Starting /dee2/code/volunteer_pipeline.sh SRR7168886 current disk space = 3091347701760 free memory = 1574723260 SRR7168886 SRAfilesize 44bc0e43b21ba9e6668722cf9253dde3 SRR7168886.sra SRR7168886.sra file validated SRR7168886 is paired end SRR7168886 is conventional basespace SRR7168886 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168886_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09125 34.0 33.0 34.0 32.0 34.0 2 33.2125 34.0 33.0 34.0 32.0 34.0 3 33.238 34.0 33.0 34.0 32.0 34.0 4 33.33075 34.0 33.0 34.0 33.0 34.0 5 33.34525 34.0 33.0 34.0 33.0 34.0 6 37.10575 38.0 38.0 38.0 36.0 38.0 7 37.3655 38.0 38.0 38.0 37.0 38.0 8 37.36125 38.0 38.0 38.0 37.0 38.0 9 37.4785 38.0 38.0 38.0 37.0 38.0 10-14 37.511449999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.46485 38.0 38.0 38.0 37.6 38.0 20-24 37.449400000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.42695 38.0 38.0 38.0 37.6 38.0 30-34 37.3902 38.0 38.0 38.0 37.0 38.0 35-39 37.32955 38.0 38.0 38.0 37.0 38.0 40-44 37.34505 38.0 38.0 38.0 37.0 38.0 45-49 37.33595 38.0 38.0 38.0 37.0 38.0 50-54 37.265499999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.185249999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.1471 38.0 38.0 38.0 36.6 38.0 65-69 37.11735 38.0 38.0 38.0 36.4 38.0 70-74 37.0394 38.0 38.0 38.0 36.0 38.0 75-79 37.0017 38.0 38.0 38.0 36.0 38.0 80-84 36.90285 38.0 38.0 38.0 36.0 38.0 85-89 36.8403 38.0 38.0 38.0 35.8 38.0 90-94 36.7014 38.0 38.0 38.0 35.0 38.0 95-99 36.64125 38.0 38.0 38.0 34.8 38.0 100-104 36.53295 38.0 38.0 38.0 34.0 38.0 105-109 36.45295 38.0 38.0 38.0 34.0 38.0 110-114 36.222 38.0 38.0 38.0 34.0 38.0 115-119 36.00605 38.0 37.2 38.0 33.2 38.0 120-124 35.80800000000001 38.0 37.0 38.0 31.8 38.0 125-129 35.4557 38.0 36.0 38.0 30.6 38.0 130-134 34.993100000000005 38.0 35.6 38.0 28.2 38.0 135-139 34.565149999999996 38.0 34.8 38.0 26.8 38.0 140-144 34.16965 38.0 33.2 38.0 25.4 38.0 145-149 33.152 38.0 33.0 38.0 18.6 38.0 150-151 28.316375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 1.0 20 5.0 21 8.0 22 7.0 23 13.0 24 6.0 25 16.0 26 20.0 27 18.0 28 24.0 29 38.0 30 34.0 31 59.0 32 73.0 33 99.0 34 122.0 35 249.0 36 636.0 37 2560.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.4250454663549 13.198233307352558 12.886464016627697 37.49025720966485 2 22.611305652826413 17.68384192096048 33.19159579789895 26.513256628314156 3 18.95 24.0 25.124999999999996 31.924999999999997 4 22.45 31.95 22.175 23.425 5 22.625 33.85 23.25 20.275000000000002 6 17.349999999999998 37.1 25.55 20.0 7 13.125 24.25 44.7 17.925 8 18.575 24.474999999999998 31.775 25.174999999999997 9 16.85 24.575 33.5 25.074999999999996 10-14 19.68 29.73 27.169999999999998 23.419999999999998 15-19 19.785 28.985 28.12 23.11 20-24 19.615 28.744999999999997 27.900000000000002 23.74 25-29 19.45 29.134999999999998 27.705000000000002 23.71 30-34 19.36 28.845 28.050000000000004 23.745 35-39 19.7 28.87 27.455000000000002 23.974999999999998 40-44 19.855 28.865000000000002 27.91 23.369999999999997 45-49 20.075000000000003 28.64 27.29 23.995 50-54 19.765 28.59 28.310000000000002 23.335 55-59 19.645000000000003 28.655 27.815 23.885 60-64 20.145 28.685 27.605 23.565 65-69 19.64 28.925 27.74 23.695 70-74 20.26 28.7 27.41 23.630000000000003 75-79 19.605 28.935 27.685 23.775 80-84 20.25 28.444999999999997 27.339999999999996 23.965 85-89 19.775000000000002 28.52 27.994999999999997 23.71 90-94 20.77 28.015 28.035 23.18 95-99 20.01 28.42 27.800000000000004 23.77 100-104 20.465 28.525 27.775 23.235 105-109 20.380000000000003 28.310000000000002 27.705000000000002 23.605 110-114 21.285 28.055000000000003 27.77 22.89 115-119 20.865000000000002 28.16 27.62 23.355 120-124 20.375 28.24 27.279999999999998 24.104999999999997 125-129 20.525 28.29 27.150000000000002 24.035 130-134 21.065 28.849999999999998 26.72 23.365 135-139 20.875 28.725 26.495 23.905 140-144 20.54 28.33 27.425 23.705000000000002 145-149 21.435000000000002 28.125 26.6 23.84 150-151 20.9125 28.549999999999997 26.775 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 4.5 26 8.0 27 9.0 28 12.5 29 13.5 30 17.0 31 26.0 32 32.0 33 38.0 34 58.5 35 80.5 36 97.5 37 125.5 38 157.0 39 189.5 40 209.5 41 228.0 42 256.5 43 266.0 44 260.0 45 244.0 46 234.5 47 239.5 48 228.5 49 194.0 50 162.5 51 128.5 52 98.0 53 95.0 54 74.0 55 48.5 56 44.0 57 34.0 58 26.0 59 19.0 60 10.5 61 8.5 62 4.5 63 3.0 64 3.0 65 1.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96412329459324 97.925 2 1.010611419909045 2.0 3 0.025265285497726126 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.3625 0.0 0.0 0.0 0.0 108-109 2.7249999999999996 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.5125 0.0 0.0 0.0 0.0 114-115 3.8375000000000004 0.0 0.0 0.0 0.0 116-117 4.225 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 4.9125 0.0 0.0 0.0 0.0 122-123 5.4125 0.0 0.0 0.0 0.0 124-125 5.875 0.0 0.0 0.0 0.0 126-127 6.275 0.0 0.0 0.0 0.0 128-129 6.65 0.0 0.0 0.0 0.0 130-131 7.225 0.0 0.0 0.0 0.0 132-133 7.737500000000001 0.0 0.0 0.0 0.0 134-135 8.0875 0.0 0.0 0.0 0.0 136-137 8.5 0.0 0.0 0.0 0.0 138-139 9.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168886 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168886_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.889 33.0 33.0 34.0 32.0 34.0 2 33.02775 34.0 33.0 34.0 32.0 34.0 3 33.05575 34.0 33.0 34.0 32.0 34.0 4 33.0205 34.0 33.0 34.0 33.0 34.0 5 32.99775 34.0 33.0 34.0 33.0 34.0 6 37.164 38.0 38.0 38.0 37.0 38.0 7 37.28175 38.0 38.0 38.0 37.0 38.0 8 37.22625 38.0 38.0 38.0 37.0 38.0 9 37.152 38.0 38.0 38.0 37.0 38.0 10-14 37.141149999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.150999999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.07285 38.0 38.0 38.0 37.0 38.0 25-29 37.092850000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.03025 38.0 38.0 38.0 37.0 38.0 35-39 37.0775 38.0 38.0 38.0 37.0 38.0 40-44 37.00175 38.0 38.0 38.0 37.0 38.0 45-49 37.001400000000004 38.0 38.0 38.0 37.0 38.0 50-54 36.915499999999994 38.0 38.0 38.0 36.6 38.0 55-59 36.88645 38.0 38.0 38.0 36.0 38.0 60-64 36.8985 38.0 38.0 38.0 36.4 38.0 65-69 36.76765 38.0 38.0 38.0 36.0 38.0 70-74 36.8029 38.0 38.0 38.0 36.0 38.0 75-79 36.7452 38.0 38.0 38.0 36.0 38.0 80-84 36.558800000000005 38.0 38.0 38.0 35.2 38.0 85-89 36.45505 38.0 38.0 38.0 34.8 38.0 90-94 36.42105 38.0 38.0 38.0 35.0 38.0 95-99 36.3528 38.0 38.0 38.0 34.2 38.0 100-104 36.2257 38.0 38.0 38.0 34.0 38.0 105-109 36.1151 38.0 38.0 38.0 34.0 38.0 110-114 35.994749999999996 38.0 38.0 38.0 33.6 38.0 115-119 35.72385 38.0 38.0 38.0 32.6 38.0 120-124 35.6329 38.0 37.4 38.0 32.0 38.0 125-129 35.3328 38.0 37.0 38.0 31.0 38.0 130-134 35.0347 38.0 36.2 38.0 29.4 38.0 135-139 34.5615 38.0 36.0 38.0 27.2 38.0 140-144 34.098749999999995 38.0 35.2 38.0 24.4 38.0 145-149 32.976099999999995 38.0 33.0 38.0 15.2 38.0 150-151 28.614875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 3.0 9 2.0 10 1.0 11 3.0 12 1.0 13 5.0 14 3.0 15 4.0 16 7.0 17 6.0 18 4.0 19 13.0 20 9.0 21 6.0 22 13.0 23 22.0 24 8.0 25 23.0 26 26.0 27 13.0 28 22.0 29 41.0 30 43.0 31 41.0 32 58.0 33 73.0 34 111.0 35 212.0 36 465.0 37 2750.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.3 19.825 17.05 27.825 2 26.400000000000002 26.474999999999998 31.574999999999996 15.55 3 21.95 28.15 29.325000000000003 20.575 4 23.075000000000003 36.375 22.775000000000002 17.775 5 24.325 36.25 21.45 17.974999999999998 6 18.55 40.050000000000004 23.525 17.875 7 19.825 19.525000000000002 40.375 20.275000000000002 8 21.675 25.124999999999996 26.525 26.674999999999997 9 22.125 25.2 29.65 23.025000000000002 10-14 23.64 28.775000000000002 26.77 20.815 15-19 22.8 27.765 28.610000000000003 20.825 20-24 22.650000000000002 28.044999999999998 28.57 20.735 25-29 23.064999999999998 28.205000000000002 27.834999999999997 20.895 30-34 22.439999999999998 28.435 28.165000000000003 20.96 35-39 23.44 27.46 28.29 20.810000000000002 40-44 23.09 27.62 28.225 21.065 45-49 22.905 28.225 27.865000000000002 21.005 50-54 23.325000000000003 28.105000000000004 28.105000000000004 20.465 55-59 23.669999999999998 27.63 28.185 20.515 60-64 22.905 28.105000000000004 28.065 20.925 65-69 23.76 27.810000000000002 28.144999999999996 20.285 70-74 23.53 27.665 27.755000000000003 21.05 75-79 23.18 28.155 28.005000000000003 20.66 80-84 23.380000000000003 27.544999999999998 27.845 21.23 85-89 23.580000000000002 27.139999999999997 28.23 21.05 90-94 23.29 27.939999999999998 28.065 20.705000000000002 95-99 23.169999999999998 28.29 28.025 20.515 100-104 23.915 27.87 27.685 20.53 105-109 23.64 27.785 28.115000000000002 20.46 110-114 23.845 27.99 27.765 20.4 115-119 24.365000000000002 28.275 27.500000000000004 19.86 120-124 23.985 27.93 28.12 19.965 125-129 24.455 27.865000000000002 27.544999999999998 20.135 130-134 24.959999999999997 28.33 27.375 19.335 135-139 25.275 27.900000000000002 27.295 19.53 140-144 24.705 27.96 27.57 19.765 145-149 25.39 29.04 26.52 19.05 150-151 26.025 27.325 27.3125 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 3.0 26 4.5 27 8.0 28 7.5 29 7.5 30 11.0 31 17.5 32 28.5 33 44.5 34 51.0 35 61.5 36 95.5 37 116.0 38 132.0 39 164.0 40 200.5 41 215.0 42 242.5 43 284.0 44 289.5 45 286.5 46 281.0 47 254.0 48 215.5 49 190.0 50 166.5 51 141.0 52 113.5 53 91.0 54 72.0 55 51.5 56 38.5 57 29.0 58 25.5 59 15.5 60 6.5 61 7.0 62 8.0 63 6.5 64 3.5 65 1.5 66 1.0 67 0.5 68 1.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.04016165698408 98.02499999999999 2 0.8840616317251832 1.7500000000000002 3 0.07577671129072998 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.5375 0.0 0.0 0.0 0.0 114-115 3.8875 0.0 0.0 0.0 0.0 116-117 4.275 0.0 0.0 0.0 0.0 118-119 4.65 0.0 0.0 0.0 0.0 120-121 4.949999999999999 0.0 0.0 0.0 0.0 122-123 5.4625 0.0 0.0 0.0 0.0 124-125 5.9 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.6875 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 7.7875 0.0 0.0 0.0 0.0 134-135 8.125 0.0 0.0 0.0 0.0 136-137 8.55 0.0 0.0 0.0 0.0 138-139 9.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATTAA 10 0.006830828 145.0 5 TTTTTTT 20 0.00593511 29.0 25-29 >>END_MODULE Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874743 spots for SRR7168886.sra Written 874743 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra Read 874727 spots for SRR7168886.sra Written 874727 spots for SRR7168886.sra SRR ids: ['SRR7168886.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8wwbewp6 SRR7168886.sra spots: 17494556 blocks: [[1, 874727], [874728, 1749454], [1749455, 2624181], [2624182, 3498908], [3498909, 4373635], [4373636, 5248362], [5248363, 6123089], [6123090, 6997816], [6997817, 7872543], [7872544, 8747270], [8747271, 9621997], [9621998, 10496724], [10496725, 11371451], [11371452, 12246178], [12246179, 13120905], [13120906, 13995632], [13995633, 14870359], [14870360, 15745086], [15745087, 16619813], [16619814, 17494556]] SRR7168886 file size 5906630 SRR7168886 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168886 SRR7168886_1.fastq SRR7168886_2.fastq Input file: SRR7168886_1.fastq Paired file: SRR7168886_2.fastq trimmed: SRR7168886-trimmed-pair1.fastq, SRR7168886-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 22:15:35 2025 >> started Sat Feb 15 22:25:56 2025 >> done (620.897s) 17494556 read pairs processed; of these: 19252 ( 0.11%) short read pairs filtered out after trimming by size control 23648 ( 0.14%) empty read pairs filtered out after trimming by size control 17451656 (99.75%) read pairs available; of these: 8857588 (50.75%) trimmed read pairs available after processing 8594068 (49.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 1 0.00% 21 5 0.00% 22 4 0.00% 23 6 0.00% 24 4 0.00% 25 7 0.00% 26 3 0.00% 27 6 0.00% 28 4 0.00% 29 5 0.00% 30 11 0.00% 31 8 0.00% 32 9 0.00% 33 13 0.00% 34 12 0.00% 35 19 0.00% 36 23 0.00% 37 18 0.00% 38 23 0.00% 39 25 0.00% 40 24 0.00% 41 26 0.00% 42 38 0.00% 43 49 0.00% 44 41 0.00% 45 62 0.00% 46 64 0.00% 47 70 0.00% 48 77 0.00% 49 106 0.00% 50 109 0.00% 51 128 0.00% 52 118 0.00% 53 185 0.00% 54 192 0.00% 55 196 0.00% 56 194 0.00% 57 229 0.00% 58 302 0.00% 59 307 0.00% 60 363 0.00% 61 401 0.00% 62 548 0.00% 63 517 0.00% 64 621 0.00% 65 675 0.00% 66 785 0.00% 67 872 0.00% 68 1092 0.01% 69 2347 0.01% 70 2178 0.01% 71 1673 0.01% 72 1765 0.01% 73 1906 0.01% 74 2041 0.01% 75 2311 0.01% 76 2688 0.02% 77 2854 0.02% 78 3254 0.02% 79 3693 0.02% 80 4147 0.02% 81 4844 0.03% 82 5229 0.03% 83 5875 0.03% 84 7283 0.04% 85 8175 0.05% 86 9093 0.05% 87 9531 0.05% 88 10246 0.06% 89 11026 0.06% 90 11632 0.07% 91 12811 0.07% 92 13865 0.08% 93 15058 0.09% 94 16232 0.09% 95 17744 0.10% 96 18019 0.10% 97 19071 0.11% 98 20062 0.11% 99 21033 0.12% 100 22423 0.13% 101 23752 0.14% 102 24982 0.14% 103 26584 0.15% 104 27995 0.16% 105 29742 0.17% 106 30535 0.17% 107 31552 0.18% 108 32488 0.19% 109 34128 0.20% 110 35354 0.20% 111 36961 0.21% 112 38570 0.22% 113 39869 0.23% 114 42024 0.24% 115 42927 0.25% 116 44552 0.26% 117 45939 0.26% 118 46725 0.27% 119 48000 0.28% 120 48991 0.28% 121 50710 0.29% 122 52769 0.30% 123 54529 0.31% 124 57222 0.33% 125 58497 0.34% 126 60307 0.35% 127 62064 0.36% 128 63614 0.36% 129 64911 0.37% 130 67219 0.39% 131 68591 0.39% 132 70976 0.41% 133 75344 0.43% 134 77258 0.44% 135 80547 0.46% 136 83498 0.48% 137 87854 0.50% 138 91510 0.52% 139 96980 0.56% 140 102347 0.59% 141 108935 0.62% 142 117283 0.67% 143 129354 0.74% 144 146703 0.84% 145 171782 0.98% 146 208532 1.19% 147 272894 1.56% 148 407569 2.34% 149 783077 4.49% 150 4054330 23.23% 151 8594068 49.25% 17451656 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=15 prefix-density=0.44 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=276.60 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=15 prefix-density=0.38 prefix-fanout=2.3 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=38.27 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.5 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7168886 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 22:42:07 Started mapping on | Feb 15 22:42:16 Finished on | Feb 15 23:17:32 Mapping speed, Million of reads per hour | 29.69 Number of input reads | 17451656 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16196493 Uniquely mapped reads % | 92.81% Average mapped length | 291.16 Number of splices: Total | 15190336 Number of splices: Annotated (sjdb) | 14827685 Number of splices: GT/AG | 14902756 Number of splices: GC/AG | 233806 Number of splices: AT/AC | 9915 Number of splices: Non-canonical | 43859 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 451996 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 127780 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 819724 819724 819724 N_multimapping 451996 451996 451996 N_noFeature 689535 15819377 909241 N_ambiguous 273150 1828 114307 UnstrandedReadsAssigned:15233808 PositiveStrandReadsAssigned:375288 NegativeStrandReadsAssigned:15172945 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168886 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168886-trimmed-pair1.fastq SRR7168886-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,451,656 reads, 15,238,129 reads pseudoaligned [quant] estimated average fragment length: 231.768 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7168886.ke.tsv 34699 SRR7168886.se.tsv 87100 total ==> SRR7168886.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.23 858 30.0509 Potri.005G024800.1.v4.1 1035 804.232 370 28.7986 Potri.004G059700.1.v4.1 961 730.269 10 0.857174 Potri.007G009000.2.v4.1 1416 1185.23 0 0 Potri.003G141000.2.v4.1 2943 2712.23 854.842 19.7292 Potri.016G087400.1.v4.1 270 88.69 1015 716.379 Potri.015G069301.1.v4.1 564 338.579 0 0 Potri.010G195200.1.v4.1 1773 1542.23 130 5.27649 Potri.012G127500.1.v4.1 977 746.258 145 12.1627 ==> SRR7168886.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1014 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 274 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR7168886 completed mapping pipeline successfully