Starting /dee2/code/volunteer_pipeline.sh SRR7168889 current disk space = 3090373820416 free memory = 1478944760 SRR7168889 SRAfilesize 4e1ebbba2b95c832e314ec3e9398bb76 SRR7168889.sra SRR7168889.sra file validated SRR7168889 is paired end SRR7168889 is conventional basespace SRR7168889 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.96375 34.0 33.0 34.0 32.0 34.0 2 33.02975 34.0 33.0 34.0 32.0 34.0 3 33.16625 34.0 33.0 34.0 32.0 34.0 4 33.26225 34.0 33.0 34.0 33.0 34.0 5 33.328 34.0 33.0 34.0 33.0 34.0 6 37.0405 38.0 38.0 38.0 36.0 38.0 7 37.19775 38.0 38.0 38.0 36.0 38.0 8 37.33575 38.0 38.0 38.0 37.0 38.0 9 37.4345 38.0 38.0 38.0 37.0 38.0 10-14 37.44644999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.437200000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.410900000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.33325 38.0 38.0 38.0 37.0 38.0 30-34 37.353899999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.32155 38.0 38.0 38.0 37.0 38.0 40-44 37.214150000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.1872 38.0 38.0 38.0 36.4 38.0 50-54 37.160650000000004 38.0 38.0 38.0 36.2 38.0 55-59 37.097899999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.08985 38.0 38.0 38.0 36.0 38.0 65-69 37.0702 38.0 38.0 38.0 36.0 38.0 70-74 36.9518 38.0 38.0 38.0 36.0 38.0 75-79 36.90454999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.8319 38.0 38.0 38.0 35.6 38.0 85-89 36.697649999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.62485 38.0 38.0 38.0 34.6 38.0 95-99 36.482000000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.36365 38.0 38.0 38.0 34.0 38.0 105-109 36.2082 38.0 37.8 38.0 34.0 38.0 110-114 35.995050000000006 38.0 37.2 38.0 33.2 38.0 115-119 35.725249999999996 38.0 36.8 38.0 31.8 38.0 120-124 35.54415 38.0 36.4 38.0 31.0 38.0 125-129 35.365449999999996 38.0 36.0 38.0 30.6 38.0 130-134 34.778400000000005 38.0 35.8 38.0 27.8 38.0 135-139 34.47055 38.0 34.4 38.0 26.6 38.0 140-144 33.7695 38.0 33.2 38.0 22.4 38.0 145-149 32.7237 38.0 33.0 38.0 13.6 38.0 150-151 27.507875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 1.0 18 4.0 19 7.0 20 5.0 21 7.0 22 4.0 23 9.0 24 13.0 25 19.0 26 17.0 27 22.0 28 30.0 29 40.0 30 51.0 31 67.0 32 80.0 33 120.0 34 132.0 35 285.0 36 641.0 37 2439.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.06267955079655 12.71872551580047 10.23765996343693 36.98093496996605 2 22.625 18.375 32.074999999999996 26.924999999999997 3 19.900000000000002 22.875 27.150000000000002 30.075000000000003 4 22.95 31.2 22.925 22.925 5 21.7 34.55 24.5 19.25 6 19.400000000000002 35.05 25.25 20.3 7 14.174999999999999 24.875 42.6 18.35 8 19.35 25.025 29.825000000000003 25.8 9 17.675 23.95 33.35 25.025 10-14 19.855 29.080000000000002 26.855 24.21 15-19 19.595000000000002 28.735 27.634999999999998 24.035 20-24 20.5 28.22 27.894999999999996 23.385 25-29 20.5 28.095 27.96 23.445 30-34 20.145 28.499999999999996 27.715 23.64 35-39 20.27 28.345 27.615000000000002 23.77 40-44 20.765 27.92 27.605 23.71 45-49 20.29 28.21 27.435 24.065 50-54 19.91 28.535 27.500000000000004 24.055 55-59 20.74 27.99 27.284999999999997 23.985 60-64 20.27 29.065 26.68 23.985 65-69 20.385 27.6 27.825 24.19 70-74 20.305 28.599999999999998 27.005000000000003 24.09 75-79 20.22 27.675 28.265 23.84 80-84 20.77 28.015 27.495000000000005 23.72 85-89 21.17 28.299999999999997 27.16 23.369999999999997 90-94 20.599999999999998 28.189999999999998 27.625 23.585 95-99 20.895 27.565 27.74 23.799999999999997 100-104 21.21 28.17 27.189999999999998 23.43 105-109 21.13 27.98 27.250000000000004 23.64 110-114 21.07 27.61 27.74 23.580000000000002 115-119 20.865000000000002 28.415000000000003 27.05 23.669999999999998 120-124 20.669999999999998 27.99 27.325 24.015 125-129 21.060000000000002 28.305000000000003 27.015 23.62 130-134 21.145 28.785 26.540000000000003 23.53 135-139 20.9 28.215 27.005000000000003 23.880000000000003 140-144 21.615000000000002 27.63 27.175 23.580000000000002 145-149 21.41 27.85 26.565 24.175 150-151 21.637500000000003 27.6375 26.7625 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 2.0 23 3.0 24 2.0 25 1.5 26 2.0 27 4.0 28 4.5 29 5.5 30 15.5 31 26.5 32 31.5 33 37.5 34 54.5 35 71.0 36 79.0 37 91.5 38 124.0 39 155.5 40 186.5 41 205.0 42 214.5 43 251.0 44 274.0 45 273.5 46 268.5 47 272.5 48 249.0 49 207.0 50 181.0 51 150.0 52 128.5 53 103.0 54 83.5 55 66.5 56 45.0 57 37.5 58 29.0 59 20.0 60 13.0 61 10.0 62 6.5 63 4.0 64 3.5 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64797586120191 99.075 2 0.2765903947699271 0.5499999999999999 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025144581342720643 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTGATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.5375 0.0 0.0 0.0 0.0 114-115 3.0250000000000004 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.5625 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.375 0.0 0.0 0.0 0.0 124-125 4.737500000000001 0.0 0.0 0.0 0.0 126-127 5.2 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.112500000000001 0.0 0.0 0.0 0.0 132-133 6.575 0.0 0.0 0.0 0.0 134-135 7.1125 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAAAT 10 0.005853838 152.57895 1 GATCTCG 10 0.0068378756 144.95 145 >>END_MODULE SRR7168889 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168889_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63525 33.0 33.0 34.0 32.0 34.0 2 32.793 33.0 33.0 34.0 32.0 34.0 3 32.79875 33.0 33.0 34.0 32.0 34.0 4 32.71375 33.0 33.0 34.0 32.0 34.0 5 32.785 33.0 33.0 34.0 32.0 34.0 6 36.92075 38.0 38.0 38.0 36.0 38.0 7 36.9365 38.0 38.0 38.0 36.0 38.0 8 37.0445 38.0 38.0 38.0 37.0 38.0 9 36.92375 38.0 38.0 38.0 36.0 38.0 10-14 36.90310000000001 38.0 38.0 38.0 36.2 38.0 15-19 36.8686 38.0 38.0 38.0 36.0 38.0 20-24 36.86855 38.0 38.0 38.0 36.0 38.0 25-29 36.82725000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.8096 38.0 38.0 38.0 36.0 38.0 35-39 36.77455 38.0 38.0 38.0 36.0 38.0 40-44 36.802099999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.72255 38.0 38.0 38.0 35.8 38.0 50-54 36.6946 38.0 38.0 38.0 35.8 38.0 55-59 36.6375 38.0 38.0 38.0 35.8 38.0 60-64 36.64275 38.0 38.0 38.0 35.6 38.0 65-69 36.56815 38.0 38.0 38.0 35.0 38.0 70-74 36.38185 38.0 38.0 38.0 34.4 38.0 75-79 36.27804999999999 38.0 38.0 38.0 34.0 38.0 80-84 36.20195 38.0 38.0 38.0 34.0 38.0 85-89 36.04515 38.0 38.0 38.0 33.6 38.0 90-94 36.03185 38.0 38.0 38.0 33.6 38.0 95-99 35.9713 38.0 38.0 38.0 33.6 38.0 100-104 35.85465000000001 38.0 38.0 38.0 33.0 38.0 105-109 35.728849999999994 38.0 37.8 38.0 32.6 38.0 110-114 35.384800000000006 38.0 37.0 38.0 29.8 38.0 115-119 35.279999999999994 38.0 36.8 38.0 29.6 38.0 120-124 34.93835 38.0 36.0 38.0 27.8 38.0 125-129 34.7363 38.0 36.0 38.0 27.0 38.0 130-134 34.16815 38.0 34.8 38.0 24.0 38.0 135-139 33.4183 38.0 33.2 38.0 19.2 38.0 140-144 32.79600000000001 38.0 33.0 38.0 13.0 38.0 145-149 31.436149999999998 38.0 32.2 38.0 6.0 38.0 150-151 26.336750000000002 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 5.0 5 4.0 6 1.0 7 2.0 8 2.0 9 1.0 10 1.0 11 4.0 12 2.0 13 4.0 14 5.0 15 3.0 16 8.0 17 10.0 18 9.0 19 8.0 20 13.0 21 14.0 22 17.0 23 21.0 24 18.0 25 23.0 26 24.0 27 36.0 28 47.0 29 28.0 30 39.0 31 72.0 32 72.0 33 109.0 34 122.0 35 262.0 36 643.0 37 2360.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 20.95 15.1 24.3 2 27.150000000000002 25.374999999999996 30.95 16.525000000000002 3 22.0 28.225 29.549999999999997 20.225 4 23.875 35.075 21.9 19.15 5 24.525 35.4 21.8 18.275 6 20.490367775831874 38.82912184138104 22.016512384288216 18.663997998498875 7 19.75 20.599999999999998 39.425 20.225 8 22.175 25.75 27.1 24.975 9 23.075000000000003 24.85 28.625 23.45 10-14 23.419999999999998 28.565 26.3 21.715 15-19 23.096154807740387 27.726386319315964 27.801390069503473 21.37606880344017 20-24 23.00460092018404 28.010602120424082 27.390478095619127 21.594318863772756 25-29 23.72830490671735 27.719701895663484 27.399589856449758 21.15240334116941 30-34 23.06961392278456 27.805561112222442 28.195639127825565 20.929185837167434 35-39 23.6291775065039 27.62157294376626 27.391434860916554 21.35781468881329 40-44 23.179271708683473 27.410964385754298 28.186274509803923 21.223489395758303 45-49 23.49469893978796 27.08041608321664 28.055611122224445 21.369273854770952 50-54 23.43 27.955000000000002 27.575 21.04 55-59 23.450552748736932 27.19723875744085 28.507828522835275 20.844379970986946 60-64 23.16 27.884999999999998 27.27 21.685 65-69 22.904888177315254 27.64797118126782 27.80807524891179 21.639065392505128 70-74 23.799279567740644 28.01681008605163 27.101260756453872 21.082649589753853 75-79 23.48526542252464 27.91314354330315 27.627958172812328 20.973632861359885 80-84 23.621810905452726 27.773886943471737 27.168584292146075 21.435717858929465 85-89 23.606245621058953 28.160344309878894 27.13942548293464 21.093984586127515 90-94 24.324459567654124 27.652121697357884 27.391913530824656 20.631505204163332 95-99 23.444928188960617 28.16393934844618 27.208126907871694 21.18300555472151 100-104 23.815242956513035 27.37827153080118 28.048841515287993 20.757643997397786 105-109 22.938350680544435 27.652121697357884 28.05244195356285 21.35708566853483 110-114 23.86289717287966 27.600700525394046 27.72579434575932 20.810607955966976 115-119 24.660961817544912 28.233998899064204 26.717710053545513 20.38732922984537 120-124 24.15052794875644 27.733573537506878 27.057999299404496 21.05789921433218 125-129 24.771055397087522 27.24816093679628 26.79277385777911 21.188009808337085 130-134 24.35814023322156 27.691306741404336 27.165807517141282 20.78474550823282 135-139 25.255255255255253 27.692692692692695 27.022022022022025 20.03003003003003 140-144 24.919935948759004 27.83226581265012 26.596277021617293 20.651521216973578 145-149 25.32152329480058 27.69854376219787 27.007956763248764 19.97197617975279 150-151 25.096959839859878 28.43738270987114 26.635806330539225 19.829851119729764 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 2.5 21 1.0 22 1.5 23 1.5 24 1.0 25 1.0 26 1.5 27 2.0 28 3.0 29 5.0 30 9.5 31 14.0 32 17.5 33 24.0 34 37.5 35 51.0 36 75.0 37 112.5 38 122.5 39 150.0 40 185.5 41 209.0 42 246.0 43 259.0 44 261.5 45 276.5 46 290.0 47 276.5 48 254.0 49 217.0 50 178.0 51 157.0 52 133.5 53 101.0 54 82.0 55 67.0 56 43.0 57 31.0 58 25.0 59 22.5 60 16.0 61 11.0 62 9.0 63 6.5 64 3.0 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.02 25-29 0.034999999999999996 30-34 0.02 35-39 0.06 40-44 0.04 45-49 0.02 50-54 0.0 55-59 0.045 60-64 0.0 65-69 0.065 70-74 0.06 75-79 0.065 80-84 0.05 85-89 0.09 90-94 0.08 95-99 0.08499999999999999 100-104 0.08499999999999999 105-109 0.08 110-114 0.075 115-119 0.08499999999999999 120-124 0.08499999999999999 125-129 0.08499999999999999 130-134 0.095 135-139 0.1 140-144 0.08 145-149 0.08499999999999999 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54659949622166 98.8 2 0.3526448362720403 0.7000000000000001 3 0.05037783375314861 0.15 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025188916876574305 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 10 0.25 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.8624999999999998 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.4 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 3.0250000000000004 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.375 0.0 0.0 0.0 0.0 124-125 4.737500000000001 0.0 0.0 0.0 0.0 126-127 5.2625 0.0 0.0 0.0 0.0 128-129 5.737500000000001 0.0 0.0 0.0 0.0 130-131 6.199999999999999 0.0 0.0 0.0 0.0 132-133 6.637499999999999 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.875 0.0 0.0 0.0 0.0 138-139 8.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGCC 10 0.006830828 145.0 2 GAAGCAT 10 0.006830828 145.0 145 >>END_MODULE Read 958738 spots for SRR7168889.sra Written 958738 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra Read 958729 spots for SRR7168889.sra Written 958729 spots for SRR7168889.sra SRR ids: ['SRR7168889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_itjxokjt SRR7168889.sra spots: 19174589 blocks: [[1, 958729], [958730, 1917458], [1917459, 2876187], [2876188, 3834916], [3834917, 4793645], [4793646, 5752374], [5752375, 6711103], [6711104, 7669832], [7669833, 8628561], [8628562, 9587290], [9587291, 10546019], [10546020, 11504748], [11504749, 12463477], [12463478, 13422206], [13422207, 14380935], [14380936, 15339664], [15339665, 16298393], [16298394, 17257122], [17257123, 18215851], [18215852, 19174589]] SRR7168889 file size 6475938 SRR7168889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168889 SRR7168889_1.fastq SRR7168889_2.fastq Input file: SRR7168889_1.fastq Paired file: SRR7168889_2.fastq trimmed: SRR7168889-trimmed-pair1.fastq, SRR7168889-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Feb 16 01:44:45 2025 >> started Sun Feb 16 01:51:30 2025 >> done (404.686s) 19174589 read pairs processed; of these: 33368 ( 0.17%) short read pairs filtered out after trimming by size control 40440 ( 0.21%) empty read pairs filtered out after trimming by size control 19100781 (99.62%) read pairs available; of these: 10560198 (55.29%) trimmed read pairs available after processing 8540583 (44.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 7 0.00% 24 5 0.00% 25 11 0.00% 26 10 0.00% 27 11 0.00% 28 7 0.00% 29 11 0.00% 30 11 0.00% 31 13 0.00% 32 14 0.00% 33 19 0.00% 34 20 0.00% 35 20 0.00% 36 19 0.00% 37 33 0.00% 38 28 0.00% 39 33 0.00% 40 33 0.00% 41 37 0.00% 42 44 0.00% 43 46 0.00% 44 48 0.00% 45 52 0.00% 46 77 0.00% 47 79 0.00% 48 84 0.00% 49 99 0.00% 50 122 0.00% 51 123 0.00% 52 141 0.00% 53 144 0.00% 54 190 0.00% 55 201 0.00% 56 207 0.00% 57 231 0.00% 58 264 0.00% 59 290 0.00% 60 389 0.00% 61 421 0.00% 62 472 0.00% 63 535 0.00% 64 597 0.00% 65 707 0.00% 66 762 0.00% 67 862 0.00% 68 1138 0.01% 69 2197 0.01% 70 1805 0.01% 71 1462 0.01% 72 1665 0.01% 73 1765 0.01% 74 2003 0.01% 75 2242 0.01% 76 2460 0.01% 77 2659 0.01% 78 3024 0.02% 79 3347 0.02% 80 3731 0.02% 81 4347 0.02% 82 4881 0.03% 83 5513 0.03% 84 7134 0.04% 85 8170 0.04% 86 8559 0.04% 87 9475 0.05% 88 9950 0.05% 89 10321 0.05% 90 11074 0.06% 91 12079 0.06% 92 13077 0.07% 93 14410 0.08% 94 15245 0.08% 95 16338 0.09% 96 17100 0.09% 97 18232 0.10% 98 18595 0.10% 99 19446 0.10% 100 20889 0.11% 101 22203 0.12% 102 23320 0.12% 103 24847 0.13% 104 26108 0.14% 105 27886 0.15% 106 29272 0.15% 107 29921 0.16% 108 31027 0.16% 109 32225 0.17% 110 33471 0.18% 111 34931 0.18% 112 36966 0.19% 113 38728 0.20% 114 40452 0.21% 115 42036 0.22% 116 43543 0.23% 117 44799 0.23% 118 45972 0.24% 119 46975 0.25% 120 48146 0.25% 121 50485 0.26% 122 51826 0.27% 123 55136 0.29% 124 57696 0.30% 125 59440 0.31% 126 62632 0.33% 127 64621 0.34% 128 66666 0.35% 129 69297 0.36% 130 71170 0.37% 131 73673 0.39% 132 77719 0.41% 133 82398 0.43% 134 86354 0.45% 135 91108 0.48% 136 97546 0.51% 137 102747 0.54% 138 108370 0.57% 139 115937 0.61% 140 123941 0.65% 141 135027 0.71% 142 148858 0.78% 143 168227 0.88% 144 195174 1.02% 145 232848 1.22% 146 290625 1.52% 147 385493 2.02% 148 573631 3.00% 149 1101876 5.77% 150 4774974 25.00% 151 8540583 44.71% 19100781 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=9 prefix-density=0.64 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=32.44 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=10.8 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.82 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=51.69 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.0 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7168889 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 16 02:26:21 Started mapping on | Feb 16 02:26:21 Finished on | Feb 16 02:28:23 Mapping speed, Million of reads per hour | 563.63 Number of input reads | 19100781 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17748914 Uniquely mapped reads % | 92.92% Average mapped length | 291.76 Number of splices: Total | 16856669 Number of splices: Annotated (sjdb) | 16514815 Number of splices: GT/AG | 16535780 Number of splices: GC/AG | 272629 Number of splices: AT/AC | 8410 Number of splices: Non-canonical | 39850 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 474365 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 70772 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 903691 903691 903691 N_multimapping 474365 474365 474365 N_noFeature 534479 17440321 687305 N_ambiguous 270969 1301 114266 UnstrandedReadsAssigned:16943466 PositiveStrandReadsAssigned:307292 NegativeStrandReadsAssigned:16947343 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168889 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168889-trimmed-pair1.fastq SRR7168889-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,100,781 reads, 16,985,470 reads pseudoaligned [quant] estimated average fragment length: 235.385 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,303 rounds 52401 SRR7168889.ke.tsv 34699 SRR7168889.se.tsv 87100 total ==> SRR7168889.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.61 550 18.3881 Potri.005G024800.1.v4.1 1035 800.615 168 12.513 Potri.004G059700.1.v4.1 961 726.663 9 0.738557 Potri.007G009000.2.v4.1 1416 1181.61 0 0 Potri.003G141000.2.v4.1 2943 2708.61 1066.34 23.4759 Potri.016G087400.1.v4.1 270 84.782 772 542.985 Potri.015G069301.1.v4.1 564 334.554 0 0 Potri.010G195200.1.v4.1 1773 1538.61 8 0.310052 Potri.012G127500.1.v4.1 977 742.651 110 8.83247 ==> SRR7168889.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 703 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168889 completed mapping pipeline successfully