Starting /dee2/code/volunteer_pipeline.sh SRR7168883 current disk space = 3092229230592 free memory = 1449641484 SRR7168883 SRAfilesize 1c297fb5cfccb78d0ba5fa911938d2ae SRR7168883.sra SRR7168883.sra file validated SRR7168883 is paired end SRR7168883 is conventional basespace SRR7168883 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168883_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19175 34.0 33.0 34.0 32.0 34.0 2 33.09575 34.0 33.0 34.0 32.0 34.0 3 33.12175 34.0 33.0 34.0 32.0 34.0 4 33.2605 34.0 33.0 34.0 32.0 34.0 5 33.25825 34.0 33.0 34.0 33.0 34.0 6 36.94175 38.0 37.0 38.0 36.0 38.0 7 37.1815 38.0 38.0 38.0 36.0 38.0 8 37.34 38.0 38.0 38.0 37.0 38.0 9 37.3965 38.0 38.0 38.0 37.0 38.0 10-14 37.39395 38.0 38.0 38.0 37.0 38.0 15-19 37.36805 38.0 38.0 38.0 37.0 38.0 20-24 37.34565 38.0 38.0 38.0 37.0 38.0 25-29 37.29335 38.0 38.0 38.0 37.0 38.0 30-34 37.28135 38.0 38.0 38.0 37.0 38.0 35-39 37.27965 38.0 38.0 38.0 37.0 38.0 40-44 37.20205 38.0 38.0 38.0 36.8 38.0 45-49 37.189800000000005 38.0 38.0 38.0 36.6 38.0 50-54 37.161500000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.1108 38.0 38.0 38.0 36.0 38.0 60-64 37.119299999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.0603 38.0 38.0 38.0 36.0 38.0 70-74 36.96855 38.0 38.0 38.0 36.0 38.0 75-79 36.860299999999995 38.0 38.0 38.0 35.4 38.0 80-84 36.80955 38.0 38.0 38.0 35.0 38.0 85-89 36.69 38.0 38.0 38.0 34.8 38.0 90-94 36.6257 38.0 38.0 38.0 34.2 38.0 95-99 36.512750000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.35735 38.0 38.0 38.0 34.0 38.0 105-109 36.22005 38.0 37.4 38.0 34.0 38.0 110-114 36.0281 38.0 37.0 38.0 33.2 38.0 115-119 35.83005 38.0 37.0 38.0 32.2 38.0 120-124 35.6238 38.0 36.2 38.0 31.4 38.0 125-129 35.18855 38.0 36.0 38.0 28.2 38.0 130-134 35.13340000000001 38.0 35.8 38.0 28.4 38.0 135-139 34.803399999999996 38.0 35.0 38.0 27.6 38.0 140-144 34.26045 38.0 34.0 38.0 24.6 38.0 145-149 33.22245 38.0 33.0 38.0 18.6 38.0 150-151 29.274375 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 3.0 19 2.0 20 1.0 21 6.0 22 8.0 23 10.0 24 11.0 25 17.0 26 15.0 27 30.0 28 30.0 29 33.0 30 52.0 31 60.0 32 84.0 33 111.0 34 152.0 35 255.0 36 624.0 37 2489.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.0749354005168 11.472868217054263 14.54780361757106 40.90439276485788 2 22.35 17.724999999999998 35.0 24.925 3 20.375 22.925 24.5 32.2 4 22.15 32.775 21.65 23.425 5 21.825 35.15 24.325 18.7 6 18.075 37.05 24.2 20.674999999999997 7 13.600000000000001 23.549999999999997 43.775 19.075 8 17.95 23.825 32.15 26.075 9 17.724999999999998 24.05 33.25 24.975 10-14 20.06 29.715000000000003 26.729999999999997 23.494999999999997 15-19 19.855 28.645 27.725 23.775 20-24 19.71 28.610000000000003 28.205000000000002 23.474999999999998 25-29 19.525000000000002 28.549999999999997 28.294999999999998 23.630000000000003 30-34 19.27 28.744999999999997 27.915 24.07 35-39 19.45 28.725 28.155 23.669999999999998 40-44 19.509999999999998 28.57 28.499999999999996 23.419999999999998 45-49 19.475 28.904999999999998 28.139999999999997 23.48 50-54 19.96 29.189999999999998 27.32 23.53 55-59 19.91 28.64 28.044999999999998 23.405 60-64 20.11 28.725 27.515 23.65 65-69 20.34 28.79 27.525 23.345 70-74 20.13 28.439999999999998 27.785 23.645 75-79 19.939999999999998 28.24 28.395 23.425 80-84 19.885 28.610000000000003 28.044999999999998 23.46 85-89 19.564999999999998 28.225 28.244999999999997 23.965 90-94 20.25 28.07 28.000000000000004 23.68 95-99 20.560000000000002 28.384999999999998 28.095 22.96 100-104 19.64 28.665000000000003 27.87 23.825 105-109 20.165 29.005 27.800000000000004 23.03 110-114 20.525 29.13 27.21 23.135 115-119 20.93 28.89 26.87 23.31 120-124 20.580000000000002 28.89 27.12 23.41 125-129 20.375 28.975 27.195000000000004 23.455000000000002 130-134 20.575 28.915000000000003 27.1 23.41 135-139 21.26 28.720000000000002 26.340000000000003 23.68 140-144 20.599999999999998 28.110000000000003 27.284999999999997 24.005000000000003 145-149 20.474999999999998 28.4 27.42 23.705000000000002 150-151 20.0875 28.712500000000002 27.237499999999997 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 1.0 23 0.5 24 1.5 25 2.0 26 3.5 27 7.0 28 10.0 29 13.0 30 15.5 31 22.5 32 33.0 33 52.0 34 61.5 35 71.5 36 106.0 37 128.0 38 141.5 39 174.5 40 204.5 41 231.0 42 252.5 43 251.0 44 264.0 45 279.0 46 262.0 47 243.5 48 222.0 49 201.0 50 180.5 51 136.5 52 99.0 53 78.5 54 62.0 55 49.5 56 37.0 57 33.0 58 25.5 59 16.0 60 10.5 61 3.0 62 2.0 63 1.5 64 1.0 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.7999999999999998 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.725 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.449999999999999 0.0 0.0 0.0 0.0 122-123 4.8625 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.65 0.0 0.0 0.0 0.0 128-129 6.1125 0.0 0.0 0.0 0.0 130-131 6.8375 0.0 0.0 0.0 0.0 132-133 7.525 0.0 0.0 0.0 0.0 134-135 8.125 0.0 0.0 0.0 0.0 136-137 8.7 0.0 0.0 0.0 0.0 138-139 9.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168883 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168883_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71125 33.0 33.0 34.0 32.0 34.0 2 32.91425 33.0 33.0 34.0 32.0 34.0 3 32.90475 33.0 33.0 34.0 31.0 34.0 4 32.8875 34.0 33.0 34.0 32.0 34.0 5 32.89025 34.0 33.0 34.0 32.0 34.0 6 37.1005 38.0 38.0 38.0 36.0 38.0 7 37.12825 38.0 38.0 38.0 36.0 38.0 8 37.077 38.0 38.0 38.0 37.0 38.0 9 37.08075 38.0 38.0 38.0 37.0 38.0 10-14 37.049549999999996 38.0 38.0 38.0 36.6 38.0 15-19 37.02255 38.0 38.0 38.0 36.6 38.0 20-24 36.98975 38.0 38.0 38.0 36.2 38.0 25-29 36.98475 38.0 38.0 38.0 36.4 38.0 30-34 36.97525 38.0 38.0 38.0 36.0 38.0 35-39 36.935500000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.91775 38.0 38.0 38.0 36.0 38.0 45-49 36.88525 38.0 38.0 38.0 36.0 38.0 50-54 36.8149 38.0 38.0 38.0 36.0 38.0 55-59 36.81525 38.0 38.0 38.0 36.0 38.0 60-64 36.72375 38.0 38.0 38.0 35.4 38.0 65-69 36.64565 38.0 38.0 38.0 35.2 38.0 70-74 36.60485 38.0 38.0 38.0 35.0 38.0 75-79 36.5021 38.0 38.0 38.0 34.6 38.0 80-84 36.3647 38.0 38.0 38.0 34.0 38.0 85-89 36.1954 38.0 38.0 38.0 34.0 38.0 90-94 36.191199999999995 38.0 38.0 38.0 33.8 38.0 95-99 36.06665 38.0 38.0 38.0 33.6 38.0 100-104 36.032149999999994 38.0 37.8 38.0 33.4 38.0 105-109 35.83755 38.0 37.6 38.0 33.0 38.0 110-114 35.70145 38.0 37.0 38.0 32.0 38.0 115-119 35.51805 38.0 37.0 38.0 31.0 38.0 120-124 35.27725 38.0 36.8 38.0 30.0 38.0 125-129 35.03775 38.0 36.0 38.0 28.4 38.0 130-134 34.52125 38.0 35.6 38.0 25.6 38.0 135-139 34.0418 38.0 34.6 38.0 22.8 38.0 140-144 33.593999999999994 38.0 33.4 38.0 21.4 38.0 145-149 32.40095 38.0 33.0 38.0 10.8 38.0 150-151 27.33425 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 0.0 6 5.0 7 2.0 8 0.0 9 0.0 10 3.0 11 2.0 12 1.0 13 3.0 14 5.0 15 4.0 16 7.0 17 7.0 18 5.0 19 5.0 20 16.0 21 9.0 22 11.0 23 15.0 24 16.0 25 22.0 26 22.0 27 40.0 28 36.0 29 29.0 30 37.0 31 62.0 32 63.0 33 111.0 34 168.0 35 231.0 36 600.0 37 2454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.2 16.675 18.65 31.474999999999998 2 25.674999999999997 25.424999999999997 33.725 15.174999999999999 3 20.474999999999998 29.975 29.299999999999997 20.25 4 23.05 35.35 23.1 18.5 5 24.125 37.724999999999994 22.45 15.7 6 20.025000000000002 37.875 23.575 18.525 7 19.2 18.3 42.375 20.125 8 20.775 24.275 29.4 25.55 9 21.75 24.5 29.9 23.849999999999998 10-14 22.765 29.285 26.63 21.32 15-19 22.865 28.07 28.475 20.59 20-24 22.595000000000002 28.845 28.02 20.54 25-29 22.795 28.025 28.365000000000002 20.815 30-34 22.685 27.87 28.845 20.599999999999998 35-39 22.395 27.87 28.660000000000004 21.075 40-44 22.545 28.375 28.27 20.810000000000002 45-49 22.900000000000002 28.205000000000002 27.860000000000003 21.035 50-54 22.805 28.215 28.38 20.599999999999998 55-59 23.265 28.54 27.744999999999997 20.45 60-64 23.035 27.944999999999997 28.37 20.65 65-69 23.59 27.77 27.750000000000004 20.89 70-74 23.23 27.765 28.425 20.580000000000002 75-79 23.14 27.66 28.525 20.674999999999997 80-84 23.150000000000002 27.52 28.34 20.990000000000002 85-89 23.265 27.985 28.555000000000003 20.195 90-94 22.735 28.455000000000002 28.144999999999996 20.665 95-99 23.115 28.32 27.950000000000003 20.615 100-104 23.605 27.87 28.035 20.49 105-109 23.3 28.335 28.205000000000002 20.16 110-114 23.794999999999998 27.82 27.944999999999997 20.44 115-119 23.925 28.804999999999996 27.575 19.695 120-124 24.165 28.505000000000003 27.855 19.475 125-129 24.585 28.599999999999998 27.36 19.455 130-134 25.12002400480096 27.70554110822164 27.430486097219443 19.74394878975795 135-139 25.064999999999998 28.155 27.465 19.314999999999998 140-144 24.77 28.075 27.455000000000002 19.7 145-149 25.185000000000002 27.76 27.675 19.38 150-151 25.575 27.950000000000003 27.250000000000004 19.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.5 25 4.5 26 3.5 27 3.5 28 10.0 29 14.0 30 13.5 31 21.0 32 31.5 33 44.0 34 60.5 35 66.0 36 93.5 37 126.5 38 146.0 39 176.0 40 200.0 41 231.5 42 260.0 43 273.5 44 291.5 45 283.0 46 252.5 47 240.0 48 223.0 49 194.0 50 162.0 51 129.5 52 102.0 53 79.0 54 72.5 55 60.0 56 39.0 57 26.5 58 18.0 59 14.5 60 11.0 61 6.5 62 2.5 63 1.5 64 0.5 65 1.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.4531722054380665 0.8999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.7625000000000002 0.0 0.0 0.0 0.0 108-109 1.9874999999999998 0.0 0.0 0.0 0.0 110-111 2.3375000000000004 0.0 0.0 0.0 0.0 112-113 2.7249999999999996 0.0 0.0 0.0 0.0 114-115 2.9625000000000004 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.449999999999999 0.0 0.0 0.0 0.0 122-123 4.8375 0.0 0.0 0.0 0.0 124-125 5.2 0.0 0.0 0.0 0.0 126-127 5.6125 0.0 0.0 0.0 0.0 128-129 6.074999999999999 0.0 0.0 0.0 0.0 130-131 6.8 0.0 0.0 0.0 0.0 132-133 7.4875 0.0 0.0 0.0 0.0 134-135 8.1125 0.0 0.0 0.0 0.0 136-137 8.65 0.0 0.0 0.0 0.0 138-139 9.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924338 spots for SRR7168883.sra Written 924338 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra Read 924326 spots for SRR7168883.sra Written 924326 spots for SRR7168883.sra SRR ids: ['SRR7168883.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__o_s36hr SRR7168883.sra spots: 18486532 blocks: [[1, 924326], [924327, 1848652], [1848653, 2772978], [2772979, 3697304], [3697305, 4621630], [4621631, 5545956], [5545957, 6470282], [6470283, 7394608], [7394609, 8318934], [8318935, 9243260], [9243261, 10167586], [10167587, 11091912], [11091913, 12016238], [12016239, 12940564], [12940565, 13864890], [13864891, 14789216], [14789217, 15713542], [15713543, 16637868], [16637869, 17562194], [17562195, 18486532]] SRR7168883 file size 6242778 SRR7168883 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168883 SRR7168883_1.fastq SRR7168883_2.fastq Input file: SRR7168883_1.fastq Paired file: SRR7168883_2.fastq trimmed: SRR7168883-trimmed-pair1.fastq, SRR7168883-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 19:42:46 2025 >> started Sat Feb 15 19:52:56 2025 >> done (609.958s) 18486532 read pairs processed; of these: 20475 ( 0.11%) short read pairs filtered out after trimming by size control 19461 ( 0.11%) empty read pairs filtered out after trimming by size control 18446596 (99.78%) read pairs available; of these: 10515339 (57.00%) trimmed read pairs available after processing 7931257 (43.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 3 0.00% 21 6 0.00% 22 6 0.00% 23 3 0.00% 24 9 0.00% 25 8 0.00% 26 4 0.00% 27 3 0.00% 28 12 0.00% 29 7 0.00% 30 12 0.00% 31 10 0.00% 32 10 0.00% 33 10 0.00% 34 13 0.00% 35 13 0.00% 36 17 0.00% 37 21 0.00% 38 27 0.00% 39 26 0.00% 40 33 0.00% 41 26 0.00% 42 30 0.00% 43 46 0.00% 44 32 0.00% 45 68 0.00% 46 69 0.00% 47 89 0.00% 48 89 0.00% 49 98 0.00% 50 111 0.00% 51 134 0.00% 52 160 0.00% 53 166 0.00% 54 178 0.00% 55 196 0.00% 56 213 0.00% 57 255 0.00% 58 316 0.00% 59 299 0.00% 60 360 0.00% 61 404 0.00% 62 480 0.00% 63 555 0.00% 64 649 0.00% 65 726 0.00% 66 838 0.00% 67 916 0.00% 68 1127 0.01% 69 2059 0.01% 70 1836 0.01% 71 1508 0.01% 72 1813 0.01% 73 1961 0.01% 74 2183 0.01% 75 2351 0.01% 76 2771 0.02% 77 3008 0.02% 78 3308 0.02% 79 3608 0.02% 80 4309 0.02% 81 4598 0.02% 82 5330 0.03% 83 6069 0.03% 84 7298 0.04% 85 8151 0.04% 86 8825 0.05% 87 9574 0.05% 88 10446 0.06% 89 10936 0.06% 90 11628 0.06% 91 12901 0.07% 92 13454 0.07% 93 15268 0.08% 94 16114 0.09% 95 17139 0.09% 96 18312 0.10% 97 19519 0.11% 98 20595 0.11% 99 21415 0.12% 100 22592 0.12% 101 23901 0.13% 102 25489 0.14% 103 26717 0.14% 104 28408 0.15% 105 30073 0.16% 106 31859 0.17% 107 32811 0.18% 108 34155 0.19% 109 35189 0.19% 110 36274 0.20% 111 37898 0.21% 112 39636 0.21% 113 40395 0.22% 114 42850 0.23% 115 44387 0.24% 116 45868 0.25% 117 48175 0.26% 118 49615 0.27% 119 50661 0.27% 120 52318 0.28% 121 53871 0.29% 122 55743 0.30% 123 58200 0.32% 124 60851 0.33% 125 62638 0.34% 126 65680 0.36% 127 67711 0.37% 128 70324 0.38% 129 71949 0.39% 130 74434 0.40% 131 77955 0.42% 132 80960 0.44% 133 84527 0.46% 134 88654 0.48% 135 93220 0.51% 136 98739 0.54% 137 104578 0.57% 138 112844 0.61% 139 119835 0.65% 140 128512 0.70% 141 139652 0.76% 142 152895 0.83% 143 169653 0.92% 144 195988 1.06% 145 230738 1.25% 146 287925 1.56% 147 382712 2.07% 148 561359 3.04% 149 1075226 5.83% 150 4631514 25.11% 151 7931257 43.00% 18446596 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=19 prefix-density=0.48 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=415.79 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=21.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=19 prefix-density=0.53 prefix-fanout=2.5 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=39.82 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.0 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCTAGTT SRR7168883 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 21:06:38 Started mapping on | Feb 15 21:06:57 Finished on | Feb 15 23:19:28 Mapping speed, Million of reads per hour | 8.35 Number of input reads | 18446596 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17386180 Uniquely mapped reads % | 94.25% Average mapped length | 290.93 Number of splices: Total | 16490997 Number of splices: Annotated (sjdb) | 16070084 Number of splices: GT/AG | 16177378 Number of splices: GC/AG | 253433 Number of splices: AT/AC | 9642 Number of splices: Non-canonical | 50544 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 519236 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 40509 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 558926 558926 558926 N_multimapping 519236 519236 519236 N_noFeature 742068 17006182 957397 N_ambiguous 291840 1761 125859 UnstrandedReadsAssigned:16352272 PositiveStrandReadsAssigned:378237 NegativeStrandReadsAssigned:16302924 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168883 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168883-trimmed-pair1.fastq SRR7168883-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,446,596 reads, 16,306,840 reads pseudoaligned [quant] estimated average fragment length: 232.135 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7168883.ke.tsv 34699 SRR7168883.se.tsv 87100 total ==> SRR7168883.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.86 1180 40.4815 Potri.005G024800.1.v4.1 1035 803.865 292 22.2672 Potri.004G059700.1.v4.1 961 729.891 16 1.34378 Potri.007G009000.2.v4.1 1416 1184.86 0 0 Potri.003G141000.2.v4.1 2943 2711.86 821.488 18.5695 Potri.016G087400.1.v4.1 270 86.7909 766 541.03 Potri.015G069301.1.v4.1 564 337.628 0 0 Potri.010G195200.1.v4.1 1773 1541.86 267.942 10.6527 Potri.012G127500.1.v4.1 977 745.881 114 9.36919 ==> SRR7168883.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1372 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 14 SRR7168883 completed mapping pipeline successfully