Starting /dee2/code/volunteer_pipeline.sh SRR7168884 current disk space = 3092223102976 free memory = 1575468792 SRR7168884 SRAfilesize 217247554e95839dd53db64a0c129010 SRR7168884.sra SRR7168884.sra file validated SRR7168884 is paired end SRR7168884 is conventional basespace SRR7168884 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168884_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14375 34.0 33.0 34.0 32.0 34.0 2 33.2055 34.0 33.0 34.0 32.0 34.0 3 33.22325 34.0 33.0 34.0 32.0 34.0 4 33.31725 34.0 33.0 34.0 33.0 34.0 5 33.3085 34.0 33.0 34.0 33.0 34.0 6 37.0475 38.0 37.0 38.0 36.0 38.0 7 37.39275 38.0 38.0 38.0 37.0 38.0 8 37.4695 38.0 38.0 38.0 37.0 38.0 9 37.497 38.0 38.0 38.0 37.0 38.0 10-14 37.515699999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.513099999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.49885 38.0 38.0 38.0 37.6 38.0 25-29 37.46040000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.409000000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.40069999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.3609 38.0 38.0 38.0 37.0 38.0 45-49 37.27735 38.0 38.0 38.0 37.0 38.0 50-54 37.195899999999995 38.0 38.0 38.0 36.6 38.0 55-59 37.1965 38.0 38.0 38.0 36.6 38.0 60-64 37.048500000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.04815000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.002750000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.914750000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.7325 38.0 38.0 38.0 35.2 38.0 85-89 36.57430000000001 38.0 38.0 38.0 34.4 38.0 90-94 36.4533 38.0 38.0 38.0 34.0 38.0 95-99 36.21560000000001 38.0 37.8 38.0 33.6 38.0 100-104 36.1429 38.0 37.6 38.0 33.4 38.0 105-109 36.121 38.0 37.8 38.0 33.6 38.0 110-114 35.87785 38.0 37.0 38.0 32.6 38.0 115-119 35.433 38.0 36.6 38.0 29.6 38.0 120-124 35.248749999999994 38.0 36.2 38.0 28.8 38.0 125-129 35.0145 38.0 36.0 38.0 28.0 38.0 130-134 34.521300000000004 38.0 35.0 38.0 25.8 38.0 135-139 33.935199999999995 38.0 34.0 38.0 22.4 38.0 140-144 33.3409 38.0 33.2 38.0 19.4 38.0 145-149 31.989800000000002 38.0 32.4 38.0 10.8 38.0 150-151 28.10325 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 1.0 16 3.0 17 6.0 18 6.0 19 3.0 20 1.0 21 7.0 22 5.0 23 7.0 24 18.0 25 12.0 26 27.0 27 20.0 28 33.0 29 48.0 30 56.0 31 53.0 32 81.0 33 113.0 34 161.0 35 311.0 36 704.0 37 2318.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.54860568152202 10.867865519937451 10.059942663539223 43.5235861350013 2 21.025 16.625 35.8 26.55 3 21.075 20.200000000000003 25.45 33.275 4 23.674999999999997 29.175 20.974999999999998 26.174999999999997 5 21.175 34.699999999999996 24.175 19.950000000000003 6 18.5 37.025000000000006 25.25 19.225 7 15.4 24.474999999999998 41.85 18.275 8 17.95 24.474999999999998 32.074999999999996 25.5 9 17.45 25.525 34.125 22.900000000000002 10-14 19.814999999999998 29.9 26.765 23.52 15-19 19.125 28.605000000000004 28.105000000000004 24.165 20-24 20.19 29.25 27.200000000000003 23.36 25-29 19.915 28.365000000000002 27.985 23.735 30-34 19.57 28.975 28.000000000000004 23.455000000000002 35-39 19.715 28.48 27.955000000000002 23.849999999999998 40-44 20.32 28.895 27.415 23.369999999999997 45-49 19.81 28.849999999999998 27.560000000000002 23.78 50-54 19.62 28.744999999999997 27.85 23.785 55-59 20.385 29.044999999999998 27.334999999999997 23.235 60-64 20.215 28.499999999999996 27.750000000000004 23.535 65-69 20.080000000000002 28.655 27.839999999999996 23.425 70-74 19.685 28.449999999999996 28.235 23.630000000000003 75-79 20.02 28.384999999999998 28.275 23.32 80-84 20.669999999999998 27.865000000000002 27.884999999999998 23.580000000000002 85-89 20.465 28.165000000000003 27.685 23.685000000000002 90-94 20.325 28.999999999999996 27.235 23.44 95-99 19.845 28.895 28.060000000000002 23.200000000000003 100-104 20.335 28.46 27.775 23.43 105-109 21.615000000000002 27.77 27.575 23.04 110-114 20.13 28.925 27.525 23.419999999999998 115-119 20.415 28.715000000000003 27.200000000000003 23.669999999999998 120-124 20.655 28.544999999999998 26.8 24.0 125-129 20.515 27.845 27.755000000000003 23.885 130-134 20.565 28.439999999999998 27.49 23.505000000000003 135-139 20.979999999999997 28.4 26.88 23.74 140-144 21.25 28.33 26.695 23.724999999999998 145-149 20.630000000000003 28.1 26.86 24.41 150-151 21.525 27.8875 26.5125 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 2.5 25 5.0 26 5.0 27 8.5 28 12.5 29 12.5 30 19.0 31 27.5 32 42.0 33 48.5 34 58.5 35 71.0 36 88.5 37 122.0 38 140.5 39 156.0 40 189.0 41 231.5 42 246.5 43 253.5 44 257.5 45 257.0 46 269.0 47 252.5 48 229.0 49 204.5 50 169.5 51 136.5 52 107.5 53 86.5 54 74.5 55 60.5 56 39.5 57 27.5 58 17.0 59 14.0 60 16.5 61 11.0 62 6.5 63 5.5 64 2.5 65 2.5 66 1.5 67 1.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.3125 0.0 0.0 0.0 0.0 112-113 2.5375 0.0 0.0 0.0 0.0 114-115 2.8375 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.975 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.7 0.0 0.0 0.0 0.0 130-131 6.2375 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.4625 0.0 0.0 0.0 0.0 136-137 7.9624999999999995 0.0 0.0 0.0 0.0 138-139 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTTT 10 0.006836113 144.9625 7 >>END_MODULE SRR7168884 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168884_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.958 33.0 33.0 34.0 32.0 34.0 2 33.07325 34.0 33.0 34.0 32.0 34.0 3 33.1095 34.0 33.0 34.0 33.0 34.0 4 33.02175 34.0 33.0 34.0 32.0 34.0 5 33.09275 34.0 33.0 34.0 33.0 34.0 6 37.2415 38.0 38.0 38.0 37.0 38.0 7 37.28125 38.0 38.0 38.0 37.0 38.0 8 37.263 38.0 38.0 38.0 37.0 38.0 9 37.18925 38.0 38.0 38.0 37.0 38.0 10-14 37.218900000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.25475 38.0 38.0 38.0 37.0 38.0 20-24 37.211299999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.2173 38.0 38.0 38.0 37.0 38.0 30-34 37.21465 38.0 38.0 38.0 37.0 38.0 35-39 37.1806 38.0 38.0 38.0 37.0 38.0 40-44 37.04115 38.0 38.0 38.0 36.8 38.0 45-49 37.072100000000006 38.0 38.0 38.0 36.8 38.0 50-54 36.972899999999996 38.0 38.0 38.0 36.4 38.0 55-59 36.9463 38.0 38.0 38.0 36.2 38.0 60-64 36.94425 38.0 38.0 38.0 36.0 38.0 65-69 36.898900000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.76535 38.0 38.0 38.0 35.8 38.0 75-79 36.69945 38.0 38.0 38.0 35.2 38.0 80-84 36.678399999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.5235 38.0 38.0 38.0 34.6 38.0 90-94 36.498949999999994 38.0 38.0 38.0 34.6 38.0 95-99 36.33605 38.0 38.0 38.0 34.0 38.0 100-104 36.18035 38.0 38.0 38.0 33.6 38.0 105-109 35.9582 38.0 38.0 38.0 33.2 38.0 110-114 35.90560000000001 38.0 37.8 38.0 33.2 38.0 115-119 35.8191 38.0 37.2 38.0 32.2 38.0 120-124 35.4621 38.0 36.4 38.0 31.0 38.0 125-129 35.3759 38.0 36.4 38.0 30.6 38.0 130-134 34.70815 38.0 35.4 38.0 27.4 38.0 135-139 34.2245 38.0 34.2 38.0 25.0 38.0 140-144 33.76585000000001 38.0 33.2 38.0 22.6 38.0 145-149 32.75495 38.0 33.0 38.0 14.4 38.0 150-151 27.335875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 1.0 6 0.0 7 2.0 8 2.0 9 3.0 10 1.0 11 2.0 12 1.0 13 2.0 14 2.0 15 2.0 16 7.0 17 5.0 18 3.0 19 5.0 20 12.0 21 9.0 22 6.0 23 11.0 24 12.0 25 20.0 26 19.0 27 26.0 28 23.0 29 36.0 30 46.0 31 48.0 32 72.0 33 96.0 34 145.0 35 277.0 36 606.0 37 2492.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.5 18.025 15.2 29.275000000000002 2 25.474999999999998 25.974999999999998 32.824999999999996 15.725 3 21.125 28.65 30.025000000000002 20.200000000000003 4 24.15 35.3 22.575 17.974999999999998 5 25.6 35.949999999999996 22.0 16.45 6 18.875 39.825 23.775 17.525 7 19.45 19.175 41.349999999999994 20.025000000000002 8 21.5 24.474999999999998 29.625 24.4 9 21.8 25.174999999999997 30.325000000000003 22.7 10-14 23.189999999999998 29.335 26.174999999999997 21.3 15-19 22.81 27.365000000000002 28.53 21.295 20-24 22.82 28.389999999999997 28.09 20.7 25-29 23.585 28.07 28.175 20.169999999999998 30-34 23.145 28.144999999999996 28.155 20.555 35-39 22.689999999999998 27.794999999999998 28.634999999999998 20.880000000000003 40-44 23.09 28.255000000000003 28.02 20.635 45-49 23.465 28.48 27.529999999999998 20.525 50-54 22.725 27.76 28.875 20.64 55-59 22.925 27.815 28.4 20.86 60-64 23.135 27.54 28.54 20.785 65-69 23.025000000000002 28.060000000000002 28.345 20.57 70-74 23.66 27.63 28.21 20.5 75-79 22.97 27.825 28.265 20.94 80-84 23.585 27.73 28.02 20.665 85-89 23.880000000000003 27.87 28.194999999999997 20.055 90-94 23.235 27.845 28.51 20.41 95-99 22.96 28.005000000000003 27.905 21.13 100-104 23.235 28.305000000000003 27.900000000000002 20.560000000000002 105-109 23.119999999999997 28.139999999999997 28.355000000000004 20.385 110-114 23.5 28.435 27.755000000000003 20.31 115-119 24.21 27.939999999999998 27.975 19.875 120-124 24.46 28.22 27.505000000000003 19.814999999999998 125-129 24.115000000000002 27.955000000000002 27.644999999999996 20.285 130-134 25.074999999999996 27.834999999999997 27.755000000000003 19.335 135-139 24.77 27.839999999999996 27.534999999999997 19.855 140-144 25.0 28.33 26.82 19.85 145-149 24.86 28.315 27.12 19.705000000000002 150-151 25.900000000000002 27.787499999999998 27.6375 18.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 1.5 21 1.0 22 1.5 23 4.0 24 5.0 25 6.0 26 5.5 27 4.5 28 6.5 29 10.0 30 15.5 31 21.5 32 33.5 33 51.5 34 61.5 35 65.5 36 89.5 37 121.0 38 137.5 39 169.0 40 190.5 41 222.0 42 259.0 43 272.0 44 274.5 45 250.5 46 247.0 47 249.5 48 238.0 49 199.5 50 154.5 51 139.5 52 111.5 53 88.0 54 77.5 55 57.5 56 38.5 57 31.5 58 24.0 59 16.5 60 13.5 61 11.0 62 9.0 63 4.0 64 2.0 65 1.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39531368102796 98.625 2 0.5039052658100277 1.0 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.02519526329050139 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.4875 0.0 0.0 0.0 0.0 120-121 3.975 0.0 0.0 0.0 0.0 122-123 4.550000000000001 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.275 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.550000000000001 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGAA 10 0.006830828 145.0 1 >>END_MODULE Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894357 spots for SRR7168884.sra Written 894357 spots for SRR7168884.sra Read 894372 spots for SRR7168884.sra Written 894372 spots for SRR7168884.sra SRR ids: ['SRR7168884.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2djmwrs1 SRR7168884.sra spots: 17887155 blocks: [[1, 894357], [894358, 1788714], [1788715, 2683071], [2683072, 3577428], [3577429, 4471785], [4471786, 5366142], [5366143, 6260499], [6260500, 7154856], [7154857, 8049213], [8049214, 8943570], [8943571, 9837927], [9837928, 10732284], [10732285, 11626641], [11626642, 12520998], [12520999, 13415355], [13415356, 14309712], [14309713, 15204069], [15204070, 16098426], [16098427, 16992783], [16992784, 17887155]] SRR7168884 file size 6039669 SRR7168884 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168884 SRR7168884_1.fastq SRR7168884_2.fastq Input file: SRR7168884_1.fastq Paired file: SRR7168884_2.fastq trimmed: SRR7168884-trimmed-pair1.fastq, SRR7168884-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 20:02:12 2025 >> started Sat Feb 15 20:08:56 2025 >> done (403.673s) 17887155 read pairs processed; of these: 12554 ( 0.07%) short read pairs filtered out after trimming by size control 15939 ( 0.09%) empty read pairs filtered out after trimming by size control 17858662 (99.84%) read pairs available; of these: 9123108 (51.09%) trimmed read pairs available after processing 8735554 (48.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 1 0.00% 21 4 0.00% 22 15 0.00% 23 3 0.00% 24 8 0.00% 25 10 0.00% 26 8 0.00% 27 8 0.00% 28 5 0.00% 29 6 0.00% 30 16 0.00% 31 8 0.00% 32 8 0.00% 33 6 0.00% 34 15 0.00% 35 12 0.00% 36 12 0.00% 37 23 0.00% 38 20 0.00% 39 26 0.00% 40 27 0.00% 41 37 0.00% 42 41 0.00% 43 42 0.00% 44 41 0.00% 45 51 0.00% 46 60 0.00% 47 56 0.00% 48 55 0.00% 49 89 0.00% 50 103 0.00% 51 108 0.00% 52 131 0.00% 53 127 0.00% 54 169 0.00% 55 161 0.00% 56 199 0.00% 57 210 0.00% 58 236 0.00% 59 275 0.00% 60 333 0.00% 61 354 0.00% 62 388 0.00% 63 467 0.00% 64 497 0.00% 65 634 0.00% 66 642 0.00% 67 776 0.00% 68 867 0.00% 69 1212 0.01% 70 1275 0.01% 71 1300 0.01% 72 1400 0.01% 73 1624 0.01% 74 1804 0.01% 75 2006 0.01% 76 2233 0.01% 77 2425 0.01% 78 2861 0.02% 79 3079 0.02% 80 3552 0.02% 81 3842 0.02% 82 4441 0.02% 83 4993 0.03% 84 6061 0.03% 85 6897 0.04% 86 7303 0.04% 87 7825 0.04% 88 8504 0.05% 89 9150 0.05% 90 9843 0.06% 91 10819 0.06% 92 11654 0.07% 93 12824 0.07% 94 13660 0.08% 95 14707 0.08% 96 15713 0.09% 97 16610 0.09% 98 17065 0.10% 99 18062 0.10% 100 19147 0.11% 101 20283 0.11% 102 21851 0.12% 103 23011 0.13% 104 24060 0.13% 105 25731 0.14% 106 27089 0.15% 107 28044 0.16% 108 28590 0.16% 109 30165 0.17% 110 30665 0.17% 111 32218 0.18% 112 33642 0.19% 113 34929 0.20% 114 36460 0.20% 115 38857 0.22% 116 39900 0.22% 117 40606 0.23% 118 42380 0.24% 119 43354 0.24% 120 44795 0.25% 121 46035 0.26% 122 47930 0.27% 123 49348 0.28% 124 51593 0.29% 125 53673 0.30% 126 56509 0.32% 127 57587 0.32% 128 59267 0.33% 129 60555 0.34% 130 63432 0.36% 131 65151 0.36% 132 67327 0.38% 133 71442 0.40% 134 74165 0.42% 135 77643 0.43% 136 81450 0.46% 137 85719 0.48% 138 90060 0.50% 139 96356 0.54% 140 102345 0.57% 141 110199 0.62% 142 120591 0.68% 143 134058 0.75% 144 153503 0.86% 145 181664 1.02% 146 223657 1.25% 147 297936 1.67% 148 451726 2.53% 149 879638 4.93% 150 4314625 24.16% 151 8735554 48.91% 17858662 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=25 prefix-density=0.34 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=332.72 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=27 prefix-density=0.34 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=39.15 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7168884 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 21:02:57 Started mapping on | Feb 15 21:03:01 Finished on | Feb 15 23:05:41 Mapping speed, Million of reads per hour | 8.74 Number of input reads | 17858662 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16761545 Uniquely mapped reads % | 93.86% Average mapped length | 292.16 Number of splices: Total | 15949936 Number of splices: Annotated (sjdb) | 15552199 Number of splices: GT/AG | 15643252 Number of splices: GC/AG | 243540 Number of splices: AT/AC | 9172 Number of splices: Non-canonical | 53972 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 489428 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 142470 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 619212 619212 619212 N_multimapping 489428 489428 489428 N_noFeature 742179 16345380 1015751 N_ambiguous 275695 2219 131260 UnstrandedReadsAssigned:15743671 PositiveStrandReadsAssigned:413946 NegativeStrandReadsAssigned:15614534 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168884 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168884-trimmed-pair1.fastq SRR7168884-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,858,662 reads, 15,632,264 reads pseudoaligned [quant] estimated average fragment length: 234.09 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR7168884.ke.tsv 34699 SRR7168884.se.tsv 87100 total ==> SRR7168884.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.91 867 31.929 Potri.005G024800.1.v4.1 1035 801.91 218 17.8696 Potri.004G059700.1.v4.1 961 727.952 4 0.361194 Potri.007G009000.2.v4.1 1416 1182.91 0 0 Potri.003G141000.2.v4.1 2943 2709.91 1036 25.1297 Potri.016G087400.1.v4.1 270 84.7518 830 643.742 Potri.015G069301.1.v4.1 564 335.139 0 0 Potri.010G195200.1.v4.1 1773 1539.91 117.949 5.03479 Potri.012G127500.1.v4.1 977 743.926 145 12.8121 ==> SRR7168884.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 870 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 54 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 175 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR7168884 completed mapping pipeline successfully