Starting /dee2/code/volunteer_pipeline.sh SRR7168888 current disk space = 3090850574336 free memory = 1534975716 SRR7168888 SRAfilesize 7bfa419b48066d4c4a28a3f185971d47 SRR7168888.sra SRR7168888.sra file validated SRR7168888 is paired end SRR7168888 is conventional basespace SRR7168888 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168888_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22825 34.0 33.0 34.0 32.0 34.0 2 33.124 34.0 33.0 34.0 32.0 34.0 3 33.21325 34.0 33.0 34.0 32.0 34.0 4 33.2835 34.0 33.0 34.0 32.0 34.0 5 33.3565 34.0 33.0 34.0 33.0 34.0 6 37.00775 38.0 37.0 38.0 36.0 38.0 7 37.1815 38.0 38.0 38.0 36.0 38.0 8 37.2975 38.0 38.0 38.0 37.0 38.0 9 37.35225 38.0 38.0 38.0 37.0 38.0 10-14 37.393600000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.38699999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.3872 38.0 38.0 38.0 37.0 38.0 25-29 37.3091 38.0 38.0 38.0 37.0 38.0 30-34 37.33669999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.305099999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.254549999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.23535 38.0 38.0 38.0 36.8 38.0 50-54 37.19515 38.0 38.0 38.0 36.8 38.0 55-59 37.08395 38.0 38.0 38.0 36.0 38.0 60-64 37.13099999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.087300000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.997249999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.981049999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.90245 38.0 38.0 38.0 36.0 38.0 85-89 36.760549999999995 38.0 38.0 38.0 34.8 38.0 90-94 36.65865 38.0 38.0 38.0 34.6 38.0 95-99 36.5176 38.0 38.0 38.0 34.0 38.0 100-104 36.49865 38.0 38.0 38.0 34.0 38.0 105-109 36.18495 38.0 37.2 38.0 33.4 38.0 110-114 36.10475 38.0 37.4 38.0 33.4 38.0 115-119 35.88824999999999 38.0 37.0 38.0 32.2 38.0 120-124 35.655449999999995 38.0 36.4 38.0 31.0 38.0 125-129 35.3753 38.0 36.2 38.0 30.2 38.0 130-134 35.0101 38.0 35.8 38.0 28.4 38.0 135-139 34.60355 38.0 34.6 38.0 27.0 38.0 140-144 33.88145000000001 38.0 33.0 38.0 22.8 38.0 145-149 32.953199999999995 38.0 33.0 38.0 17.0 38.0 150-151 27.58325 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 3.0 20 4.0 21 7.0 22 6.0 23 9.0 24 5.0 25 13.0 26 19.0 27 27.0 28 30.0 29 37.0 30 54.0 31 60.0 32 68.0 33 133.0 34 167.0 35 263.0 36 691.0 37 2397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.935316946959894 12.39327296248383 9.857697283311772 47.8137128072445 2 19.275000000000002 18.525 39.175 23.025000000000002 3 18.95 21.6 26.424999999999997 33.025 4 22.35 31.624999999999996 22.0 24.025 5 22.525000000000002 34.225 25.074999999999996 18.175 6 18.475 35.125 26.5 19.900000000000002 7 15.1 23.549999999999997 42.95 18.4 8 16.875 25.75 31.55 25.825 9 16.1 23.1 35.925000000000004 24.875 10-14 20.035 30.15 26.314999999999998 23.5 15-19 19.415 28.415000000000003 28.12 24.05 20-24 19.525000000000002 28.115000000000002 28.439999999999998 23.919999999999998 25-29 19.564999999999998 28.98 28.294999999999998 23.16 30-34 20.235 28.54 27.48 23.745 35-39 20.015 28.305000000000003 28.035 23.645 40-44 20.175 28.945 26.985 23.895 45-49 20.075000000000003 28.68 27.189999999999998 24.055 50-54 19.82 28.765 27.55 23.865 55-59 20.135 28.95 27.560000000000002 23.355 60-64 20.305 28.175 27.860000000000003 23.66 65-69 20.3 28.565 27.57 23.565 70-74 19.755 28.82 27.115000000000002 24.310000000000002 75-79 19.439999999999998 28.505000000000003 28.23 23.825 80-84 20.775 28.375 27.384999999999998 23.465 85-89 20.57 28.389999999999997 27.644999999999996 23.395 90-94 20.305 28.585 27.639999999999997 23.47 95-99 20.375 28.7 27.875 23.05 100-104 20.28 28.444999999999997 27.51 23.765 105-109 20.885 28.71 26.935 23.47 110-114 20.919999999999998 28.82 27.04 23.22 115-119 21.11 28.665000000000003 26.99 23.235 120-124 20.7 28.494999999999997 27.034999999999997 23.77 125-129 21.055 28.74 26.974999999999998 23.23 130-134 21.555 28.53 26.355 23.56 135-139 20.995 28.560000000000002 26.505000000000003 23.94 140-144 21.105 28.62 26.905 23.369999999999997 145-149 21.23 27.965 26.545 24.26 150-151 20.5125 28.812500000000004 26.5125 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 2.5 25 2.5 26 3.5 27 6.5 28 9.0 29 12.5 30 18.0 31 27.0 32 40.5 33 46.5 34 58.0 35 78.5 36 90.0 37 104.5 38 130.5 39 167.5 40 214.5 41 247.0 42 244.0 43 250.0 44 271.0 45 272.0 46 255.5 47 244.0 48 229.0 49 196.0 50 158.5 51 134.5 52 113.5 53 89.0 54 72.5 55 52.5 56 39.0 57 31.5 58 24.5 59 16.5 60 12.0 61 10.0 62 8.5 63 6.5 64 3.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.675 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.85 0.0 0.0 0.0 0.0 110-111 3.25 0.0 0.0 0.0 0.0 112-113 3.7 0.0 0.0 0.0 0.0 114-115 4.1 0.0 0.0 0.0 0.0 116-117 4.425000000000001 0.0 0.0 0.0 0.0 118-119 4.7625 0.0 0.0 0.0 0.0 120-121 5.362500000000001 0.0 0.0 0.0 0.0 122-123 5.8375 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.800000000000001 0.0 0.0 0.0 0.0 128-129 7.3375 0.0 0.0 0.0 0.0 130-131 7.8 0.0 0.0 0.0 0.0 132-133 8.2875 0.0 0.0 0.0 0.0 134-135 8.9 0.0 0.0 0.0 0.0 136-137 9.625 0.0 0.0 0.0 0.0 138-139 10.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTG 10 0.006830828 145.0 5 ACTGCCA 10 0.006830828 145.0 8 CACTGCC 10 0.006830828 145.0 7 TGGATTC 20 3.5877043E-4 108.75 3 >>END_MODULE SRR7168888 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168888_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6605 33.0 33.0 34.0 32.0 34.0 2 32.846 33.0 33.0 34.0 32.0 34.0 3 32.814 33.0 33.0 34.0 32.0 34.0 4 32.818 33.0 33.0 34.0 32.0 34.0 5 32.7875 33.0 33.0 34.0 32.0 34.0 6 36.99 38.0 38.0 38.0 36.0 38.0 7 36.977 38.0 38.0 38.0 36.0 38.0 8 36.9945 38.0 38.0 38.0 36.0 38.0 9 37.0065 38.0 38.0 38.0 37.0 38.0 10-14 36.96615 38.0 38.0 38.0 36.0 38.0 15-19 36.9904 38.0 38.0 38.0 36.0 38.0 20-24 36.95465 38.0 38.0 38.0 36.0 38.0 25-29 36.94375 38.0 38.0 38.0 36.0 38.0 30-34 36.97725 38.0 38.0 38.0 36.0 38.0 35-39 36.936350000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.942699999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.88765 38.0 38.0 38.0 36.0 38.0 50-54 36.85665000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.7528 38.0 38.0 38.0 35.8 38.0 60-64 36.71815 38.0 38.0 38.0 35.2 38.0 65-69 36.7285 38.0 38.0 38.0 35.2 38.0 70-74 36.630700000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.60785 38.0 38.0 38.0 35.0 38.0 80-84 36.4566 38.0 38.0 38.0 34.2 38.0 85-89 36.207100000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.1663 38.0 38.0 38.0 34.0 38.0 95-99 36.1359 38.0 38.0 38.0 33.6 38.0 100-104 36.00935 38.0 38.0 38.0 33.2 38.0 105-109 35.9357 38.0 37.8 38.0 32.8 38.0 110-114 35.6045 38.0 37.0 38.0 30.8 38.0 115-119 35.4619 38.0 37.0 38.0 30.6 38.0 120-124 35.20285 38.0 36.2 38.0 29.0 38.0 125-129 35.07715 38.0 36.0 38.0 28.8 38.0 130-134 34.27635 38.0 34.6 38.0 24.6 38.0 135-139 33.6721 38.0 33.2 38.0 21.6 38.0 140-144 32.9197 38.0 33.0 38.0 13.8 38.0 145-149 31.4632 38.0 32.2 38.0 6.2 38.0 150-151 26.309125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 0.0 5 1.0 6 0.0 7 1.0 8 3.0 9 2.0 10 1.0 11 3.0 12 2.0 13 3.0 14 2.0 15 4.0 16 3.0 17 5.0 18 7.0 19 7.0 20 14.0 21 13.0 22 15.0 23 21.0 24 10.0 25 24.0 26 29.0 27 32.0 28 31.0 29 53.0 30 43.0 31 61.0 32 75.0 33 111.0 34 162.0 35 297.0 36 644.0 37 2314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.95 19.275000000000002 14.524999999999999 35.25 2 25.650000000000002 26.674999999999997 32.074999999999996 15.6 3 20.225 29.2 30.15 20.424999999999997 4 21.275 37.425000000000004 23.125 18.175 5 22.825 37.675 22.475 17.025000000000002 6 20.155038759689923 37.28432108027007 24.031007751937985 18.529632408102024 7 18.975 19.15 40.675 21.2 8 20.8 24.3 29.95 24.95 9 21.6 23.65 30.85 23.9 10-14 22.400000000000002 28.84 26.555 22.205 15-19 22.825 28.050000000000004 28.18 20.945 20-24 22.45724572457246 28.532853285328535 27.87778777877788 21.132113211321133 25-29 22.36223622362236 27.96779677967797 28.367836783678367 21.302130213021304 30-34 22.30111505575279 27.641382069103454 28.761438071903594 21.29606480324016 35-39 22.724544908981798 28.405681136227244 27.980596119223843 20.889177835567114 40-44 22.80842126318948 27.669150372555883 28.43926588988348 21.083162474371157 45-49 22.626131306565327 28.081404070203508 28.59142957147857 20.701035051752587 50-54 22.86 27.925 28.17 21.044999999999998 55-59 23.128469270390557 27.474121118167727 28.519277891683753 20.878131719757963 60-64 23.03 27.205000000000002 28.025 21.740000000000002 65-69 23.139627925585117 27.680536107221442 27.745549109821965 21.43428685737147 70-74 23.036911073321996 28.023407022106632 27.063118935680702 21.876562968890667 75-79 23.15694708412524 27.978393518055416 28.038411523457036 20.82624787436231 80-84 23.319663932786558 27.850570114022805 27.40548109621924 21.424284856971397 85-89 22.936468234117058 27.968984492246125 28.109054527263634 20.985492746373186 90-94 23.160422189985493 28.087639437746986 27.817517883047373 20.934420489220148 95-99 23.195437947076183 28.062628182682207 27.97758991546196 20.76434395477965 100-104 23.84953981592637 27.67607042817127 27.656062424969992 20.818327330932373 105-109 24.155870141563703 27.26727027162223 28.002601170526738 20.574258416287332 110-114 23.99839943980393 27.709698394438053 27.874756164657633 20.417146001100388 115-119 24.228479967988797 28.29990496673836 27.184514580103038 20.28710048516981 120-124 24.384753901560625 27.941176470588236 27.485994397759107 20.188075230092036 125-129 24.923723303156102 26.914420047016456 28.3149102185765 19.846946431250938 130-134 24.781151518183183 27.56740533239958 27.547396328347755 20.10404682106948 135-139 24.70735367683842 28.499249624812407 27.308654327163584 19.484742371185593 140-144 24.874949979991996 28.156262505002 27.425970388155264 19.54281712685074 145-149 24.634853941576633 28.13625450180072 27.646058423369347 19.582833133253303 150-151 25.347005126922596 27.31024134050269 27.5728398149306 19.769913717644116 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 0.5 24 2.0 25 3.5 26 2.5 27 5.5 28 8.5 29 12.0 30 18.5 31 23.5 32 26.0 33 34.5 34 51.5 35 68.0 36 80.5 37 105.5 38 141.0 39 175.0 40 208.0 41 235.0 42 261.5 43 277.5 44 285.0 45 264.0 46 238.0 47 233.5 48 225.5 49 198.0 50 164.5 51 145.5 52 118.5 53 90.0 54 71.5 55 61.0 56 49.0 57 33.5 58 22.0 59 19.0 60 14.5 61 7.5 62 5.5 63 2.5 64 0.5 65 0.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.01 30-34 0.005 35-39 0.02 40-44 0.015 45-49 0.005 50-54 0.0 55-59 0.015 60-64 0.0 65-69 0.02 70-74 0.03 75-79 0.03 80-84 0.02 85-89 0.05 90-94 0.045 95-99 0.045 100-104 0.04 105-109 0.045 110-114 0.034999999999999996 115-119 0.034999999999999996 120-124 0.04 125-129 0.034999999999999996 130-134 0.045 135-139 0.05 140-144 0.04 145-149 0.04 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44584382871537 98.7 2 0.4534005037783375 0.8999999999999999 3 0.05037783375314861 0.15 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.025188916876574305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.675 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.8375000000000004 0.0 0.0 0.0 0.0 110-111 3.2249999999999996 0.0 0.0 0.0 0.0 112-113 3.675 0.0 0.0 0.0 0.0 114-115 4.075 0.0 0.0 0.0 0.0 116-117 4.425000000000001 0.0 0.0 0.0 0.0 118-119 4.7625 0.0 0.0 0.0 0.0 120-121 5.362500000000001 0.0 0.0 0.0 0.0 122-123 5.8375 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.775 0.0 0.0 0.0 0.0 128-129 7.3125 0.0 0.0 0.0 0.0 130-131 7.775 0.0 0.0 0.0 0.0 132-133 8.25 0.0 0.0 0.0 0.0 134-135 8.875 0.0 0.0 0.0 0.0 136-137 9.587499999999999 0.0 0.0 0.0 0.0 138-139 10.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695435 spots for SRR7168888.sra Written 695435 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra Read 695426 spots for SRR7168888.sra Written 695426 spots for SRR7168888.sra SRR ids: ['SRR7168888.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0lu9p4tj SRR7168888.sra spots: 13908529 blocks: [[1, 695426], [695427, 1390852], [1390853, 2086278], [2086279, 2781704], [2781705, 3477130], [3477131, 4172556], [4172557, 4867982], [4867983, 5563408], [5563409, 6258834], [6258835, 6954260], [6954261, 7649686], [7649687, 8345112], [8345113, 9040538], [9040539, 9735964], [9735965, 10431390], [10431391, 11126816], [11126817, 11822242], [11822243, 12517668], [12517669, 13213094], [13213095, 13908529]] SRR7168888 file size 4691443 SRR7168888 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168888 SRR7168888_1.fastq SRR7168888_2.fastq Input file: SRR7168888_1.fastq Paired file: SRR7168888_2.fastq trimmed: SRR7168888-trimmed-pair1.fastq, SRR7168888-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 23:36:19 2025 >> started Sat Feb 15 23:43:32 2025 >> done (432.647s) 13908529 read pairs processed; of these: 17156 ( 0.12%) short read pairs filtered out after trimming by size control 13389 ( 0.10%) empty read pairs filtered out after trimming by size control 13877984 (99.78%) read pairs available; of these: 7882042 (56.80%) trimmed read pairs available after processing 5995942 (43.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 16 0.00% 20 14 0.00% 21 17 0.00% 22 24 0.00% 23 21 0.00% 24 27 0.00% 25 17 0.00% 26 27 0.00% 27 38 0.00% 28 22 0.00% 29 26 0.00% 30 30 0.00% 31 32 0.00% 32 33 0.00% 33 29 0.00% 34 31 0.00% 35 42 0.00% 36 35 0.00% 37 56 0.00% 38 47 0.00% 39 53 0.00% 40 53 0.00% 41 74 0.00% 42 74 0.00% 43 82 0.00% 44 66 0.00% 45 103 0.00% 46 97 0.00% 47 122 0.00% 48 121 0.00% 49 147 0.00% 50 184 0.00% 51 215 0.00% 52 238 0.00% 53 244 0.00% 54 258 0.00% 55 283 0.00% 56 294 0.00% 57 390 0.00% 58 430 0.00% 59 486 0.00% 60 550 0.00% 61 610 0.00% 62 733 0.01% 63 852 0.01% 64 908 0.01% 65 1028 0.01% 66 1024 0.01% 67 1092 0.01% 68 1366 0.01% 69 1498 0.01% 70 1727 0.01% 71 1929 0.01% 72 2186 0.02% 73 2479 0.02% 74 2769 0.02% 75 3055 0.02% 76 3212 0.02% 77 3524 0.03% 78 3901 0.03% 79 4369 0.03% 80 4684 0.03% 81 5373 0.04% 82 6195 0.04% 83 7090 0.05% 84 7963 0.06% 85 8574 0.06% 86 8995 0.06% 87 9387 0.07% 88 10372 0.07% 89 10600 0.08% 90 11192 0.08% 91 12095 0.09% 92 13168 0.09% 93 14683 0.11% 94 15723 0.11% 95 16829 0.12% 96 17335 0.12% 97 18048 0.13% 98 18472 0.13% 99 19094 0.14% 100 20080 0.14% 101 20192 0.15% 102 22152 0.16% 103 23156 0.17% 104 24600 0.18% 105 26014 0.19% 106 26819 0.19% 107 27573 0.20% 108 28062 0.20% 109 28509 0.21% 110 29078 0.21% 111 29806 0.21% 112 30976 0.22% 113 32879 0.24% 114 34312 0.25% 115 36158 0.26% 116 37145 0.27% 117 37543 0.27% 118 38546 0.28% 119 38510 0.28% 120 39245 0.28% 121 40903 0.29% 122 42123 0.30% 123 43751 0.32% 124 45769 0.33% 125 47469 0.34% 126 49830 0.36% 127 50694 0.37% 128 52316 0.38% 129 53383 0.38% 130 54844 0.40% 131 57300 0.41% 132 58585 0.42% 133 61560 0.44% 134 64467 0.46% 135 67952 0.49% 136 72380 0.52% 137 76702 0.55% 138 81795 0.59% 139 87187 0.63% 140 92941 0.67% 141 100302 0.72% 142 110256 0.79% 143 123166 0.89% 144 143691 1.04% 145 170518 1.23% 146 214506 1.55% 147 283775 2.04% 148 423402 3.05% 149 807751 5.82% 150 3392071 24.44% 151 5995942 43.20% 13877984 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=232.87 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=18 prefix-density=0.82 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=30.40 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7168888 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 16 00:52:07 Started mapping on | Feb 16 00:52:26 Finished on | Feb 16 02:26:07 Mapping speed, Million of reads per hour | 8.89 Number of input reads | 13877984 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12826321 Uniquely mapped reads % | 92.42% Average mapped length | 289.78 Number of splices: Total | 12414819 Number of splices: Annotated (sjdb) | 12137381 Number of splices: GT/AG | 12173273 Number of splices: GC/AG | 199938 Number of splices: AT/AC | 6537 Number of splices: Non-canonical | 35071 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383826 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 56328 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.31% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 678854 678854 678854 N_multimapping 383826 383826 383826 N_noFeature 488544 12550332 641281 N_ambiguous 211325 1103 87344 UnstrandedReadsAssigned:12126452 PositiveStrandReadsAssigned:274886 NegativeStrandReadsAssigned:12097696 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168888 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168888-trimmed-pair1.fastq SRR7168888-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,877,984 reads, 12,116,862 reads pseudoaligned [quant] estimated average fragment length: 238.591 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7168888.ke.tsv 34699 SRR7168888.se.tsv 87100 total ==> SRR7168888.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.41 420 18.6847 Potri.005G024800.1.v4.1 1035 797.409 188 18.6738 Potri.004G059700.1.v4.1 961 723.434 10 1.09486 Potri.007G009000.2.v4.1 1416 1178.41 0 0 Potri.003G141000.2.v4.1 2943 2705.41 989 28.9548 Potri.016G087400.1.v4.1 270 90.5521 715 625.41 Potri.015G069301.1.v4.1 564 329.803 0 0 Potri.010G195200.1.v4.1 1773 1535.41 36 1.8571 Potri.012G127500.1.v4.1 977 739.421 162 17.3532 ==> SRR7168888.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1020 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 2 SRR7168888 completed mapping pipeline successfully