Starting /dee2/code/volunteer_pipeline.sh SRR7168890 current disk space = 3089775161344 free memory = 1576513976 SRR7168890 SRAfilesize 80692b4613757dbe83b93ef483f552f5 SRR7168890.sra SRR7168890.sra file validated SRR7168890 is paired end SRR7168890 is conventional basespace SRR7168890 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168890_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1725 34.0 33.0 34.0 32.0 34.0 2 32.9415 34.0 33.0 34.0 32.0 34.0 3 32.9785 34.0 33.0 34.0 32.0 34.0 4 33.13975 34.0 33.0 34.0 32.0 34.0 5 33.155 34.0 33.0 34.0 32.0 34.0 6 36.86575 38.0 37.0 38.0 35.0 38.0 7 37.1875 38.0 38.0 38.0 36.0 38.0 8 37.28825 38.0 38.0 38.0 37.0 38.0 9 37.32025 38.0 38.0 38.0 37.0 38.0 10-14 37.331450000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.34645 38.0 38.0 38.0 37.0 38.0 20-24 37.3093 38.0 38.0 38.0 37.0 38.0 25-29 37.2545 38.0 38.0 38.0 37.0 38.0 30-34 37.2783 38.0 38.0 38.0 37.0 38.0 35-39 37.2445 38.0 38.0 38.0 37.0 38.0 40-44 37.1333 38.0 38.0 38.0 36.2 38.0 45-49 37.11935 38.0 38.0 38.0 36.2 38.0 50-54 37.10744999999999 38.0 38.0 38.0 36.2 38.0 55-59 37.063399999999994 38.0 38.0 38.0 36.0 38.0 60-64 37.0122 38.0 38.0 38.0 36.0 38.0 65-69 37.0156 38.0 38.0 38.0 36.0 38.0 70-74 36.9458 38.0 38.0 38.0 35.6 38.0 75-79 36.72924999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.702749999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.53555 38.0 38.0 38.0 34.2 38.0 90-94 36.5118 38.0 38.0 38.0 34.0 38.0 95-99 36.31935 38.0 38.0 38.0 34.0 38.0 100-104 36.216899999999995 38.0 37.8 38.0 33.6 38.0 105-109 36.10510000000001 38.0 37.2 38.0 33.2 38.0 110-114 35.820750000000004 38.0 37.0 38.0 32.2 38.0 115-119 35.557399999999994 38.0 36.6 38.0 30.2 38.0 120-124 35.408500000000004 38.0 36.0 38.0 30.0 38.0 125-129 35.0623 38.0 35.8 38.0 28.0 38.0 130-134 34.8072 38.0 35.4 38.0 27.6 38.0 135-139 34.424099999999996 38.0 34.6 38.0 25.6 38.0 140-144 33.932100000000005 38.0 33.8 38.0 23.2 38.0 145-149 32.81915 38.0 33.0 38.0 15.4 38.0 150-151 28.689375 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 5.0 18 4.0 19 10.0 20 6.0 21 7.0 22 6.0 23 9.0 24 10.0 25 16.0 26 17.0 27 32.0 28 27.0 29 36.0 30 51.0 31 74.0 32 81.0 33 124.0 34 178.0 35 244.0 36 718.0 37 2340.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.461380020597325 13.388259526261587 12.512873326467558 36.637487126673534 2 22.625 18.975 32.925 25.474999999999998 3 20.45 24.325 26.200000000000003 29.025000000000002 4 21.425 33.175 21.475 23.925 5 21.325 35.35 23.799999999999997 19.525000000000002 6 17.825 36.175000000000004 25.55 20.45 7 14.075 24.85 42.375 18.7 8 17.025000000000002 25.2 30.075000000000003 27.700000000000003 9 18.775 24.825 32.025 24.375 10-14 19.7 29.630000000000003 27.224999999999998 23.445 15-19 20.27 28.38 27.700000000000003 23.65 20-24 20.105 28.605000000000004 28.07 23.22 25-29 20.349999999999998 28.65 27.839999999999996 23.16 30-34 20.095 28.555000000000003 27.825 23.525 35-39 19.885 28.68 27.565 23.87 40-44 20.119999999999997 28.804999999999996 27.46 23.615 45-49 19.82 28.560000000000002 27.675 23.945 50-54 19.885 28.325 28.294999999999998 23.494999999999997 55-59 19.725 28.52 27.77 23.985 60-64 19.97 28.27 27.755000000000003 24.005000000000003 65-69 20.075000000000003 28.84 27.169999999999998 23.915 70-74 19.93 28.65 27.445000000000004 23.974999999999998 75-79 19.830000000000002 28.285 28.249999999999996 23.635 80-84 20.59 28.38 27.555000000000003 23.474999999999998 85-89 20.23 28.249999999999996 27.435 24.085 90-94 20.315 28.27 27.685 23.73 95-99 20.580000000000002 28.125 27.625 23.669999999999998 100-104 20.9 28.465 26.85 23.785 105-109 20.71 27.794999999999998 27.845 23.65 110-114 21.3 28.03 27.084999999999997 23.585 115-119 20.735 28.355000000000004 27.105 23.805 120-124 20.965 28.194999999999997 26.21 24.63 125-129 21.19 28.38 26.625 23.805 130-134 21.02 28.084999999999997 26.405 24.490000000000002 135-139 21.085 27.83 26.015 25.069999999999997 140-144 20.880000000000003 27.589999999999996 26.58 24.95 145-149 21.060000000000002 28.660000000000004 25.385 24.895 150-151 21.0125 28.762500000000003 25.8625 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 2.0 25 3.5 26 4.5 27 5.5 28 8.5 29 13.0 30 15.5 31 18.5 32 29.0 33 47.5 34 70.0 35 83.0 36 95.5 37 127.0 38 158.5 39 165.5 40 181.0 41 214.5 42 235.5 43 249.5 44 252.5 45 264.5 46 259.5 47 249.5 48 232.0 49 193.0 50 175.0 51 138.0 52 110.5 53 104.5 54 77.5 55 55.5 56 41.0 57 28.0 58 22.5 59 18.0 60 15.0 61 8.5 62 4.5 63 5.5 64 4.0 65 3.0 66 2.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.3770739064856712 0.75 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGC 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.6125 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 3.0125 0.0 0.0 0.0 0.0 108-109 3.475 0.0 0.0 0.0 0.0 110-111 3.8125 0.0 0.0 0.0 0.0 112-113 4.4125 0.0 0.0 0.0 0.0 114-115 4.9375 0.0 0.0 0.0 0.0 116-117 5.6625 0.0 0.0 0.0 0.0 118-119 6.425000000000001 0.0 0.0 0.0 0.0 120-121 7.0625 0.0 0.0 0.0 0.0 122-123 8.0125 0.0 0.0 0.0 0.0 124-125 8.8875 0.0 0.0 0.0 0.0 126-127 9.55 0.0 0.0 0.0 0.0 128-129 10.1625 0.0 0.0 0.0 0.0 130-131 11.0 0.0 0.0 0.0 0.0 132-133 11.7 0.0 0.0 0.0 0.0 134-135 12.375 0.0 0.0 0.0 0.0 136-137 13.475000000000001 0.0 0.0 0.0 0.0 138-139 14.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168890 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168890_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61175 33.0 33.0 34.0 32.0 34.0 2 32.75825 33.0 33.0 34.0 32.0 34.0 3 32.73825 33.0 33.0 34.0 31.0 34.0 4 32.6995 33.0 33.0 34.0 32.0 34.0 5 32.742 33.0 33.0 34.0 32.0 34.0 6 36.892 38.0 38.0 38.0 36.0 38.0 7 36.886 38.0 38.0 38.0 36.0 38.0 8 36.9045 38.0 38.0 38.0 36.0 38.0 9 36.858 38.0 38.0 38.0 36.0 38.0 10-14 36.8993 38.0 38.0 38.0 36.0 38.0 15-19 36.87 38.0 38.0 38.0 36.0 38.0 20-24 36.921800000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.867399999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.840650000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.857949999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.893299999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.74685 38.0 38.0 38.0 35.8 38.0 50-54 36.7097 38.0 38.0 38.0 35.6 38.0 55-59 36.6948 38.0 38.0 38.0 35.2 38.0 60-64 36.64945 38.0 38.0 38.0 35.2 38.0 65-69 36.54075 38.0 38.0 38.0 35.0 38.0 70-74 36.41095 38.0 38.0 38.0 34.4 38.0 75-79 36.2665 38.0 38.0 38.0 34.0 38.0 80-84 36.168400000000005 38.0 38.0 38.0 33.6 38.0 85-89 36.0713 38.0 38.0 38.0 33.2 38.0 90-94 36.06935 38.0 38.0 38.0 33.6 38.0 95-99 35.8915 38.0 38.0 38.0 33.0 38.0 100-104 35.842200000000005 38.0 37.4 38.0 32.6 38.0 105-109 35.682849999999995 38.0 37.0 38.0 31.8 38.0 110-114 35.452999999999996 38.0 37.0 38.0 30.2 38.0 115-119 35.163850000000004 38.0 36.0 38.0 28.6 38.0 120-124 34.988299999999995 38.0 36.0 38.0 28.0 38.0 125-129 34.6632 38.0 35.8 38.0 26.4 38.0 130-134 34.14960000000001 38.0 35.0 38.0 23.0 38.0 135-139 33.54205 38.0 34.2 38.0 20.2 38.0 140-144 32.823449999999994 38.0 33.2 38.0 13.8 38.0 145-149 31.45595 38.0 32.0 38.0 8.6 38.0 150-151 25.964375 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 0.0 5 3.0 6 0.0 7 3.0 8 0.0 9 0.0 10 0.0 11 3.0 12 1.0 13 4.0 14 2.0 15 6.0 16 9.0 17 10.0 18 10.0 19 11.0 20 7.0 21 8.0 22 16.0 23 19.0 24 15.0 25 25.0 26 34.0 27 37.0 28 33.0 29 43.0 30 54.0 31 74.0 32 85.0 33 108.0 34 162.0 35 298.0 36 675.0 37 2235.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.199999999999996 19.225 16.05 28.525 2 25.45 25.95 31.775 16.825000000000003 3 21.4 27.575 32.05 18.975 4 23.95 34.575 22.05 19.425 5 24.9 37.525 21.6 15.975 6 20.9 37.45 23.974999999999998 17.675 7 19.825 20.1 39.825 20.25 8 22.05 25.924999999999997 26.724999999999998 25.3 9 23.5 24.575 28.725 23.200000000000003 10-14 23.39 28.425 26.88 21.305 15-19 22.95 27.6 28.34 21.11 20-24 23.294999999999998 28.895 27.095000000000002 20.715 25-29 23.34 28.625 27.295 20.74 30-34 23.195 28.035 28.470000000000002 20.3 35-39 23.49 28.035 27.205000000000002 21.27 40-44 23.474999999999998 27.775 27.955000000000002 20.794999999999998 45-49 23.635 28.235 27.705000000000002 20.424999999999997 50-54 24.279999999999998 27.1 28.050000000000004 20.57 55-59 23.52 27.295 27.96 21.224999999999998 60-64 24.005000000000003 27.43 27.889999999999997 20.674999999999997 65-69 23.919999999999998 27.575 27.515 20.990000000000002 70-74 23.49 27.58 28.134999999999998 20.794999999999998 75-79 23.655 28.015 27.57 20.76 80-84 23.380000000000003 27.87 27.944999999999997 20.805 85-89 23.76 28.075 27.715 20.45 90-94 23.95 28.189999999999998 27.66 20.200000000000003 95-99 23.275000000000002 28.46 27.544999999999998 20.72 100-104 23.585 27.810000000000002 28.26 20.345 105-109 23.955000000000002 28.125 27.67 20.25 110-114 23.84 28.23 27.455000000000002 20.474999999999998 115-119 24.474999999999998 28.24 27.43 19.855 120-124 24.515 28.050000000000004 27.51 19.925 125-129 25.45 27.63 27.150000000000002 19.77 130-134 25.627688306491947 27.888366509952984 26.89306792037611 19.590877263178953 135-139 26.105 27.705000000000002 26.955000000000002 19.235 140-144 25.679999999999996 28.4 26.47 19.45 145-149 26.224999999999998 28.42 26.35 19.005 150-151 27.2625 28.725 25.650000000000002 18.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 4.0 26 3.5 27 2.0 28 4.5 29 6.0 30 7.0 31 9.5 32 18.5 33 31.5 34 51.0 35 68.5 36 86.0 37 111.5 38 135.5 39 157.5 40 193.5 41 242.5 42 257.0 43 249.0 44 273.0 45 289.5 46 277.5 47 259.5 48 222.0 49 197.5 50 168.5 51 140.5 52 126.0 53 99.5 54 80.0 55 64.0 56 41.0 57 25.0 58 20.0 59 17.0 60 18.0 61 14.0 62 8.0 63 6.0 64 4.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.03 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52189229994968 98.875 2 0.45294413688978363 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025163563160543533 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.6000000000000001 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.1375 0.0 0.0 0.0 0.0 96-97 1.2625000000000002 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 3.0625 0.0 0.0 0.0 0.0 108-109 3.525 0.0 0.0 0.0 0.0 110-111 3.8499999999999996 0.0 0.0 0.0 0.0 112-113 4.45 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.75 0.0 0.0 0.0 0.0 118-119 6.512499999999999 0.0 0.0 0.0 0.0 120-121 7.125 0.0 0.0 0.0 0.0 122-123 8.0375 0.0 0.0 0.0 0.0 124-125 8.899999999999999 0.0 0.0 0.0 0.0 126-127 9.575 0.0 0.0 0.0 0.0 128-129 10.1375 0.0 0.0 0.0 0.0 130-131 10.962499999999999 0.0 0.0 0.0 0.0 132-133 11.6875 0.0 0.0 0.0 0.0 134-135 12.3875 0.0 0.0 0.0 0.0 136-137 13.475000000000001 0.0 0.0 0.0 0.0 138-139 14.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCTC 10 0.006830828 145.0 8 GACCTCA 10 0.006830828 145.0 9 >>END_MODULE Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878085 spots for SRR7168890.sra Written 878085 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra Read 878072 spots for SRR7168890.sra Written 878072 spots for SRR7168890.sra SRR ids: ['SRR7168890.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pdunwcf2 SRR7168890.sra spots: 17561453 blocks: [[1, 878072], [878073, 1756144], [1756145, 2634216], [2634217, 3512288], [3512289, 4390360], [4390361, 5268432], [5268433, 6146504], [6146505, 7024576], [7024577, 7902648], [7902649, 8780720], [8780721, 9658792], [9658793, 10536864], [10536865, 11414936], [11414937, 12293008], [12293009, 13171080], [13171081, 14049152], [14049153, 14927224], [14927225, 15805296], [15805297, 16683368], [16683369, 17561453]] SRR7168890 file size 5929299 SRR7168890 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168890 SRR7168890_1.fastq SRR7168890_2.fastq Input file: SRR7168890_1.fastq Paired file: SRR7168890_2.fastq trimmed: SRR7168890-trimmed-pair1.fastq, SRR7168890-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Feb 16 02:19:28 2025 >> started Sun Feb 16 02:26:11 2025 >> done (403.333s) 17561453 read pairs processed; of these: 26356 ( 0.15%) short read pairs filtered out after trimming by size control 83569 ( 0.48%) empty read pairs filtered out after trimming by size control 17451528 (99.37%) read pairs available; of these: 10659317 (61.08%) trimmed read pairs available after processing 6792211 (38.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 10 0.00% 20 13 0.00% 21 9 0.00% 22 6 0.00% 23 9 0.00% 24 7 0.00% 25 7 0.00% 26 10 0.00% 27 11 0.00% 28 16 0.00% 29 11 0.00% 30 16 0.00% 31 13 0.00% 32 11 0.00% 33 18 0.00% 34 22 0.00% 35 19 0.00% 36 34 0.00% 37 25 0.00% 38 35 0.00% 39 39 0.00% 40 46 0.00% 41 57 0.00% 42 70 0.00% 43 68 0.00% 44 83 0.00% 45 87 0.00% 46 109 0.00% 47 109 0.00% 48 131 0.00% 49 162 0.00% 50 185 0.00% 51 192 0.00% 52 249 0.00% 53 270 0.00% 54 275 0.00% 55 327 0.00% 56 381 0.00% 57 359 0.00% 58 452 0.00% 59 523 0.00% 60 611 0.00% 61 702 0.00% 62 880 0.01% 63 979 0.01% 64 1105 0.01% 65 1270 0.01% 66 1287 0.01% 67 1474 0.01% 68 1782 0.01% 69 2801 0.02% 70 2605 0.01% 71 2495 0.01% 72 2880 0.02% 73 3345 0.02% 74 3582 0.02% 75 3919 0.02% 76 4417 0.03% 77 4896 0.03% 78 5398 0.03% 79 6116 0.04% 80 6765 0.04% 81 7747 0.04% 82 8708 0.05% 83 10016 0.06% 84 11809 0.07% 85 13300 0.08% 86 14074 0.08% 87 15230 0.09% 88 15952 0.09% 89 16938 0.10% 90 18207 0.10% 91 19825 0.11% 92 21807 0.12% 93 23486 0.13% 94 25584 0.15% 95 26982 0.15% 96 28577 0.16% 97 29509 0.17% 98 30168 0.17% 99 31866 0.18% 100 33447 0.19% 101 35060 0.20% 102 37633 0.22% 103 39807 0.23% 104 42090 0.24% 105 44491 0.25% 106 45794 0.26% 107 46840 0.27% 108 47673 0.27% 109 49235 0.28% 110 50745 0.29% 111 51827 0.30% 112 53968 0.31% 113 57325 0.33% 114 59573 0.34% 115 62120 0.36% 116 63463 0.36% 117 64262 0.37% 118 65843 0.38% 119 66378 0.38% 120 67425 0.39% 121 68951 0.40% 122 70936 0.41% 123 74714 0.43% 124 77814 0.45% 125 80368 0.46% 126 82679 0.47% 127 85096 0.49% 128 86000 0.49% 129 88268 0.51% 130 90402 0.52% 131 92186 0.53% 132 95639 0.55% 133 99509 0.57% 134 103700 0.59% 135 109181 0.63% 136 113867 0.65% 137 119129 0.68% 138 125040 0.72% 139 131173 0.75% 140 137872 0.79% 141 148030 0.85% 142 159722 0.92% 143 176617 1.01% 144 201002 1.15% 145 234150 1.34% 146 285115 1.63% 147 373458 2.14% 148 538189 3.08% 149 1003682 5.75% 150 4088257 23.43% 151 6792211 38.92% 17451528 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=34 prefix-density=0.50 prefix-fanout=1.1 sequence=TAAGCTTTCTTTGCCTCCTCAAGCTCAAGCAACACTTGAGATGCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=111.60 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=13.5 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=7.05 fanout-score-rank=13 prefix-density=0.68 prefix-fanout=1.9 sequence=ATGGCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=84.89 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.0 sequence=AACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGT SRR7168890 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 16 02:28:35 Started mapping on | Feb 16 02:28:36 Finished on | Feb 16 02:30:39 Mapping speed, Million of reads per hour | 510.78 Number of input reads | 17451528 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 16252646 Uniquely mapped reads % | 93.13% Average mapped length | 287.12 Number of splices: Total | 14728355 Number of splices: Annotated (sjdb) | 14360771 Number of splices: GT/AG | 14444896 Number of splices: GC/AG | 228268 Number of splices: AT/AC | 8815 Number of splices: Non-canonical | 46376 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501672 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 93619 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718055 718055 718055 N_multimapping 501672 501672 501672 N_noFeature 553056 15937108 753287 N_ambiguous 242441 1738 125857 UnstrandedReadsAssigned:15457149 PositiveStrandReadsAssigned:313800 NegativeStrandReadsAssigned:15373502 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7168890 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168890-trimmed-pair1.fastq SRR7168890-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,451,528 reads, 15,421,450 reads pseudoaligned [quant] estimated average fragment length: 215.292 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7168890.ke.tsv 34699 SRR7168890.se.tsv 87100 total ==> SRR7168890.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.71 997 39.3264 Potri.005G024800.1.v4.1 1035 820.708 410 35.5427 Potri.004G059700.1.v4.1 961 746.718 5 0.476397 Potri.007G009000.2.v4.1 1416 1201.71 0 0 Potri.003G141000.2.v4.1 2943 2728.71 862 22.4753 Potri.016G087400.1.v4.1 270 95.9268 1158 858.864 Potri.015G069301.1.v4.1 564 352.847 0 0 Potri.010G195200.1.v4.1 1773 1558.71 17 0.775961 Potri.012G127500.1.v4.1 977 762.713 362 33.7678 ==> SRR7168890.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 72 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 227 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 113 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168890 completed mapping pipeline successfully