Starting /dee2/code/volunteer_pipeline.sh SRR7168887 current disk space = 3090774319104 free memory = 1569459144 SRR7168887 SRAfilesize 2b1ef75126f43085665b5b2ccfc7b2a9 SRR7168887.sra SRR7168887.sra file validated SRR7168887 is paired end SRR7168887 is conventional basespace SRR7168887 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168887_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.24 34.0 33.0 34.0 32.0 34.0 2 33.11925 34.0 33.0 34.0 32.0 34.0 3 33.122 34.0 33.0 34.0 32.0 34.0 4 33.22075 34.0 33.0 34.0 32.0 34.0 5 33.27325 34.0 33.0 34.0 33.0 34.0 6 36.9795 38.0 37.0 38.0 36.0 38.0 7 37.2475 38.0 38.0 38.0 36.0 38.0 8 37.341 38.0 38.0 38.0 37.0 38.0 9 37.434 38.0 38.0 38.0 37.0 38.0 10-14 37.41895 38.0 38.0 38.0 37.0 38.0 15-19 37.40735 38.0 38.0 38.0 37.0 38.0 20-24 37.38645 38.0 38.0 38.0 37.0 38.0 25-29 37.3293 38.0 38.0 38.0 37.0 38.0 30-34 37.2938 38.0 38.0 38.0 37.0 38.0 35-39 37.27615 38.0 38.0 38.0 37.0 38.0 40-44 37.18655 38.0 38.0 38.0 36.8 38.0 45-49 37.18915 38.0 38.0 38.0 36.4 38.0 50-54 37.15865 38.0 38.0 38.0 36.6 38.0 55-59 37.1346 38.0 38.0 38.0 36.0 38.0 60-64 37.104600000000005 38.0 38.0 38.0 36.2 38.0 65-69 36.99679999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.946999999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.8706 38.0 38.0 38.0 35.4 38.0 80-84 36.78635 38.0 38.0 38.0 35.2 38.0 85-89 36.64565 38.0 38.0 38.0 34.8 38.0 90-94 36.589600000000004 38.0 38.0 38.0 34.4 38.0 95-99 36.486149999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.3644 38.0 38.0 38.0 34.0 38.0 105-109 36.1882 38.0 37.8 38.0 33.8 38.0 110-114 35.99 38.0 37.0 38.0 32.6 38.0 115-119 35.8004 38.0 37.0 38.0 31.8 38.0 120-124 35.501999999999995 38.0 36.4 38.0 30.6 38.0 125-129 35.20754999999999 38.0 36.0 38.0 29.0 38.0 130-134 34.99185 38.0 35.6 38.0 28.0 38.0 135-139 34.627849999999995 38.0 34.6 38.0 26.4 38.0 140-144 34.2341 38.0 34.0 38.0 25.4 38.0 145-149 33.34095 38.0 33.0 38.0 19.0 38.0 150-151 29.455125000000002 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 2.0 16 3.0 17 4.0 18 3.0 19 6.0 20 8.0 21 2.0 22 5.0 23 8.0 24 11.0 25 12.0 26 13.0 27 16.0 28 30.0 29 32.0 30 52.0 31 53.0 32 80.0 33 100.0 34 146.0 35 328.0 36 644.0 37 2435.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.69032258064516 13.135483870967743 12.180645161290322 34.99354838709677 2 23.5 18.65 31.65 26.200000000000003 3 21.325 23.400000000000002 23.674999999999997 31.6 4 23.025000000000002 31.624999999999996 22.325 23.025000000000002 5 21.75 34.75 23.425 20.075000000000003 6 18.375 37.0 24.525 20.1 7 14.35 24.875 42.275 18.5 8 19.05 22.825 30.175 27.950000000000003 9 16.400000000000002 24.6 33.300000000000004 25.7 10-14 20.200000000000003 29.485 26.555 23.76 15-19 19.88 28.499999999999996 27.889999999999997 23.73 20-24 19.925 28.575 27.6 23.9 25-29 19.86 28.595 27.785 23.76 30-34 20.015 28.345 27.944999999999997 23.695 35-39 19.575 28.655 27.985 23.785 40-44 20.365 28.189999999999998 27.725 23.72 45-49 20.544999999999998 28.515 27.169999999999998 23.77 50-54 20.395 28.785 27.49 23.330000000000002 55-59 20.4 28.53 27.284999999999997 23.785 60-64 20.549999999999997 28.665000000000003 27.365000000000002 23.419999999999998 65-69 20.235 28.425 27.815 23.525 70-74 19.625 28.27 27.68 24.425 75-79 20.935000000000002 28.275 27.62 23.169999999999998 80-84 20.555 28.08 27.755000000000003 23.61 85-89 20.915 27.96 27.694999999999997 23.43 90-94 20.695 28.87 26.77 23.665 95-99 20.4 28.09 28.03 23.48 100-104 20.605 28.74 27.26 23.395 105-109 20.990000000000002 28.17 27.185 23.655 110-114 20.89 28.560000000000002 27.515 23.035 115-119 21.060000000000002 28.275 27.175 23.49 120-124 20.615 28.165000000000003 27.450000000000003 23.77 125-129 21.45 28.46 26.805 23.285 130-134 20.985 28.64 26.669999999999998 23.705000000000002 135-139 21.34 28.410000000000004 26.165 24.085 140-144 20.9 28.595 25.965 24.54 145-149 21.060000000000002 28.73 26.215 23.995 150-151 21.175 29.037499999999998 25.6125 24.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.5 24 2.5 25 3.0 26 3.5 27 6.5 28 6.5 29 11.5 30 18.5 31 23.0 32 29.0 33 38.0 34 49.0 35 62.5 36 82.5 37 113.5 38 143.0 39 166.5 40 192.0 41 228.0 42 249.5 43 265.5 44 261.0 45 234.5 46 244.5 47 264.5 48 261.5 49 210.0 50 167.5 51 144.5 52 116.0 53 95.0 54 67.0 55 47.5 56 39.5 57 32.0 58 27.5 59 23.5 60 16.0 61 14.0 62 10.5 63 6.5 64 4.0 65 2.5 66 2.5 67 2.0 68 2.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.8625 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.025 0.0 112-113 3.1500000000000004 0.0 0.0 0.025 0.0 114-115 3.525 0.0 0.0 0.025 0.0 116-117 4.0375 0.0 0.0 0.025 0.0 118-119 4.475 0.0 0.0 0.025 0.0 120-121 5.0 0.0 0.0 0.025 0.0 122-123 5.4125 0.0 0.0 0.025 0.0 124-125 5.8125 0.0 0.0 0.025 0.0 126-127 6.3125 0.0 0.0 0.025 0.0 128-129 6.9625 0.0 0.0 0.025 0.0 130-131 7.3375 0.0 0.0 0.025 0.0 132-133 7.8125 0.0 0.0 0.025 0.0 134-135 8.5625 0.0 0.0 0.025 0.0 136-137 9.3125 0.0 0.0 0.025 0.0 138-139 10.1 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCA 60 0.0044944645 14.498751 140-144 ATCGGAA 65 0.0076419367 13.383461 135-139 >>END_MODULE SRR7168887 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168887_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.741 33.0 33.0 34.0 32.0 34.0 2 32.8425 33.0 33.0 34.0 32.0 34.0 3 32.8195 33.0 33.0 34.0 31.0 34.0 4 32.823 33.0 33.0 34.0 32.0 34.0 5 32.87175 33.0 33.0 34.0 32.0 34.0 6 37.0645 38.0 38.0 38.0 36.0 38.0 7 37.01975 38.0 38.0 38.0 37.0 38.0 8 37.091 38.0 38.0 38.0 37.0 38.0 9 37.11075 38.0 38.0 38.0 37.0 38.0 10-14 37.07835 38.0 38.0 38.0 37.0 38.0 15-19 37.067 38.0 38.0 38.0 37.0 38.0 20-24 37.032399999999996 38.0 38.0 38.0 36.8 38.0 25-29 37.0559 38.0 38.0 38.0 37.0 38.0 30-34 37.01835 38.0 38.0 38.0 36.6 38.0 35-39 36.9832 38.0 38.0 38.0 36.8 38.0 40-44 36.9628 38.0 38.0 38.0 36.4 38.0 45-49 36.889599999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.864 38.0 38.0 38.0 36.0 38.0 55-59 36.81915 38.0 38.0 38.0 36.0 38.0 60-64 36.8 38.0 38.0 38.0 36.0 38.0 65-69 36.759049999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.6728 38.0 38.0 38.0 35.6 38.0 75-79 36.5389 38.0 38.0 38.0 35.0 38.0 80-84 36.423100000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.32205 38.0 38.0 38.0 34.0 38.0 90-94 36.2828 38.0 38.0 38.0 34.0 38.0 95-99 36.17615 38.0 38.0 38.0 33.8 38.0 100-104 36.16590000000001 38.0 38.0 38.0 33.8 38.0 105-109 35.974900000000005 38.0 38.0 38.0 33.2 38.0 110-114 35.87585 38.0 37.6 38.0 33.0 38.0 115-119 35.5403 38.0 37.0 38.0 31.0 38.0 120-124 35.3781 38.0 36.8 38.0 30.6 38.0 125-129 35.1723 38.0 36.0 38.0 29.6 38.0 130-134 34.60680000000001 38.0 35.8 38.0 26.6 38.0 135-139 34.1888 38.0 34.8 38.0 24.0 38.0 140-144 33.599599999999995 38.0 33.4 38.0 21.4 38.0 145-149 32.5921 38.0 33.0 38.0 11.0 38.0 150-151 27.265625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 2.0 5 0.0 6 4.0 7 3.0 8 1.0 9 2.0 10 1.0 11 3.0 12 2.0 13 2.0 14 3.0 15 5.0 16 3.0 17 9.0 18 6.0 19 6.0 20 12.0 21 14.0 22 11.0 23 9.0 24 9.0 25 16.0 26 16.0 27 28.0 28 31.0 29 30.0 30 50.0 31 47.0 32 80.0 33 96.0 34 152.0 35 277.0 36 585.0 37 2475.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.324999999999996 19.0 15.825 26.85 2 27.474999999999998 26.55 30.25 15.725 3 20.599999999999998 30.075000000000003 29.475 19.85 4 24.9 35.199999999999996 21.45 18.45 5 24.5 36.25 22.400000000000002 16.85 6 20.8 37.375 22.85 18.975 7 18.975 20.0 39.75 21.275 8 20.625 25.575 27.325 26.474999999999998 9 22.05 24.725 28.875 24.349999999999998 10-14 23.335 27.83 26.650000000000002 22.185 15-19 22.720000000000002 27.839999999999996 27.77 21.67 20-24 23.435 27.625 27.900000000000002 21.04 25-29 23.205000000000002 27.894999999999996 27.82 21.08 30-34 23.215 27.125 28.15 21.51 35-39 23.23 27.375 27.83 21.565 40-44 23.595 27.395000000000003 27.750000000000004 21.26 45-49 22.605 27.744999999999997 28.235 21.415 50-54 23.385 27.54 27.815 21.26 55-59 23.119999999999997 27.215 28.189999999999998 21.475 60-64 23.805 27.315 27.48 21.4 65-69 23.07 27.485 28.110000000000003 21.335 70-74 23.435 27.365000000000002 27.62 21.58 75-79 22.91 27.54 28.144999999999996 21.404999999999998 80-84 23.405 27.529999999999998 27.925 21.14 85-89 23.485 27.595 28.03 20.89 90-94 23.035 27.750000000000004 27.894999999999996 21.32 95-99 23.255 27.639999999999997 28.04 21.065 100-104 23.98 27.73 27.315 20.974999999999998 105-109 23.330000000000002 28.050000000000004 28.065 20.555 110-114 23.915 27.685 27.474999999999998 20.925 115-119 24.46 28.515 27.02 20.005 120-124 24.545 27.825 27.275 20.355 125-129 24.46 27.62 27.200000000000003 20.72 130-134 25.05375806370956 27.434115117267588 27.03905585837876 20.473070960644097 135-139 25.335 27.555000000000003 27.474999999999998 19.634999999999998 140-144 25.314999999999998 27.955000000000002 27.025 19.705000000000002 145-149 25.790000000000003 28.18 26.5 19.53 150-151 26.8375 28.037499999999998 26.5375 18.587500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 3.0 27 3.5 28 4.0 29 7.5 30 9.5 31 15.0 32 25.0 33 31.0 34 37.5 35 52.0 36 73.5 37 105.0 38 132.5 39 149.5 40 175.0 41 212.5 42 261.5 43 279.5 44 285.5 45 279.0 46 263.5 47 255.5 48 229.0 49 214.5 50 203.0 51 160.0 52 118.0 53 102.0 54 75.0 55 54.5 56 46.5 57 33.0 58 26.5 59 21.0 60 13.5 61 10.5 62 9.0 63 6.0 64 2.5 65 1.5 66 1.0 67 2.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.3 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108-109 2.7125 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.6 0.0 0.0 0.0 0.0 116-117 4.15 0.0 0.0 0.0 0.0 118-119 4.575 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.5625 0.0 0.0 0.0 0.0 124-125 5.9875 0.0 0.0 0.0 0.0 126-127 6.5125 0.0 0.0 0.0 0.0 128-129 7.1375 0.0 0.0 0.0 0.0 130-131 7.5625 0.0 0.0 0.0 0.0 132-133 8.075 0.0 0.0 0.0 0.0 134-135 8.8625 0.0 0.0 0.0 0.0 136-137 9.575 0.0 0.0 0.0 0.0 138-139 10.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAGAT 10 0.006830828 145.0 5 AAGAGCG 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990317 spots for SRR7168887.sra Written 990317 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra Read 990301 spots for SRR7168887.sra Written 990301 spots for SRR7168887.sra SRR ids: ['SRR7168887.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8w6phzs6 SRR7168887.sra spots: 19806036 blocks: [[1, 990301], [990302, 1980602], [1980603, 2970903], [2970904, 3961204], [3961205, 4951505], [4951506, 5941806], [5941807, 6932107], [6932108, 7922408], [7922409, 8912709], [8912710, 9903010], [9903011, 10893311], [10893312, 11883612], [11883613, 12873913], [12873914, 13864214], [13864215, 14854515], [14854516, 15844816], [15844817, 16835117], [16835118, 17825418], [17825419, 18815719], [18815720, 19806036]] SRR7168887 file size 6689915 SRR7168887 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168887 SRR7168887_1.fastq SRR7168887_2.fastq Input file: SRR7168887_1.fastq Paired file: SRR7168887_2.fastq trimmed: SRR7168887-trimmed-pair1.fastq, SRR7168887-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Feb 16 00:23:33 2025 >> started Sun Feb 16 00:32:38 2025 >> done (544.550s) 19806036 read pairs processed; of these: 25387 ( 0.13%) short read pairs filtered out after trimming by size control 30929 ( 0.16%) empty read pairs filtered out after trimming by size control 19749720 (99.72%) read pairs available; of these: 11435565 (57.90%) trimmed read pairs available after processing 8314155 (42.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 5 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 10 0.00% 26 12 0.00% 27 7 0.00% 28 12 0.00% 29 8 0.00% 30 12 0.00% 31 18 0.00% 32 21 0.00% 33 17 0.00% 34 17 0.00% 35 37 0.00% 36 27 0.00% 37 23 0.00% 38 21 0.00% 39 47 0.00% 40 54 0.00% 41 47 0.00% 42 50 0.00% 43 65 0.00% 44 60 0.00% 45 90 0.00% 46 91 0.00% 47 97 0.00% 48 107 0.00% 49 127 0.00% 50 168 0.00% 51 143 0.00% 52 196 0.00% 53 225 0.00% 54 194 0.00% 55 244 0.00% 56 307 0.00% 57 312 0.00% 58 339 0.00% 59 403 0.00% 60 436 0.00% 61 605 0.00% 62 661 0.00% 63 708 0.00% 64 822 0.00% 65 808 0.00% 66 1007 0.01% 67 1113 0.01% 68 1273 0.01% 69 2129 0.01% 70 2034 0.01% 71 1869 0.01% 72 2106 0.01% 73 2467 0.01% 74 2755 0.01% 75 2926 0.01% 76 3508 0.02% 77 3709 0.02% 78 4184 0.02% 79 4658 0.02% 80 5128 0.03% 81 5861 0.03% 82 6624 0.03% 83 7616 0.04% 84 9167 0.05% 85 10243 0.05% 86 11288 0.06% 87 12090 0.06% 88 12998 0.07% 89 13845 0.07% 90 14537 0.07% 91 16209 0.08% 92 17329 0.09% 93 19053 0.10% 94 20608 0.10% 95 21955 0.11% 96 22747 0.12% 97 24114 0.12% 98 25231 0.13% 99 26153 0.13% 100 27882 0.14% 101 29400 0.15% 102 31287 0.16% 103 32856 0.17% 104 35075 0.18% 105 37263 0.19% 106 38441 0.19% 107 39464 0.20% 108 40838 0.21% 109 42527 0.22% 110 43452 0.22% 111 44889 0.23% 112 47324 0.24% 113 49661 0.25% 114 51338 0.26% 115 53956 0.27% 116 55805 0.28% 117 57606 0.29% 118 58508 0.30% 119 59454 0.30% 120 61453 0.31% 121 63988 0.32% 122 65714 0.33% 123 68515 0.35% 124 71447 0.36% 125 74078 0.38% 126 77192 0.39% 127 79316 0.40% 128 82098 0.42% 129 84710 0.43% 130 86439 0.44% 131 89083 0.45% 132 92481 0.47% 133 97638 0.49% 134 102105 0.52% 135 107949 0.55% 136 113723 0.58% 137 119364 0.60% 138 126704 0.64% 139 134924 0.68% 140 141967 0.72% 141 154628 0.78% 142 168398 0.85% 143 187207 0.95% 144 214170 1.08% 145 252198 1.28% 146 310496 1.57% 147 411354 2.08% 148 598061 3.03% 149 1136593 5.75% 150 4838332 24.50% 151 8314155 42.10% 19749720 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=17 prefix-density=0.53 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=333.07 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.53 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=46.15 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR7168887 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 16 01:07:37 Started mapping on | Feb 16 01:07:55 Finished on | Feb 16 02:26:07 Mapping speed, Million of reads per hour | 15.15 Number of input reads | 19749720 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 18344016 Uniquely mapped reads % | 92.88% Average mapped length | 289.99 Number of splices: Total | 17240737 Number of splices: Annotated (sjdb) | 16864231 Number of splices: GT/AG | 16909999 Number of splices: GC/AG | 276543 Number of splices: AT/AC | 9199 Number of splices: Non-canonical | 44996 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 507689 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 211233 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.27% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 920332 920332 920332 N_multimapping 507689 507689 507689 N_noFeature 681358 17989927 876339 N_ambiguous 278997 1600 118733 UnstrandedReadsAssigned:17383661 PositiveStrandReadsAssigned:352489 NegativeStrandReadsAssigned:17348944 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168887 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168887-trimmed-pair1.fastq SRR7168887-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,749,720 reads, 17,544,590 reads pseudoaligned [quant] estimated average fragment length: 224.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52401 SRR7168887.ke.tsv 34699 SRR7168887.se.tsv 87100 total ==> SRR7168887.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.87 746 23.8892 Potri.005G024800.1.v4.1 1035 811.874 193 13.6636 Potri.004G059700.1.v4.1 961 737.89 23 1.79157 Potri.007G009000.2.v4.1 1416 1192.87 0 0 Potri.003G141000.2.v4.1 2943 2719.87 1056.24 22.3209 Potri.016G087400.1.v4.1 270 89.7458 928 594.334 Potri.015G069301.1.v4.1 564 344.929 0 0 Potri.010G195200.1.v4.1 1773 1549.87 51 1.89134 Potri.012G127500.1.v4.1 977 753.885 104 7.92912 ==> SRR7168887.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1253 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7168887 completed mapping pipeline successfully