Starting /dee2/code/volunteer_pipeline.sh SRR7168882 current disk space = 3092227780608 free memory = 1571808060 SRR7168882 SRAfilesize 9dcd34448914a17ac1367ef7d4cdd7b0 SRR7168882.sra SRR7168882.sra file validated SRR7168882 is paired end SRR7168882 is conventional basespace SRR7168882 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168882_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6265 34.0 33.0 34.0 32.0 34.0 2 33.17725 34.0 33.0 34.0 32.0 34.0 3 33.3485 34.0 33.0 34.0 33.0 34.0 4 33.40175 34.0 33.0 34.0 33.0 34.0 5 33.468 34.0 34.0 34.0 33.0 34.0 6 37.205 38.0 38.0 38.0 36.0 38.0 7 37.361 38.0 38.0 38.0 37.0 38.0 8 37.55125 38.0 38.0 38.0 37.0 38.0 9 37.45925 38.0 38.0 38.0 37.0 38.0 10-14 37.5587 38.0 38.0 38.0 37.8 38.0 15-19 37.55105 38.0 38.0 38.0 37.8 38.0 20-24 37.52735 38.0 38.0 38.0 37.8 38.0 25-29 37.56955 38.0 38.0 38.0 38.0 38.0 30-34 37.51180000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.49145 38.0 38.0 38.0 37.8 38.0 40-44 37.427949999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.42465 38.0 38.0 38.0 37.0 38.0 50-54 37.39955 38.0 38.0 38.0 37.0 38.0 55-59 37.3565 38.0 38.0 38.0 37.0 38.0 60-64 37.3437 38.0 38.0 38.0 37.0 38.0 65-69 37.282599999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.2525 38.0 38.0 38.0 37.0 38.0 75-79 37.155950000000004 38.0 38.0 38.0 36.4 38.0 80-84 37.072199999999995 38.0 38.0 38.0 36.0 38.0 85-89 37.000350000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.877750000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.789699999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.7256 38.0 38.0 38.0 35.0 38.0 105-109 36.576800000000006 38.0 38.0 38.0 34.2 38.0 110-114 36.4795 38.0 38.0 38.0 34.2 38.0 115-119 36.3981 38.0 38.0 38.0 34.2 38.0 120-124 36.01985 38.0 37.2 38.0 33.2 38.0 125-129 35.7822 38.0 37.0 38.0 32.0 38.0 130-134 35.5187 38.0 36.0 38.0 31.0 38.0 135-139 35.2626 38.0 36.0 38.0 31.0 38.0 140-144 34.698 38.0 34.4 38.0 28.0 38.0 145-149 34.14985 38.0 33.8 38.0 26.2 38.0 150-151 29.66275 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 4.0 19 3.0 20 0.0 21 5.0 22 4.0 23 8.0 24 16.0 25 13.0 26 9.0 27 14.0 28 27.0 29 14.0 30 29.0 31 41.0 32 62.0 33 77.0 34 131.0 35 203.0 36 604.0 37 2730.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.73835125448029 12.800819252432156 12.519201228878648 37.94162826420891 2 21.925 16.6 32.2 29.275000000000002 3 20.724999999999998 20.8 24.775 33.7 4 23.425 28.95 22.225 25.4 5 22.5 33.4 23.400000000000002 20.7 6 19.25 36.3 25.174999999999997 19.275000000000002 7 15.25 24.474999999999998 42.0 18.275 8 17.875 26.025 29.475 26.625 9 17.575 24.0 35.325 23.1 10-14 20.064999999999998 29.715000000000003 26.61 23.61 15-19 20.185 28.360000000000003 27.48 23.974999999999998 20-24 20.474999999999998 28.04 27.785 23.7 25-29 19.71 28.645 27.47 24.175 30-34 20.44 28.244999999999997 27.894999999999996 23.419999999999998 35-39 20.064999999999998 28.54 26.96 24.435000000000002 40-44 20.51 28.005000000000003 27.26 24.224999999999998 45-49 20.82 27.224999999999998 27.495000000000005 24.46 50-54 20.44 27.985 26.855 24.72 55-59 20.79 27.455000000000002 27.325 24.43 60-64 20.855 27.92 27.07 24.154999999999998 65-69 20.885 27.544999999999998 27.589999999999996 23.98 70-74 20.44 28.01 27.325 24.224999999999998 75-79 20.435 27.439999999999998 27.560000000000002 24.565 80-84 20.03 27.58 27.765 24.625 85-89 20.385 27.38 27.495000000000005 24.740000000000002 90-94 20.880000000000003 27.68 26.795 24.645 95-99 21.099999999999998 27.685 26.924999999999997 24.29 100-104 20.9 27.455000000000002 27.500000000000004 24.145 105-109 21.36 27.325 26.915 24.4 110-114 21.01 28.515 26.51 23.965 115-119 21.135 28.105000000000004 26.8 23.96 120-124 21.21 27.515 26.584999999999997 24.69 125-129 21.45 26.88 26.805 24.865000000000002 130-134 21.46 28.275 25.650000000000002 24.615000000000002 135-139 21.165 28.455000000000002 25.795 24.585 140-144 21.08 28.525 25.94 24.455 145-149 21.295 27.775 25.765 25.165 150-151 21.575 28.1 25.674999999999997 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 1.5 27 2.0 28 8.5 29 12.0 30 12.0 31 20.5 32 27.0 33 36.0 34 46.0 35 54.5 36 74.0 37 92.5 38 128.5 39 159.5 40 170.5 41 203.0 42 229.5 43 233.0 44 246.5 45 250.0 46 249.0 47 252.5 48 241.0 49 231.5 50 203.0 51 154.5 52 131.5 53 120.0 54 96.0 55 77.0 56 58.5 57 43.5 58 32.5 59 22.0 60 17.5 61 14.0 62 10.5 63 6.5 64 6.0 65 8.0 66 4.0 67 1.0 68 2.5 69 2.0 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1409802930773 98.1 2 0.7326932794340576 1.4500000000000002 3 0.07579585649317837 0.22499999999999998 4 0.025265285497726126 0.1 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.2000000000000002 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.3625 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.2125 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 3.9000000000000004 0.0 0.0 0.0 0.0 116-117 4.1875 0.0 0.0 0.0 0.0 118-119 4.737500000000001 0.0 0.0 0.0 0.0 120-121 5.4 0.0 0.0 0.0 0.0 122-123 6.025 0.0 0.0 0.0 0.0 124-125 6.5125 0.0 0.0 0.0 0.0 126-127 7.025 0.0 0.0 0.0 0.0 128-129 7.5625 0.0 0.0 0.0 0.0 130-131 8.1875 0.0 0.0 0.0 0.0 132-133 8.7375 0.0 0.0 0.0 0.0 134-135 9.375 0.0 0.0 0.0 0.0 136-137 10.087499999999999 0.0 0.0 0.0 0.0 138-139 10.712499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAGG 10 0.006832588 144.9875 7 ATTCAAG 10 0.006832588 144.9875 6 >>END_MODULE SRR7168882 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168882_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91525 33.0 33.0 34.0 32.0 34.0 2 32.994 34.0 33.0 34.0 32.0 34.0 3 32.9915 34.0 33.0 34.0 32.0 34.0 4 32.98825 34.0 33.0 34.0 33.0 34.0 5 32.98725 34.0 33.0 34.0 33.0 34.0 6 37.12325 38.0 38.0 38.0 37.0 38.0 7 37.1195 38.0 38.0 38.0 37.0 38.0 8 37.14725 38.0 38.0 38.0 37.0 38.0 9 37.04125 38.0 38.0 38.0 37.0 38.0 10-14 37.04485 38.0 38.0 38.0 37.0 38.0 15-19 37.0803 38.0 38.0 38.0 37.0 38.0 20-24 37.0627 38.0 38.0 38.0 37.0 38.0 25-29 37.02380000000001 38.0 38.0 38.0 37.0 38.0 30-34 36.9836 38.0 38.0 38.0 37.0 38.0 35-39 36.990899999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.9851 38.0 38.0 38.0 37.0 38.0 45-49 36.9754 38.0 38.0 38.0 37.0 38.0 50-54 36.88969999999999 38.0 38.0 38.0 37.0 38.0 55-59 36.85355 38.0 38.0 38.0 36.8 38.0 60-64 36.90875 38.0 38.0 38.0 37.0 38.0 65-69 36.7947 38.0 38.0 38.0 36.2 38.0 70-74 36.7329 38.0 38.0 38.0 36.2 38.0 75-79 36.625099999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.51085 38.0 38.0 38.0 35.4 38.0 85-89 36.46585 38.0 38.0 38.0 35.2 38.0 90-94 36.3834 38.0 38.0 38.0 34.8 38.0 95-99 36.42615 38.0 38.0 38.0 35.0 38.0 100-104 36.29644999999999 38.0 38.0 38.0 34.6 38.0 105-109 36.1383 38.0 38.0 38.0 34.0 38.0 110-114 35.938900000000004 38.0 38.0 38.0 33.8 38.0 115-119 35.79655 38.0 38.0 38.0 33.6 38.0 120-124 35.544599999999996 38.0 37.6 38.0 32.2 38.0 125-129 35.3137 38.0 37.2 38.0 31.0 38.0 130-134 35.1605 38.0 36.2 38.0 31.0 38.0 135-139 34.824400000000004 38.0 36.0 38.0 29.0 38.0 140-144 34.3615 38.0 36.0 38.0 26.4 38.0 145-149 33.382600000000004 38.0 33.4 38.0 18.4 38.0 150-151 28.761 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 8.0 4 1.0 5 6.0 6 1.0 7 2.0 8 3.0 9 4.0 10 1.0 11 3.0 12 1.0 13 1.0 14 7.0 15 6.0 16 5.0 17 7.0 18 7.0 19 9.0 20 7.0 21 7.0 22 13.0 23 7.0 24 11.0 25 10.0 26 21.0 27 26.0 28 16.0 29 16.0 30 23.0 31 48.0 32 59.0 33 74.0 34 98.0 35 209.0 36 459.0 37 2812.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.525 18.95 17.25 27.275 2 28.125 24.275 29.975 17.625 3 22.0 28.549999999999997 29.125 20.325 4 23.3 34.125 21.475 21.099999999999998 5 24.875 35.275 22.325 17.525 6 22.05 35.825 23.625 18.5 7 20.45 20.849999999999998 38.3 20.4 8 23.200000000000003 24.05 26.474999999999998 26.275 9 22.8 24.025 29.125 24.05 10-14 24.65 28.439999999999998 25.115 21.795 15-19 23.830000000000002 27.694999999999997 26.945000000000004 21.529999999999998 20-24 24.055 27.58 27.145000000000003 21.22 25-29 24.34 28.110000000000003 26.619999999999997 20.93 30-34 23.96 27.925 26.66 21.455 35-39 24.01 27.650000000000002 27.08 21.26 40-44 24.240000000000002 27.565 27.125 21.07 45-49 23.605 27.38 27.834999999999997 21.18 50-54 23.95 27.755000000000003 27.08 21.215 55-59 24.14 27.250000000000004 27.134999999999998 21.475 60-64 24.169999999999998 27.255000000000003 26.75 21.825 65-69 23.815 27.29 27.525 21.37 70-74 24.55 27.650000000000002 26.14 21.66 75-79 23.98 27.21 27.155 21.654999999999998 80-84 24.2 27.6 27.029999999999998 21.17 85-89 24.169999999999998 27.01 27.22 21.6 90-94 24.135 27.35 27.029999999999998 21.485000000000003 95-99 24.61246124612461 27.827782778277825 26.912691269126913 20.647064706470648 100-104 24.187418741874186 27.442744274427444 26.96769676967697 21.402140214021404 105-109 24.402440244024405 27.552755275527552 26.687668766876687 21.357135713571356 110-114 24.325 27.79 27.305 20.580000000000002 115-119 25.71257125712571 27.96279627962796 26.48264826482648 19.841984198419844 120-124 25.4 27.76 26.534999999999997 20.305 125-129 25.88 26.840000000000003 27.279999999999998 20.0 130-134 25.67256725672567 27.85778577857786 26.327632763276327 20.142014201420142 135-139 25.776288814440722 27.85139256962848 26.761338066903345 19.610980549027452 140-144 26.08 28.015 25.82 20.085 145-149 26.88 27.1 25.91 20.11 150-151 27.150000000000002 27.775 26.237500000000004 18.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 3.0 27 2.0 28 1.5 29 4.5 30 5.5 31 8.0 32 16.5 33 17.5 34 22.5 35 37.0 36 51.0 37 75.0 38 106.0 39 145.5 40 167.5 41 194.5 42 241.0 43 272.5 44 275.0 45 275.0 46 282.0 47 257.5 48 247.5 49 236.0 50 192.5 51 161.0 52 142.5 53 118.5 54 100.5 55 80.5 56 55.5 57 47.0 58 38.5 59 28.5 60 22.5 61 18.5 62 15.0 63 11.5 64 7.5 65 3.0 66 2.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.01 105-109 0.01 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9873417721519 97.75 2 0.8860759493670887 1.7500000000000002 3 0.0759493670886076 0.22499999999999998 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025316455696202535 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.4500000000000002 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.725 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.199999999999999 0.0 0.0 0.0 0.0 118-119 4.775 0.0 0.0 0.0 0.0 120-121 5.375 0.0 0.0 0.0 0.0 122-123 5.975 0.0 0.0 0.0 0.0 124-125 6.4375 0.0 0.0 0.0 0.0 126-127 6.9375 0.0 0.0 0.0 0.0 128-129 7.487500000000001 0.0 0.0 0.0 0.0 130-131 8.1125 0.0 0.0 0.0 0.0 132-133 8.6875 0.0 0.0 0.0 0.0 134-135 9.35 0.0 0.0 0.0 0.0 136-137 10.1 0.0 0.0 0.0 0.0 138-139 10.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCTC 10 0.006830828 145.0 6 ACTTGTC 10 0.006830828 145.0 4 CTTGTCT 10 0.006830828 145.0 5 >>END_MODULE Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845208 spots for SRR7168882.sra Written 845208 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra Read 845201 spots for SRR7168882.sra Written 845201 spots for SRR7168882.sra SRR ids: ['SRR7168882.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9ul89742 SRR7168882.sra spots: 16904027 blocks: [[1, 845201], [845202, 1690402], [1690403, 2535603], [2535604, 3380804], [3380805, 4226005], [4226006, 5071206], [5071207, 5916407], [5916408, 6761608], [6761609, 7606809], [7606810, 8452010], [8452011, 9297211], [9297212, 10142412], [10142413, 10987613], [10987614, 11832814], [11832815, 12678015], [12678016, 13523216], [13523217, 14368417], [14368418, 15213618], [15213619, 16058819], [16058820, 16904027]] SRR7168882 file size 5706519 SRR7168882 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168882 SRR7168882_1.fastq SRR7168882_2.fastq Input file: SRR7168882_1.fastq Paired file: SRR7168882_2.fastq trimmed: SRR7168882-trimmed-pair1.fastq, SRR7168882-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 19:54:32 2025 >> started Sat Feb 15 20:05:54 2025 >> done (681.796s) 16904027 read pairs processed; of these: 34694 ( 0.21%) short read pairs filtered out after trimming by size control 56190 ( 0.33%) empty read pairs filtered out after trimming by size control 16813143 (99.46%) read pairs available; of these: 9081190 (54.01%) trimmed read pairs available after processing 7731953 (45.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 1 0.00% 21 6 0.00% 22 4 0.00% 23 6 0.00% 24 6 0.00% 25 7 0.00% 26 6 0.00% 27 14 0.00% 28 14 0.00% 29 12 0.00% 30 18 0.00% 31 14 0.00% 32 18 0.00% 33 21 0.00% 34 17 0.00% 35 12 0.00% 36 23 0.00% 37 31 0.00% 38 25 0.00% 39 39 0.00% 40 23 0.00% 41 41 0.00% 42 36 0.00% 43 47 0.00% 44 60 0.00% 45 50 0.00% 46 72 0.00% 47 68 0.00% 48 91 0.00% 49 91 0.00% 50 99 0.00% 51 142 0.00% 52 146 0.00% 53 175 0.00% 54 179 0.00% 55 187 0.00% 56 228 0.00% 57 211 0.00% 58 270 0.00% 59 289 0.00% 60 351 0.00% 61 366 0.00% 62 458 0.00% 63 538 0.00% 64 590 0.00% 65 686 0.00% 66 799 0.00% 67 889 0.01% 68 1187 0.01% 69 3166 0.02% 70 2822 0.02% 71 1621 0.01% 72 1738 0.01% 73 1909 0.01% 74 2131 0.01% 75 2394 0.01% 76 2736 0.02% 77 2997 0.02% 78 3341 0.02% 79 3607 0.02% 80 4313 0.03% 81 4622 0.03% 82 5323 0.03% 83 6105 0.04% 84 7851 0.05% 85 9281 0.06% 86 9964 0.06% 87 10748 0.06% 88 11375 0.07% 89 12072 0.07% 90 13468 0.08% 91 13345 0.08% 92 14774 0.09% 93 16096 0.10% 94 17365 0.10% 95 19057 0.11% 96 20080 0.12% 97 20513 0.12% 98 21397 0.13% 99 22132 0.13% 100 23412 0.14% 101 24537 0.15% 102 26108 0.16% 103 28382 0.17% 104 29720 0.18% 105 31425 0.19% 106 33020 0.20% 107 33844 0.20% 108 34640 0.21% 109 36545 0.22% 110 38206 0.23% 111 38819 0.23% 112 40527 0.24% 113 42601 0.25% 114 44436 0.26% 115 46652 0.28% 116 48558 0.29% 117 49551 0.29% 118 50715 0.30% 119 51446 0.31% 120 52571 0.31% 121 54192 0.32% 122 55799 0.33% 123 58203 0.35% 124 60592 0.36% 125 62207 0.37% 126 64451 0.38% 127 66987 0.40% 128 68514 0.41% 129 69473 0.41% 130 71394 0.42% 131 73138 0.44% 132 75764 0.45% 133 79369 0.47% 134 82168 0.49% 135 86609 0.52% 136 89851 0.53% 137 94381 0.56% 138 98472 0.59% 139 103363 0.61% 140 108783 0.65% 141 116564 0.69% 142 125049 0.74% 143 138249 0.82% 144 157251 0.94% 145 182968 1.09% 146 223932 1.33% 147 293281 1.74% 148 431499 2.57% 149 838096 4.98% 150 3947857 23.48% 151 7731953 45.99% 16813143 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=10 prefix-density=0.86 prefix-fanout=2.6 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=77.62 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.7 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.61 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=17.89 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7168882 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 20:55:36 Started mapping on | Feb 15 20:55:54 Finished on | Feb 16 00:09:00 Mapping speed, Million of reads per hour | 5.22 Number of input reads | 16813143 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15307850 Uniquely mapped reads % | 91.05% Average mapped length | 290.50 Number of splices: Total | 14528030 Number of splices: Annotated (sjdb) | 14244023 Number of splices: GT/AG | 14234419 Number of splices: GC/AG | 251741 Number of splices: AT/AC | 7715 Number of splices: Non-canonical | 34155 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422342 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 203488 % of reads mapped to too many loci | 1.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.02% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1110741 1110741 1110741 N_multimapping 422342 422342 422342 N_noFeature 397992 14988320 532217 N_ambiguous 281166 1383 94929 UnstrandedReadsAssigned:14628692 PositiveStrandReadsAssigned:318147 NegativeStrandReadsAssigned:14680704 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168882 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168882-trimmed-pair1.fastq SRR7168882-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,813,143 reads, 14,888,940 reads pseudoaligned [quant] estimated average fragment length: 218.566 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR7168882.ke.tsv 34699 SRR7168882.se.tsv 87100 total ==> SRR7168882.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.43 493 15.2727 Potri.005G024800.1.v4.1 1035 817.434 274 18.6958 Potri.004G059700.1.v4.1 961 743.439 15 1.12536 Potri.007G009000.2.v4.1 1416 1198.43 0 0 Potri.003G141000.2.v4.1 2943 2725.43 848 17.3543 Potri.016G087400.1.v4.1 270 89.1524 737 461.085 Potri.015G069301.1.v4.1 564 348.534 0 0 Potri.010G195200.1.v4.1 1773 1555.43 21 0.753034 Potri.012G127500.1.v4.1 977 759.434 401 29.4511 ==> SRR7168882.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 512 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR7168882 completed mapping pipeline successfully