 38.0 38.0 38.0 34.0 38.0 120-124 36.07000000000001 38.0 38.0 38.0 33.8 38.0 125-129 35.92865 38.0 37.8 38.0 33.6 38.0 130-134 35.586800000000004 38.0 36.8 38.0 32.2 38.0 135-139 35.04019999999999 38.0 36.0 38.0 30.2 38.0 140-144 34.7062 38.0 36.0 38.0 28.6 38.0 145-149 33.777849999999994 38.0 34.4 38.0 23.2 38.0 150-151 28.648875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 2.0 11 1.0 12 2.0 13 2.0 14 4.0 15 5.0 16 3.0 17 10.0 18 4.0 19 2.0 20 6.0 21 8.0 22 14.0 23 11.0 24 5.0 25 14.0 26 9.0 27 15.0 28 17.0 29 20.0 30 24.0 31 29.0 32 52.0 33 64.0 34 115.0 35 168.0 36 477.0 37 2908.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.525 18.7 16.825000000000003 27.950000000000003 2 27.224999999999998 25.85 30.7 16.225 3 20.775 29.349999999999998 29.625 20.25 4 24.85 33.725 22.775000000000002 18.65 5 25.4 35.35 22.225 17.025000000000002 6 21.916437327995997 36.527395546659996 23.992994746059544 17.563172379284463 7 19.46459844883663 20.965724293219914 39.229422066549915 20.340255191393545 8 22.280570142535634 25.98149537384346 26.206551637909474 25.531382845711427 9 22.56128064032016 25.212606303151574 28.939469734867433 23.28664332166083 10-14 23.799279567740644 28.38202921753052 26.691014608765258 21.12767660596358 15-19 22.902176632474355 28.55141356017013 27.710783087315487 20.83562672004003 20-24 23.212409306980238 28.331248436327243 27.74080560420315 20.715536652489366 25-29 23.282118012111503 27.876482658525596 28.03663480306291 20.804764526299984 30-34 23.143143143143146 28.48848848848849 27.78778778778779 20.58058058058058 35-39 23.510563732852706 28.021427856213077 27.605887653950134 20.86212075698408 40-44 23.981787251075755 28.1346942860002 27.879515660962674 20.004002801961374 45-49 23.905976494123532 27.596899224806204 27.991997999499873 20.505126281570394 50-54 23.09539292681707 28.132659696863588 27.86754039317693 20.904406983142415 55-59 23.23626538577004 27.709396577604323 27.729410587411184 21.32492744921445 60-64 23.6291775065039 28.437062237342403 27.52651590954573 20.407244346607964 65-69 23.80166116281397 27.944561192834982 28.104673271289904 20.149104373061142 70-74 24.022821680596568 28.001601521445373 27.2108503077924 20.764726490165657 75-79 23.3163214249975 27.809466626638645 28.049634744321022 20.82457720404283 80-84 24.197827501626872 27.77193772838765 28.03724282925364 19.99299194073184 85-89 23.876263890279308 27.71548703573931 27.665431975172687 20.74281709880869 90-94 23.789273564138483 27.891735041024614 27.721632979787874 20.59735841504903 95-99 23.72093023255814 28.27706926731683 27.6419104776194 20.360090022505624 100-104 24.021005251312825 27.701925481370342 27.636909227306827 20.640160040010002 105-109 23.72830490671735 27.9697894262992 27.76471765117791 20.537188015805533 110-114 23.977193157947386 28.15344603381014 27.80334100230069 20.06601980594178 115-119 24.621003652374043 28.20833541802171 27.73802971931756 19.432631210286686 120-124 23.801421279151235 28.36552897607847 27.409668701831645 20.423381042938647 125-129 24.572114903413073 28.28045240716645 27.23451105995396 19.91292162946652 130-134 24.91368526394796 27.950963222416814 27.290467850888167 19.84488366274706 135-139 25.2326628640048 28.414890423296306 27.113979785850095 19.238466926848794 140-144 25.013754814184963 27.679687890761766 27.034462061721605 20.272095233331665 145-149 25.909250087548152 28.055430486767722 26.87478112962129 19.160538296062835 150-151 25.662499999999998 28.9375 27.150000000000002 18.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 1.0 24 1.0 25 1.0 26 1.5 27 3.5 28 7.0 29 7.0 30 8.0 31 17.0 32 23.5 33 34.0 34 44.5 35 59.5 36 76.0 37 96.5 38 129.0 39 167.0 40 205.5 41 229.0 42 247.0 43 280.0 44 296.5 45 283.5 46 281.5 47 265.5 48 224.5 49 200.5 50 175.5 51 127.0 52 94.5 53 90.5 54 88.5 55 67.5 56 43.5 57 34.5 58 25.0 59 14.5 60 11.5 61 9.5 62 7.5 63 5.0 64 2.0 65 1.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.075 8 0.025 9 0.05 10-14 0.06 15-19 0.075 20-24 0.075 25-29 0.095 30-34 0.1 35-39 0.13 40-44 0.06999999999999999 45-49 0.025 50-54 0.045 55-59 0.06999999999999999 60-64 0.06 65-69 0.06999999999999999 70-74 0.095 75-79 0.06999999999999999 80-84 0.11499999999999999 85-89 0.11 90-94 0.06 95-99 0.025 100-104 0.025 105-109 0.034999999999999996 110-114 0.03 115-119 0.065 120-124 0.09 125-129 0.09 130-134 0.075 135-139 0.06999999999999999 140-144 0.034999999999999996 145-149 0.055 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.4027183488547697 0.8 3 0.10067958721369243 0.3 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3875000000000002 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.9874999999999998 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.975 0.0 0.0 0.0 0.0 116-117 3.65 0.0 0.0 0.0 0.0 118-119 3.95 0.0 0.0 0.0 0.0 120-121 4.35 0.0 0.0 0.0 0.0 122-123 4.6625 0.0 0.0 0.0 0.0 124-125 5.05 0.0 0.0 0.0 0.0 126-127 5.625 0.0 0.0 0.0 0.0 128-129 6.2625 0.0 0.0 0.0 0.0 130-131 6.8375 0.0 0.0 0.0 0.0 132-133 7.25 0.0 0.0 0.0 0.0 134-135 7.675000000000001 0.0 0.0 0.0 0.0 136-137 8.25 0.0 0.0 0.0 0.0 138-139 8.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551286 spots for SRR7168881.sra Written 551286 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra Read 551283 spots for SRR7168881.sra Written 551283 spots for SRR7168881.sra SRR ids: ['SRR7168881.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fv2qz9z6 SRR7168881.sra spots: 11025663 blocks: [[1, 551283], [551284, 1102566], [1102567, 1653849], [1653850, 2205132], [2205133, 2756415], [2756416, 3307698], [3307699, 3858981], [3858982, 4410264], [4410265, 4961547], [4961548, 5512830], [5512831, 6064113], [6064114, 6615396], [6615397, 7166679], [7166680, 7717962], [7717963, 8269245], [8269246, 8820528], [8820529, 9371811], [9371812, 9923094], [9923095, 10474377], [10474378, 11025663]] SRR7168881 file size 3714535 SRR7168881 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168881 SRR7168881_1.fastq SRR7168881_2.fastq Input file: SRR7168881_1.fastq Paired file: SRR7168881_2.fastq trimmed: SRR7168881-trimmed-pair1.fastq, SRR7168881-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 18:23:25 2025 >> started Sat Feb 15 18:31:47 2025 >> done (502.315s) 11025663 read pairs processed; of these: 15584 ( 0.14%) short read pairs filtered out after trimming by size control 29722 ( 0.27%) empty read pairs filtered out after trimming by size control 10980357 (99.59%) read pairs available; of these: 5714764 (52.05%) trimmed read pairs available after processing 5265593 (47.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 3 0.00% 21 4 0.00% 22 8 0.00% 23 2 0.00% 24 5 0.00% 25 6 0.00% 26 4 0.00% 27 4 0.00% 28 5 0.00% 29 5 0.00% 30 13 0.00% 31 10 0.00% 32 3 0.00% 33 6 0.00% 34 7 0.00% 35 8 0.00% 36 10 0.00% 37 15 0.00% 38 10 0.00% 39 13 0.00% 40 11 0.00% 41 21 0.00% 42 18 0.00% 43 18 0.00% 44 23 0.00% 45 33 0.00% 46 40 0.00% 47 43 0.00% 48 38 0.00% 49 58 0.00% 50 57 0.00% 51 68 0.00% 52 70 0.00% 53 91 0.00% 54 83 0.00% 55 110 0.00% 56 112 0.00% 57 121 0.00% 58 161 0.00% 59 153 0.00% 60 207 0.00% 61 229 0.00% 62 250 0.00% 63 279 0.00% 64 289 0.00% 65 360 0.00% 66 443 0.00% 67 482 0.00% 68 637 0.01% 69 1740 0.02% 70 1811 0.02% 71 1042 0.01% 72 1068 0.01% 73 1174 0.01% 74 1281 0.01% 75 1369 0.01% 76 1492 0.01% 77 1640 0.01% 78 1753 0.02% 79 2002 0.02% 80 2152 0.02% 81 2424 0.02% 82 2912 0.03% 83 3164 0.03% 84 3908 0.04% 85 4494 0.04% 86 4922 0.04% 87 5176 0.05% 88 5711 0.05% 89 6026 0.05% 90 6563 0.06% 91 7158 0.07% 92 7657 0.07% 93 8426 0.08% 94 9123 0.08% 95 9760 0.09% 96 10221 0.09% 97 11020 0.10% 98 11405 0.10% 99 11824 0.11% 100 12711 0.12% 101 13170 0.12% 102 14250 0.13% 103 15089 0.14% 104 16082 0.15% 105 16866 0.15% 106 17637 0.16% 107 18274 0.17% 108 19033 0.17% 109 19672 0.18% 110 20116 0.18% 111 21279 0.19% 112 22035 0.20% 113 23227 0.21% 114 24206 0.22% 115 25408 0.23% 116 26416 0.24% 117 27305 0.25% 118 28119 0.26% 119 28411 0.26% 120 29418 0.27% 121 29991 0.27% 122 30788 0.28% 123 32031 0.29% 124 34303 0.31% 125 35392 0.32% 126 37002 0.34% 127 37713 0.34% 128 39080 0.36% 129 39496 0.36% 130 40727 0.37% 131 42319 0.39% 132 43577 0.40% 133 45465 0.41% 134 47100 0.43% 135 49232 0.45% 136 51980 0.47% 137 54651 0.50% 138 56909 0.52% 139 60124 0.55% 140 63558 0.58% 141 67767 0.62% 142 73395 0.67% 143 80830 0.74% 144 91737 0.84% 145 106830 0.97% 146 131435 1.20% 147 173423 1.58% 148 265244 2.42% 149 531368 4.84% 150 2727497 24.84% 151 5265593 47.95% 10980357 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=94.23 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=11.9 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=23 prefix-density=0.47 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=26.34 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7168881 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 18:55:32 Started mapping on | Feb 15 18:55:51 Finished on | Feb 15 20:58:00 Mapping speed, Million of reads per hour | 5.39 Number of input reads | 10980357 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10298726 Uniquely mapped reads % | 93.79% Average mapped length | 291.89 Number of splices: Total | 9750875 Number of splices: Annotated (sjdb) | 9524448 Number of splices: GT/AG | 9561164 Number of splices: GC/AG | 157441 Number of splices: AT/AC | 5532 Number of splices: Non-canonical | 26738 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264342 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 23194 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 426805 426805 426805 N_multimapping 264342 264342 264342 N_noFeature 358248 10061456 478366 N_ambiguous 186078 917 68313 UnstrandedReadsAssigned:9754400 PositiveStrandReadsAssigned:236353 NegativeStrandReadsAssigned:9752047 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168881 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168881-trimmed-pair1.fastq SRR7168881-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,980,357 reads, 9,722,355 reads pseudoaligned [quant] estimated average fragment length: 226.963 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 969 rounds 52401 SRR7168881.ke.tsv 34699 SRR7168881.se.tsv 87100 total ==> SRR7168881.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.04 458 24.1013 Potri.005G024800.1.v4.1 1035 809.037 244 28.441 Potri.004G059700.1.v4.1 961 735.058 27 3.4639 Potri.007G009000.2.v4.1 1416 1190.04 0 0 Potri.003G141000.2.v4.1 2943 2717.04 595.388 20.6646 Potri.016G087400.1.v4.1 270 86.961 486 527.029 Potri.015G069301.1.v4.1 564 341.578 0 0 Potri.010G195200.1.v4.1 1773 1547.04 22 1.34105 Potri.012G127500.1.v4.1 977 751.053 283 35.5336 ==> SRR7168881.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 721 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 254 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7168881 completed mapping pipeline successfully