Starting /dee2/code/volunteer_pipeline.sh SRR7168885 current disk space = 3092257566720 free memory = 1496073076 SRR7168885 SRAfilesize f7285f85fbd2c7042d873f6a40a06732 SRR7168885.sra SRR7168885.sra file validated SRR7168885 is paired end SRR7168885 is conventional basespace SRR7168885 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168885_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06425 34.0 33.0 34.0 32.0 34.0 2 33.17875 34.0 33.0 34.0 32.0 34.0 3 33.24375 34.0 33.0 34.0 32.0 34.0 4 33.30375 34.0 33.0 34.0 33.0 34.0 5 33.34875 34.0 33.0 34.0 33.0 34.0 6 37.103 38.0 37.0 38.0 36.0 38.0 7 37.3735 38.0 38.0 38.0 37.0 38.0 8 37.45225 38.0 38.0 38.0 37.0 38.0 9 37.4985 38.0 38.0 38.0 37.0 38.0 10-14 37.544050000000006 38.0 38.0 38.0 37.8 38.0 15-19 37.521699999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.497550000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.48195 38.0 38.0 38.0 37.6 38.0 30-34 37.42945 38.0 38.0 38.0 37.0 38.0 35-39 37.37625 38.0 38.0 38.0 37.0 38.0 40-44 37.311749999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.322050000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.2247 38.0 38.0 38.0 36.8 38.0 55-59 37.17345 38.0 38.0 38.0 36.6 38.0 60-64 37.040000000000006 38.0 38.0 38.0 36.2 38.0 65-69 37.025349999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.06905 38.0 38.0 38.0 36.0 38.0 75-79 36.9476 38.0 38.0 38.0 36.0 38.0 80-84 36.757549999999995 38.0 38.0 38.0 35.2 38.0 85-89 36.6177 38.0 38.0 38.0 34.6 38.0 90-94 36.5452 38.0 38.0 38.0 34.2 38.0 95-99 36.3572 38.0 38.0 38.0 33.8 38.0 100-104 36.334799999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.23945 38.0 38.0 38.0 34.0 38.0 110-114 35.898250000000004 38.0 37.2 38.0 32.2 38.0 115-119 35.5753 38.0 37.0 38.0 30.6 38.0 120-124 35.34375 38.0 36.4 38.0 29.0 38.0 125-129 35.08275 38.0 36.0 38.0 28.0 38.0 130-134 34.60555 38.0 35.2 38.0 25.4 38.0 135-139 34.06795 38.0 34.4 38.0 23.2 38.0 140-144 33.4816 38.0 33.4 38.0 20.4 38.0 145-149 32.0484 38.0 32.8 38.0 10.8 38.0 150-151 28.194625000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 6.0 19 5.0 20 6.0 21 2.0 22 10.0 23 8.0 24 17.0 25 10.0 26 21.0 27 28.0 28 39.0 29 46.0 30 51.0 31 63.0 32 91.0 33 108.0 34 135.0 35 279.0 36 608.0 37 2458.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.768989819890365 10.649960845732185 11.95510310623858 42.625946228138865 2 21.825 17.5 34.875 25.8 3 19.25 22.3 24.025 34.425 4 24.2 30.525000000000002 20.825 24.45 5 22.7 34.575 23.875 18.85 6 18.675 36.55 24.875 19.900000000000002 7 13.8 24.275 43.475 18.45 8 18.85 23.45 32.4 25.3 9 17.9 24.4 33.6 24.099999999999998 10-14 19.950000000000003 29.595 26.705000000000002 23.75 15-19 20.625 28.035 27.750000000000004 23.59 20-24 19.57 28.265 28.305000000000003 23.86 25-29 19.575 28.965000000000003 27.83 23.630000000000003 30-34 20.485 28.499999999999996 27.334999999999997 23.68 35-39 20.195 28.665000000000003 27.66 23.48 40-44 20.105 28.754999999999995 27.750000000000004 23.39 45-49 20.169999999999998 28.18 28.275 23.375 50-54 20.635 28.23 27.33 23.805 55-59 19.919999999999998 28.925 28.07 23.085 60-64 20.24 28.615000000000002 27.900000000000002 23.244999999999997 65-69 21.075 27.85 27.435 23.64 70-74 20.51 28.335 27.560000000000002 23.595 75-79 20.29 28.96 27.35 23.400000000000002 80-84 20.34 28.084999999999997 28.165000000000003 23.41 85-89 20.9 28.575 27.235 23.29 90-94 20.785 27.865000000000002 27.735 23.615 95-99 20.89 27.794999999999998 28.255000000000003 23.06 100-104 20.849999999999998 28.775000000000002 27.005000000000003 23.369999999999997 105-109 20.375 28.199999999999996 27.810000000000002 23.615 110-114 21.39 27.99 27.32 23.3 115-119 21.04 28.95 26.96 23.05 120-124 21.0 28.51 26.790000000000003 23.7 125-129 21.13 28.89 26.69 23.29 130-134 21.84 28.410000000000004 26.729999999999997 23.02 135-139 21.43 28.235 27.105 23.23 140-144 21.22 28.04 26.855 23.885 145-149 21.69 28.71 26.275 23.325000000000003 150-151 21.825 27.8375 25.874999999999996 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 3.0 25 3.5 26 3.5 27 7.0 28 9.5 29 8.0 30 10.5 31 19.5 32 30.5 33 46.5 34 59.0 35 75.5 36 100.5 37 115.0 38 127.5 39 155.0 40 187.5 41 223.0 42 257.5 43 283.5 44 276.5 45 268.5 46 258.0 47 226.0 48 209.5 49 192.0 50 164.5 51 133.5 52 126.5 53 115.0 54 75.5 55 53.5 56 46.0 57 34.0 58 25.5 59 21.5 60 14.5 61 10.5 62 9.0 63 5.5 64 2.5 65 0.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.2250000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.875 0.0 0.0 0.0 0.0 102-103 2.275 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 2.8375 0.0 0.0 0.0 0.0 108-109 3.1 0.0 0.0 0.0 0.0 110-111 3.4625 0.0 0.0 0.0 0.0 112-113 3.8125 0.0 0.0 0.0 0.0 114-115 4.262499999999999 0.0 0.0 0.0 0.0 116-117 4.7125 0.0 0.0 0.0 0.0 118-119 5.262499999999999 0.0 0.0 0.0 0.0 120-121 5.6875 0.0 0.0 0.0 0.0 122-123 6.0125 0.0 0.0 0.0 0.0 124-125 6.7625 0.0 0.0 0.0 0.0 126-127 7.3375 0.0 0.0 0.0 0.0 128-129 7.975 0.0 0.0 0.0 0.0 130-131 8.6125 0.0 0.0 0.0 0.0 132-133 9.212499999999999 0.0 0.0 0.0 0.0 134-135 9.7625 0.0 0.0 0.0 0.0 136-137 10.3125 0.0 0.0 0.0 0.0 138-139 10.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATTAT 10 0.006836113 144.9625 4 >>END_MODULE SRR7168885 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168885_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85575 33.0 33.0 34.0 32.0 34.0 2 32.98725 34.0 33.0 34.0 32.0 34.0 3 33.0275 34.0 33.0 34.0 32.0 34.0 4 32.93575 34.0 33.0 34.0 32.0 34.0 5 32.92975 34.0 33.0 34.0 32.0 34.0 6 37.16025 38.0 38.0 38.0 37.0 38.0 7 37.1655 38.0 38.0 38.0 37.0 38.0 8 37.164 38.0 38.0 38.0 37.0 38.0 9 37.067 38.0 38.0 38.0 37.0 38.0 10-14 37.09625 38.0 38.0 38.0 37.0 38.0 15-19 37.127250000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.10995 38.0 38.0 38.0 37.0 38.0 25-29 37.1108 38.0 38.0 38.0 37.0 38.0 30-34 37.0865 38.0 38.0 38.0 37.0 38.0 35-39 37.03495 38.0 38.0 38.0 37.0 38.0 40-44 36.92530000000001 38.0 38.0 38.0 36.2 38.0 45-49 36.9477 38.0 38.0 38.0 36.4 38.0 50-54 36.8221 38.0 38.0 38.0 36.0 38.0 55-59 36.85105 38.0 38.0 38.0 35.8 38.0 60-64 36.76495 38.0 38.0 38.0 36.0 38.0 65-69 36.7258 38.0 38.0 38.0 35.8 38.0 70-74 36.625150000000005 38.0 38.0 38.0 35.2 38.0 75-79 36.477000000000004 38.0 38.0 38.0 34.6 38.0 80-84 36.52185 38.0 38.0 38.0 34.6 38.0 85-89 36.40815 38.0 38.0 38.0 34.6 38.0 90-94 36.3236 38.0 38.0 38.0 34.0 38.0 95-99 36.286500000000004 38.0 38.0 38.0 34.0 38.0 100-104 35.963849999999994 38.0 37.8 38.0 32.8 38.0 105-109 35.735499999999995 38.0 37.6 38.0 31.8 38.0 110-114 35.772299999999994 38.0 37.4 38.0 32.2 38.0 115-119 35.60615 38.0 37.2 38.0 31.0 38.0 120-124 35.221199999999996 38.0 36.6 38.0 29.8 38.0 125-129 35.10335 38.0 36.2 38.0 29.2 38.0 130-134 34.41705 38.0 35.2 38.0 25.6 38.0 135-139 33.761250000000004 38.0 34.0 38.0 20.6 38.0 140-144 33.10755 38.0 33.0 38.0 15.8 38.0 145-149 31.969849999999997 38.0 33.0 38.0 8.0 38.0 150-151 26.95375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 2.0 5 1.0 6 0.0 7 0.0 8 3.0 9 0.0 10 0.0 11 3.0 12 4.0 13 0.0 14 1.0 15 9.0 16 10.0 17 9.0 18 3.0 19 9.0 20 12.0 21 4.0 22 18.0 23 17.0 24 18.0 25 20.0 26 22.0 27 26.0 28 30.0 29 37.0 30 42.0 31 62.0 32 79.0 33 107.0 34 136.0 35 238.0 36 571.0 37 2497.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.975 17.599999999999998 18.05 31.374999999999996 2 26.200000000000003 26.875 30.25 16.675 3 21.3 27.675 31.25 19.775000000000002 4 24.925 32.95 23.150000000000002 18.975 5 24.325 35.325 22.975 17.375 6 19.525000000000002 38.175 23.575 18.725 7 19.125 19.6 41.0 20.275000000000002 8 22.1 24.775 27.825 25.3 9 20.625 24.8 31.2 23.375 10-14 23.02 28.235 26.669999999999998 22.075 15-19 22.384999999999998 27.955000000000002 27.93 21.73 20-24 22.25 28.655 27.825 21.27 25-29 22.845 27.900000000000002 28.28 20.974999999999998 30-34 23.235 27.900000000000002 27.955000000000002 20.91 35-39 23.01 28.125 27.615000000000002 21.25 40-44 23.095 27.889999999999997 28.115000000000002 20.9 45-49 22.82 28.015 28.110000000000003 21.055 50-54 22.525000000000002 28.34 27.315 21.82 55-59 22.79 27.825 28.485 20.9 60-64 23.26 27.82 27.985 20.935000000000002 65-69 22.705000000000002 28.22 27.52 21.555 70-74 23.3 27.584999999999997 27.805000000000003 21.310000000000002 75-79 22.85 27.665 28.000000000000004 21.485000000000003 80-84 23.235 28.255000000000003 26.87 21.64 85-89 23.53 28.475 27.315 20.68 90-94 23.305 27.91 27.765 21.02 95-99 23.435 28.27 27.775 20.52 100-104 23.674999999999997 27.384999999999998 27.76 21.18 105-109 23.76 27.860000000000003 27.185 21.195 110-114 23.97 27.735 27.525 20.77 115-119 24.15 27.735 28.16 19.955000000000002 120-124 24.224999999999998 28.015 27.35 20.41 125-129 24.945 28.439999999999998 26.395000000000003 20.22 130-134 25.009999999999998 27.575 27.43 19.985 135-139 25.27 27.36 27.1 20.27 140-144 25.619999999999997 27.37 27.200000000000003 19.81 145-149 25.22 28.225 26.85 19.705000000000002 150-151 26.237500000000004 28.5625 26.487500000000004 18.712500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 3.0 26 3.0 27 3.5 28 4.5 29 11.0 30 15.0 31 14.0 32 20.0 33 37.0 34 52.5 35 65.0 36 85.0 37 119.0 38 140.0 39 156.0 40 186.5 41 231.5 42 252.5 43 261.5 44 290.0 45 269.0 46 265.5 47 267.5 48 220.0 49 195.0 50 169.5 51 143.0 52 119.5 53 90.5 54 76.0 55 60.0 56 44.0 57 36.0 58 25.0 59 15.0 60 13.5 61 10.5 62 7.5 63 5.5 64 3.0 65 2.0 66 2.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.4375 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.2 0.0 0.0 0.0 0.0 104-105 2.5375 0.0 0.0 0.0 0.0 106-107 2.7625 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.4375 0.0 0.0 0.0 0.0 112-113 3.7874999999999996 0.0 0.0 0.0 0.0 114-115 4.237500000000001 0.0 0.0 0.0 0.0 116-117 4.7125 0.0 0.0 0.0 0.0 118-119 5.262499999999999 0.0 0.0 0.0 0.0 120-121 5.6875 0.0 0.0 0.0 0.0 122-123 6.0125 0.0 0.0 0.0 0.0 124-125 6.775 0.0 0.0 0.0 0.0 126-127 7.325 0.0 0.0 0.0 0.0 128-129 7.975 0.0 0.0 0.0 0.0 130-131 8.5875 0.0 0.0 0.0 0.0 132-133 9.15 0.0 0.0 0.0 0.0 134-135 9.7 0.0 0.0 0.0 0.0 136-137 10.287500000000001 0.0 0.0 0.0 0.0 138-139 10.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCGAGT 10 0.006830828 145.0 8 GGGGGGG 20 0.00593511 29.0 110-114 >>END_MODULE Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822141 spots for SRR7168885.sra Written 822141 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra Read 822133 spots for SRR7168885.sra Written 822133 spots for SRR7168885.sra SRR ids: ['SRR7168885.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8rnjqyd3 SRR7168885.sra spots: 16442668 blocks: [[1, 822133], [822134, 1644266], [1644267, 2466399], [2466400, 3288532], [3288533, 4110665], [4110666, 4932798], [4932799, 5754931], [5754932, 6577064], [6577065, 7399197], [7399198, 8221330], [8221331, 9043463], [9043464, 9865596], [9865597, 10687729], [10687730, 11509862], [11509863, 12331995], [12331996, 13154128], [13154129, 13976261], [13976262, 14798394], [14798395, 15620527], [15620528, 16442668]] SRR7168885 file size 5550180 SRR7168885 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168885 SRR7168885_1.fastq SRR7168885_2.fastq Input file: SRR7168885_1.fastq Paired file: SRR7168885_2.fastq trimmed: SRR7168885-trimmed-pair1.fastq, SRR7168885-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 20:09:04 2025 >> started Sat Feb 15 20:17:01 2025 >> done (476.520s) 16442668 read pairs processed; of these: 13728 ( 0.08%) short read pairs filtered out after trimming by size control 25584 ( 0.16%) empty read pairs filtered out after trimming by size control 16403356 (99.76%) read pairs available; of these: 8716645 (53.14%) trimmed read pairs available after processing 7686711 (46.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 7 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 5 0.00% 26 6 0.00% 27 11 0.00% 28 7 0.00% 29 12 0.00% 30 3 0.00% 31 7 0.00% 32 9 0.00% 33 7 0.00% 34 17 0.00% 35 16 0.00% 36 12 0.00% 37 24 0.00% 38 19 0.00% 39 25 0.00% 40 30 0.00% 41 36 0.00% 42 43 0.00% 43 48 0.00% 44 57 0.00% 45 70 0.00% 46 72 0.00% 47 85 0.00% 48 104 0.00% 49 123 0.00% 50 113 0.00% 51 143 0.00% 52 169 0.00% 53 199 0.00% 54 202 0.00% 55 239 0.00% 56 286 0.00% 57 329 0.00% 58 349 0.00% 59 408 0.00% 60 498 0.00% 61 533 0.00% 62 583 0.00% 63 672 0.00% 64 760 0.00% 65 904 0.01% 66 1017 0.01% 67 1159 0.01% 68 1306 0.01% 69 2112 0.01% 70 2032 0.01% 71 1947 0.01% 72 2187 0.01% 73 2542 0.02% 74 2826 0.02% 75 3081 0.02% 76 3425 0.02% 77 4028 0.02% 78 4264 0.03% 79 4872 0.03% 80 5341 0.03% 81 6025 0.04% 82 6716 0.04% 83 7539 0.05% 84 8916 0.05% 85 9840 0.06% 86 10634 0.06% 87 11342 0.07% 88 12364 0.08% 89 13075 0.08% 90 13879 0.08% 91 15338 0.09% 92 16181 0.10% 93 17508 0.11% 94 18917 0.12% 95 20307 0.12% 96 21337 0.13% 97 22523 0.14% 98 23255 0.14% 99 24103 0.15% 100 25652 0.16% 101 26711 0.16% 102 28223 0.17% 103 29711 0.18% 104 30868 0.19% 105 32340 0.20% 106 33885 0.21% 107 34823 0.21% 108 36074 0.22% 109 37357 0.23% 110 38451 0.23% 111 39762 0.24% 112 40482 0.25% 113 42214 0.26% 114 43960 0.27% 115 45888 0.28% 116 46499 0.28% 117 48345 0.29% 118 49579 0.30% 119 50462 0.31% 120 51393 0.31% 121 53023 0.32% 122 54037 0.33% 123 56366 0.34% 124 58119 0.35% 125 59979 0.37% 126 61287 0.37% 127 63777 0.39% 128 65328 0.40% 129 66799 0.41% 130 68431 0.42% 131 69887 0.43% 132 72415 0.44% 133 75167 0.46% 134 77536 0.47% 135 81507 0.50% 136 84794 0.52% 137 87768 0.54% 138 92100 0.56% 139 97731 0.60% 140 102575 0.63% 141 109014 0.66% 142 118237 0.72% 143 131186 0.80% 144 147572 0.90% 145 172174 1.05% 146 209515 1.28% 147 272886 1.66% 148 405899 2.47% 149 776525 4.73% 150 3783136 23.06% 151 7686711 46.86% 16403356 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=14 prefix-density=0.42 prefix-fanout=2.1 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=29.90 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=10.4 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=52.31 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7168885 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 21:27:50 Started mapping on | Feb 15 21:28:04 Finished on | Feb 15 23:54:52 Mapping speed, Million of reads per hour | 6.70 Number of input reads | 16403356 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15188469 Uniquely mapped reads % | 92.59% Average mapped length | 289.74 Number of splices: Total | 14071758 Number of splices: Annotated (sjdb) | 13715198 Number of splices: GT/AG | 13783397 Number of splices: GC/AG | 229010 Number of splices: AT/AC | 8398 Number of splices: Non-canonical | 50953 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 524767 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 84997 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 702727 702727 702727 N_multimapping 524767 524767 524767 N_noFeature 587772 14859792 795007 N_ambiguous 261020 1756 138172 UnstrandedReadsAssigned:14339677 PositiveStrandReadsAssigned:326921 NegativeStrandReadsAssigned:14255290 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168885 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168885-trimmed-pair1.fastq SRR7168885-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,403,356 reads, 14,362,029 reads pseudoaligned [quant] estimated average fragment length: 226.836 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 999 rounds 52401 SRR7168885.ke.tsv 34699 SRR7168885.se.tsv 87100 total ==> SRR7168885.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.16 1188 49.0701 Potri.005G024800.1.v4.1 1035 809.164 177 16.1926 Potri.004G059700.1.v4.1 961 735.218 20 2.01369 Potri.007G009000.2.v4.1 1416 1190.16 0 0 Potri.003G141000.2.v4.1 2943 2717.16 596.83 16.2597 Potri.016G087400.1.v4.1 270 91.5136 691 558.948 Potri.015G069301.1.v4.1 564 343.255 0 0 Potri.010G195200.1.v4.1 1773 1547.16 28 1.33968 Potri.012G127500.1.v4.1 977 751.188 192 18.9204 ==> SRR7168885.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1079 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168885 completed mapping pipeline successfully