Starting /dee2/code/volunteer_pipeline.sh SRR7168891 current disk space = 3090836492288 free memory = 1573813984 SRR7168891 SRAfilesize 5aefd7bba0fadeca6f06385f00de5636 SRR7168891.sra SRR7168891.sra file validated SRR7168891 is paired end SRR7168891 is conventional basespace SRR7168891 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168891_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13525 34.0 33.0 34.0 32.0 34.0 2 33.18175 34.0 33.0 34.0 32.0 34.0 3 33.22525 34.0 33.0 34.0 32.0 34.0 4 33.318 34.0 33.0 34.0 32.0 34.0 5 33.37025 34.0 33.0 34.0 33.0 34.0 6 36.98775 38.0 37.0 38.0 36.0 38.0 7 37.29675 38.0 38.0 38.0 36.0 38.0 8 37.46725 38.0 38.0 38.0 37.0 38.0 9 37.4295 38.0 38.0 38.0 37.0 38.0 10-14 37.46455 38.0 38.0 38.0 37.0 38.0 15-19 37.5035 38.0 38.0 38.0 37.2 38.0 20-24 37.488299999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.412400000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.3882 38.0 38.0 38.0 37.0 38.0 35-39 37.3696 38.0 38.0 38.0 37.0 38.0 40-44 37.317750000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.29875 38.0 38.0 38.0 37.0 38.0 50-54 37.15495 38.0 38.0 38.0 36.4 38.0 55-59 37.098 38.0 38.0 38.0 36.0 38.0 60-64 36.9996 38.0 38.0 38.0 35.8 38.0 65-69 36.92835 38.0 38.0 38.0 35.8 38.0 70-74 36.953700000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.82705 38.0 38.0 38.0 35.0 38.0 80-84 36.6509 38.0 38.0 38.0 34.4 38.0 85-89 36.518350000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.338350000000005 38.0 37.6 38.0 34.0 38.0 95-99 35.93860000000001 38.0 37.0 38.0 32.4 38.0 100-104 35.87555 38.0 37.0 38.0 31.8 38.0 105-109 35.7734 38.0 37.0 38.0 31.0 38.0 110-114 35.465700000000005 38.0 36.2 38.0 29.6 38.0 115-119 35.1563 38.0 36.0 38.0 28.0 38.0 120-124 34.668899999999994 38.0 35.2 38.0 26.2 38.0 125-129 34.3341 38.0 34.8 38.0 23.8 38.0 130-134 33.825849999999996 38.0 34.0 38.0 21.8 38.0 135-139 33.132949999999994 38.0 33.2 38.0 17.4 38.0 140-144 32.45975 37.8 32.0 38.0 14.2 38.0 145-149 30.926800000000004 36.0 30.6 38.0 8.6 38.0 150-151 26.296875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 5.0 19 7.0 20 3.0 21 5.0 22 9.0 23 12.0 24 19.0 25 18.0 26 19.0 27 28.0 28 34.0 29 52.0 30 81.0 31 71.0 32 97.0 33 141.0 34 218.0 35 354.0 36 884.0 37 1937.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.275332117739 12.841885907788486 10.315186246418339 39.56759572805419 2 22.3 16.975 34.150000000000006 26.575 3 20.275000000000002 22.125 25.424999999999997 32.175 4 23.150000000000002 32.0 21.625 23.225 5 23.125 33.5 23.025000000000002 20.349999999999998 6 18.104526131532882 36.509127281820454 25.906476619154787 19.479869967491872 7 14.875 25.8 42.05 17.275 8 17.275 25.224999999999998 31.900000000000002 25.6 9 17.349999999999998 25.25 33.45 23.95 10-14 20.055 29.9 26.35 23.695 15-19 19.814999999999998 28.43 28.525 23.23 20-24 19.56 28.9 27.765 23.775 25-29 19.8 29.45 27.474999999999998 23.275000000000002 30-34 19.735 28.549999999999997 28.095 23.62 35-39 20.305 28.34 27.555000000000003 23.799999999999997 40-44 20.155 28.634999999999998 27.529999999999998 23.68 45-49 20.71 28.410000000000004 27.71 23.169999999999998 50-54 19.85 28.299999999999997 28.244999999999997 23.605 55-59 19.905 28.76 28.325 23.01 60-64 20.515 28.945 27.68 22.86 65-69 19.775000000000002 28.73 28.12 23.375 70-74 20.265 28.599999999999998 27.43 23.705000000000002 75-79 19.689999999999998 28.749999999999996 28.18 23.380000000000003 80-84 19.805 28.78 27.825 23.59 85-89 19.759999999999998 29.345 27.67 23.225 90-94 19.895 28.37 27.900000000000002 23.835 95-99 20.48 28.804999999999996 27.725 22.99 100-104 20.185 28.67 28.03 23.115 105-109 20.31 28.765 27.43 23.494999999999997 110-114 19.895 28.585 28.035 23.485 115-119 20.635 28.98 27.295 23.09 120-124 20.24 29.025000000000002 26.945000000000004 23.79 125-129 21.08 28.360000000000003 27.0 23.56 130-134 21.055 28.51 26.795 23.64 135-139 20.585 28.77 27.029999999999998 23.615 140-144 20.39 28.799999999999997 26.825 23.985 145-149 20.855 28.854999999999997 26.584999999999997 23.705000000000002 150-151 19.9125 29.625 25.9625 24.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 2.0 25 2.5 26 5.0 27 7.0 28 11.0 29 17.5 30 20.5 31 30.0 32 38.5 33 44.5 34 62.0 35 87.0 36 100.0 37 121.0 38 152.0 39 174.0 40 197.5 41 222.0 42 237.5 43 259.5 44 288.5 45 279.5 46 248.0 47 231.0 48 214.5 49 185.5 50 150.0 51 125.0 52 106.0 53 88.5 54 71.0 55 50.0 56 43.5 57 35.5 58 27.5 59 22.5 60 13.0 61 9.5 62 5.0 63 2.5 64 2.5 65 0.5 66 1.5 67 2.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.9249999999999998 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5375 0.0 0.0 0.0 0.0 114-115 2.9625 0.0 0.0 0.0 0.0 116-117 3.425 0.0 0.0 0.0 0.0 118-119 3.9000000000000004 0.0 0.0 0.0 0.0 120-121 4.449999999999999 0.0 0.0 0.0 0.0 122-123 4.9375 0.0 0.0 0.0 0.0 124-125 5.3625 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.324999999999999 0.0 0.0 0.0 0.0 130-131 6.8125 0.0 0.0 0.0 0.0 132-133 7.2625 0.0 0.0 0.0 0.0 134-135 7.775 0.0 0.0 0.0 0.0 136-137 8.412500000000001 0.0 0.0 0.0 0.0 138-139 8.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168891 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168891_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85225 33.0 33.0 34.0 32.0 34.0 2 32.963 34.0 33.0 34.0 32.0 34.0 3 32.9425 34.0 33.0 34.0 32.0 34.0 4 32.929 34.0 33.0 34.0 32.0 34.0 5 32.92825 34.0 33.0 34.0 32.0 34.0 6 37.1975 38.0 38.0 38.0 37.0 38.0 7 37.15025 38.0 38.0 38.0 37.0 38.0 8 37.14175 38.0 38.0 38.0 37.0 38.0 9 37.1625 38.0 38.0 38.0 37.0 38.0 10-14 37.179050000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.15 38.0 38.0 38.0 37.0 38.0 20-24 37.1088 38.0 38.0 38.0 37.0 38.0 25-29 37.127449999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.083800000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.07645 38.0 38.0 38.0 37.0 38.0 40-44 36.993399999999994 38.0 38.0 38.0 36.6 38.0 45-49 36.93705 38.0 38.0 38.0 36.2 38.0 50-54 36.825199999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.805350000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.777950000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.749700000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.6339 38.0 38.0 38.0 35.2 38.0 75-79 36.50095 38.0 38.0 38.0 34.8 38.0 80-84 36.48505 38.0 38.0 38.0 34.4 38.0 85-89 36.33515 38.0 38.0 38.0 34.2 38.0 90-94 36.35125000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.2005 38.0 38.0 38.0 34.0 38.0 100-104 36.0654 38.0 38.0 38.0 33.0 38.0 105-109 35.82025 38.0 37.4 38.0 32.0 38.0 110-114 35.75555000000001 38.0 37.4 38.0 31.4 38.0 115-119 35.666 38.0 37.2 38.0 32.0 38.0 120-124 35.30265 38.0 36.4 38.0 29.8 38.0 125-129 35.173899999999996 38.0 36.2 38.0 29.6 38.0 130-134 34.49145 38.0 35.2 38.0 25.8 38.0 135-139 33.95635 38.0 34.0 38.0 22.8 38.0 140-144 33.2568 38.0 33.0 38.0 17.0 38.0 145-149 32.168350000000004 38.0 33.0 38.0 8.4 38.0 150-151 27.1115 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 1.0 5 3.0 6 1.0 7 2.0 8 4.0 9 0.0 10 0.0 11 3.0 12 4.0 13 1.0 14 1.0 15 2.0 16 8.0 17 5.0 18 7.0 19 6.0 20 4.0 21 12.0 22 14.0 23 12.0 24 18.0 25 24.0 26 29.0 27 28.0 28 40.0 29 38.0 30 53.0 31 64.0 32 73.0 33 109.0 34 133.0 35 237.0 36 562.0 37 2497.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.35 18.475 16.150000000000002 27.025 2 26.450000000000003 24.375 33.25 15.925 3 21.325 27.875 30.2 20.599999999999998 4 24.375 35.75 22.15 17.724999999999998 5 23.75 36.575 23.674999999999997 16.0 6 20.65 36.975 25.224999999999998 17.150000000000002 7 19.2 21.175 40.699999999999996 18.925 8 21.475 24.474999999999998 28.175 25.874999999999996 9 21.975 24.5 29.475 24.05 10-14 23.064999999999998 29.54 26.424999999999997 20.97 15-19 23.145 28.425 27.855 20.575 20-24 22.28 28.505000000000003 28.134999999999998 21.08 25-29 22.400000000000002 28.38 28.21 21.01 30-34 23.064999999999998 28.535 28.035 20.365 35-39 22.7 28.42 27.935 20.945 40-44 23.025000000000002 27.860000000000003 28.425 20.69 45-49 22.66 28.13 28.875 20.335 50-54 22.675 27.694999999999997 28.975 20.655 55-59 23.015 27.860000000000003 28.235 20.89 60-64 23.765 28.09 27.855 20.29 65-69 23.14 27.389999999999997 28.595 20.875 70-74 23.275000000000002 27.985 28.075 20.665 75-79 23.200000000000003 28.17 28.235 20.395 80-84 23.62 28.115000000000002 27.665 20.599999999999998 85-89 22.915 28.64 27.815 20.630000000000003 90-94 23.43 27.42 28.660000000000004 20.49 95-99 23.150000000000002 28.125 28.470000000000002 20.255000000000003 100-104 23.49 27.49 28.384999999999998 20.635 105-109 23.455000000000002 27.83 28.449999999999996 20.265 110-114 23.625 28.415000000000003 27.41 20.549999999999997 115-119 23.82 27.76 28.12 20.3 120-124 24.015 28.294999999999998 27.54 20.150000000000002 125-129 24.47 27.860000000000003 27.815 19.855 130-134 24.82 28.075 27.43 19.675 135-139 25.115 27.555000000000003 27.715 19.615 140-144 25.314999999999998 28.444999999999997 26.529999999999998 19.71 145-149 26.064999999999998 28.405 26.57 18.96 150-151 25.900000000000002 27.6375 26.875 19.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 1.0 25 3.5 26 5.5 27 8.5 28 12.0 29 14.5 30 19.5 31 24.5 32 27.5 33 45.5 34 60.0 35 75.0 36 93.5 37 120.0 38 149.5 39 183.5 40 215.5 41 229.5 42 252.0 43 273.0 44 276.0 45 261.0 46 248.0 47 233.5 48 223.5 49 200.5 50 160.5 51 121.5 52 94.0 53 86.5 54 68.5 55 45.5 56 34.0 57 30.0 58 25.5 59 20.0 60 17.0 61 11.0 62 7.5 63 5.0 64 2.5 65 1.0 66 1.5 67 3.0 68 2.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44584382871537 98.7 2 0.4030226700251889 0.8 3 0.10075566750629722 0.3 4 0.05037783375314861 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.8375 0.0 0.0 0.0 0.0 116-117 3.3125 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 4.35 0.0 0.0 0.0 0.0 122-123 4.824999999999999 0.0 0.0 0.0 0.0 124-125 5.2875 0.0 0.0 0.0 0.0 126-127 5.7625 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.6625 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.6875 0.0 0.0 0.0 0.0 136-137 8.337499999999999 0.0 0.0 0.0 0.0 138-139 8.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCTT 10 0.006830828 145.0 4 ATTCTTA 10 0.006830828 145.0 4 CAAATCT 10 0.006830828 145.0 3 AAAAAAA 35 0.0035366106 20.714287 60-64 >>END_MODULE Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833792 spots for SRR7168891.sra Written 833792 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra Read 833784 spots for SRR7168891.sra Written 833784 spots for SRR7168891.sra SRR ids: ['SRR7168891.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uoihlpuh SRR7168891.sra spots: 16675688 blocks: [[1, 833784], [833785, 1667568], [1667569, 2501352], [2501353, 3335136], [3335137, 4168920], [4168921, 5002704], [5002705, 5836488], [5836489, 6670272], [6670273, 7504056], [7504057, 8337840], [8337841, 9171624], [9171625, 10005408], [10005409, 10839192], [10839193, 11672976], [11672977, 12506760], [12506761, 13340544], [13340545, 14174328], [14174329, 15008112], [15008113, 15841896], [15841897, 16675688]] SRR7168891 file size 5629143 SRR7168891 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168891 SRR7168891_1.fastq SRR7168891_2.fastq Input file: SRR7168891_1.fastq Paired file: SRR7168891_2.fastq trimmed: SRR7168891-trimmed-pair1.fastq, SRR7168891-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Feb 16 02:28:53 2025 >> started Sun Feb 16 02:29:15 2025 >> done (22.675s) 16675688 read pairs processed; of these: 15098 ( 0.09%) short read pairs filtered out after trimming by size control 23487 ( 0.14%) empty read pairs filtered out after trimming by size control 16637103 (99.77%) read pairs available; of these: 8858816 (53.25%) trimmed read pairs available after processing 7778287 (46.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 3 0.00% 21 5 0.00% 22 7 0.00% 23 4 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 10 0.00% 28 7 0.00% 29 8 0.00% 30 13 0.00% 31 9 0.00% 32 14 0.00% 33 10 0.00% 34 14 0.00% 35 16 0.00% 36 16 0.00% 37 8 0.00% 38 22 0.00% 39 19 0.00% 40 36 0.00% 41 35 0.00% 42 43 0.00% 43 45 0.00% 44 34 0.00% 45 50 0.00% 46 59 0.00% 47 61 0.00% 48 89 0.00% 49 102 0.00% 50 101 0.00% 51 134 0.00% 52 145 0.00% 53 150 0.00% 54 162 0.00% 55 179 0.00% 56 208 0.00% 57 260 0.00% 58 245 0.00% 59 265 0.00% 60 397 0.00% 61 433 0.00% 62 452 0.00% 63 475 0.00% 64 600 0.00% 65 652 0.00% 66 731 0.00% 67 795 0.00% 68 991 0.01% 69 1688 0.01% 70 1688 0.01% 71 1449 0.01% 72 1591 0.01% 73 1816 0.01% 74 1951 0.01% 75 2234 0.01% 76 2433 0.01% 77 2748 0.02% 78 3036 0.02% 79 3360 0.02% 80 3687 0.02% 81 4283 0.03% 82 4898 0.03% 83 5361 0.03% 84 6592 0.04% 85 7434 0.04% 86 7763 0.05% 87 8644 0.05% 88 9090 0.05% 89 9826 0.06% 90 10758 0.06% 91 11566 0.07% 92 12497 0.08% 93 13499 0.08% 94 14579 0.09% 95 15717 0.09% 96 16464 0.10% 97 17601 0.11% 98 18072 0.11% 99 19296 0.12% 100 20149 0.12% 101 21272 0.13% 102 22376 0.13% 103 23747 0.14% 104 24804 0.15% 105 26366 0.16% 106 27442 0.16% 107 28414 0.17% 108 29452 0.18% 109 30298 0.18% 110 31978 0.19% 111 33080 0.20% 112 34402 0.21% 113 35950 0.22% 114 36834 0.22% 115 38743 0.23% 116 39770 0.24% 117 41287 0.25% 118 42121 0.25% 119 43270 0.26% 120 44710 0.27% 121 46433 0.28% 122 47412 0.28% 123 49650 0.30% 124 51014 0.31% 125 53395 0.32% 126 55166 0.33% 127 56853 0.34% 128 58246 0.35% 129 59976 0.36% 130 62686 0.38% 131 63943 0.38% 132 66822 0.40% 133 69624 0.42% 134 72397 0.44% 135 75848 0.46% 136 79343 0.48% 137 83534 0.50% 138 88865 0.53% 139 94328 0.57% 140 100480 0.60% 141 108675 0.65% 142 119587 0.72% 143 133380 0.80% 144 152452 0.92% 145 180981 1.09% 146 225286 1.35% 147 300071 1.80% 148 454201 2.73% 149 879918 5.29% 150 4042025 24.30% 151 7778287 46.75% 16637103 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=29 prefix-density=0.31 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=52.38 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.8 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=22 prefix-density=0.43 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=12.61 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=4.0 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7168891 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 16 02:30:43 Started mapping on | Feb 16 02:30:43 Finished on | Feb 16 02:32:44 Mapping speed, Million of reads per hour | 494.99 Number of input reads | 16637103 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15504737 Uniquely mapped reads % | 93.19% Average mapped length | 291.52 Number of splices: Total | 14479737 Number of splices: Annotated (sjdb) | 14108269 Number of splices: GT/AG | 14203333 Number of splices: GC/AG | 222921 Number of splices: AT/AC | 8688 Number of splices: Non-canonical | 44795 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 444170 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 179638 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 702833 702833 702833 N_multimapping 444170 444170 444170 N_noFeature 808310 15008796 1166039 N_ambiguous 238416 2686 98006 UnstrandedReadsAssigned:14458011 PositiveStrandReadsAssigned:493255 NegativeStrandReadsAssigned:14240692 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168891 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168891-trimmed-pair1.fastq SRR7168891-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,637,103 reads, 14,302,503 reads pseudoaligned [quant] estimated average fragment length: 233.551 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR7168891.ke.tsv 34699 SRR7168891.se.tsv 87100 total ==> SRR7168891.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.45 744 29.4651 Potri.005G024800.1.v4.1 1035 802.449 315 27.7572 Potri.004G059700.1.v4.1 961 728.481 10 0.970654 Potri.007G009000.2.v4.1 1416 1183.45 0 0 Potri.003G141000.2.v4.1 2943 2710.45 1072.44 27.9778 Potri.016G087400.1.v4.1 270 86.9442 703 571.739 Potri.015G069301.1.v4.1 564 336.571 0 0 Potri.010G195200.1.v4.1 1773 1540.45 86 3.94761 Potri.012G127500.1.v4.1 977 744.465 124 11.7777 ==> SRR7168891.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 683 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 206 Potri.001G212900.v4.1 40 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168891 completed mapping pipeline successfully