Starting /dee2/code/volunteer_pipeline.sh SRR7168892 current disk space = 3090862727168 free memory = 1576722188 SRR7168892 SRAfilesize 4061f06699b5b7933b598b1ee033f41b SRR7168892.sra SRR7168892.sra file validated SRR7168892 is paired end SRR7168892 is conventional basespace SRR7168892 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168892_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12525 34.0 33.0 34.0 32.0 34.0 2 33.22525 34.0 33.0 34.0 32.0 34.0 3 33.24775 34.0 33.0 34.0 32.0 34.0 4 33.32875 34.0 33.0 34.0 33.0 34.0 5 33.356 34.0 33.0 34.0 33.0 34.0 6 37.0665 38.0 38.0 38.0 36.0 38.0 7 37.422 38.0 38.0 38.0 37.0 38.0 8 37.4765 38.0 38.0 38.0 37.0 38.0 9 37.564 38.0 38.0 38.0 38.0 38.0 10-14 37.52175 38.0 38.0 38.0 38.0 38.0 15-19 37.5293 38.0 38.0 38.0 38.0 38.0 20-24 37.51369999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.4683 38.0 38.0 38.0 38.0 38.0 30-34 37.4591 38.0 38.0 38.0 37.6 38.0 35-39 37.44465 38.0 38.0 38.0 37.2 38.0 40-44 37.442600000000006 38.0 38.0 38.0 37.2 38.0 45-49 37.357150000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.30655 38.0 38.0 38.0 37.0 38.0 55-59 37.256899999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.208600000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.125550000000004 38.0 38.0 38.0 36.4 38.0 70-74 37.07425 38.0 38.0 38.0 36.0 38.0 75-79 37.0109 38.0 38.0 38.0 36.0 38.0 80-84 36.921749999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.89925 38.0 38.0 38.0 35.8 38.0 90-94 36.713699999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.75115 38.0 38.0 38.0 35.0 38.0 100-104 36.58815 38.0 38.0 38.0 34.6 38.0 105-109 36.5018 38.0 38.0 38.0 34.0 38.0 110-114 36.27354999999999 38.0 37.4 38.0 34.0 38.0 115-119 36.04255 38.0 37.0 38.0 33.0 38.0 120-124 35.8608 38.0 37.0 38.0 32.6 38.0 125-129 35.56045 38.0 36.6 38.0 31.0 38.0 130-134 35.159749999999995 38.0 35.6 38.0 29.4 38.0 135-139 34.659800000000004 38.0 35.0 38.0 28.0 38.0 140-144 34.2733 38.0 33.8 38.0 26.4 38.0 145-149 33.3 38.0 33.0 38.0 20.4 38.0 150-151 28.253124999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 0.0 16 3.0 17 5.0 18 3.0 19 4.0 20 4.0 21 3.0 22 9.0 23 4.0 24 8.0 25 15.0 26 13.0 27 18.0 28 24.0 29 29.0 30 34.0 31 45.0 32 64.0 33 86.0 34 138.0 35 254.0 36 678.0 37 2553.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.45833333333333 12.65625 11.328125 39.557291666666664 2 20.65 19.025 35.35 24.975 3 19.175 23.7 25.75 31.374999999999996 4 22.5 32.45 22.8 22.25 5 21.525 34.875 24.025 19.575 6 17.349999999999998 36.825 26.55 19.275000000000002 7 13.450000000000001 24.05 43.675000000000004 18.825 8 17.875 24.55 31.724999999999998 25.85 9 18.025 24.25 33.825 23.9 10-14 19.945 29.45 27.05 23.555 15-19 19.625 28.915000000000003 27.825 23.635 20-24 19.3 28.865000000000002 27.875 23.96 25-29 19.869999999999997 28.634999999999998 27.800000000000004 23.695 30-34 19.455 28.854999999999997 28.139999999999997 23.549999999999997 35-39 19.79 28.4 27.810000000000002 24.0 40-44 19.975 28.725 28.294999999999998 23.005 45-49 19.994999999999997 28.42 28.060000000000002 23.525 50-54 19.925 28.1 28.265 23.71 55-59 19.64 29.080000000000002 28.055000000000003 23.225 60-64 20.13 28.299999999999997 27.91 23.66 65-69 19.7 28.689999999999998 27.834999999999997 23.775 70-74 19.63 28.610000000000003 27.950000000000003 23.810000000000002 75-79 19.16 28.655 28.075 24.11 80-84 20.36 28.685 27.46 23.494999999999997 85-89 20.005 28.884999999999998 27.61 23.5 90-94 19.994999999999997 28.33 28.09 23.585 95-99 19.98 29.065 27.57 23.385 100-104 20.369999999999997 27.800000000000004 28.215 23.615 105-109 20.01 28.43 27.529999999999998 24.03 110-114 20.18 28.185 28.015 23.62 115-119 20.5 28.575 27.48 23.445 120-124 20.78 28.595 27.255000000000003 23.369999999999997 125-129 20.59 28.499999999999996 26.915 23.995 130-134 20.865000000000002 28.754999999999995 26.939999999999998 23.44 135-139 20.735 28.105000000000004 27.495000000000005 23.665 140-144 20.785 28.799999999999997 26.86 23.555 145-149 20.845 29.32 26.064999999999998 23.77 150-151 20.375 28.9125 26.3625 24.349999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 2.0 22 2.5 23 2.5 24 2.5 25 3.0 26 3.5 27 5.5 28 10.5 29 15.5 30 19.0 31 22.5 32 33.0 33 53.5 34 70.5 35 91.0 36 98.0 37 114.5 38 154.5 39 180.5 40 204.5 41 230.0 42 241.0 43 234.5 44 245.0 45 279.5 46 281.5 47 248.5 48 223.0 49 204.5 50 159.0 51 109.0 52 94.5 53 85.5 54 68.5 55 55.0 56 45.0 57 31.5 58 20.5 59 16.5 60 10.0 61 5.5 62 4.5 63 3.0 64 2.5 65 2.0 66 2.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.0 0.0 112-113 3.325 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.1375 0.0 0.0 0.0 0.0 118-119 4.6625 0.0 0.0 0.0 0.0 120-121 5.0375 0.0 0.0 0.0 0.0 122-123 5.3625 0.0 0.0 0.0 0.0 124-125 5.8125 0.0 0.0 0.0 0.0 126-127 6.425 0.0 0.0 0.0 0.0 128-129 6.925 0.0 0.0 0.0 0.0 130-131 7.3875 0.0 0.0 0.0 0.0 132-133 8.025 0.0 0.0 0.0 0.0 134-135 8.787500000000001 0.0 0.0 0.0 0.0 136-137 9.375 0.0 0.0 0.0 0.0 138-139 10.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGAT 10 0.005853838 152.57895 1 CCAAGTT 10 0.0068378756 144.95 3 AGTTATA 10 0.0068378756 144.95 6 GGGGGGG 40 0.0076702754 18.11875 95-99 AAAAAAA 85 1.15353505E-5 15.347648 135-139 >>END_MODULE SRR7168892 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168892_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9955 33.0 33.0 34.0 32.0 34.0 2 33.08975 34.0 33.0 34.0 33.0 34.0 3 33.1365 34.0 33.0 34.0 33.0 34.0 4 33.1515 34.0 33.0 34.0 33.0 34.0 5 33.13675 34.0 33.0 34.0 33.0 34.0 6 37.3265 38.0 38.0 38.0 37.0 38.0 7 37.396 38.0 38.0 38.0 37.0 38.0 8 37.3225 38.0 38.0 38.0 38.0 38.0 9 37.35425 38.0 38.0 38.0 37.0 38.0 10-14 37.3253 38.0 38.0 38.0 37.2 38.0 15-19 37.25865 38.0 38.0 38.0 37.0 38.0 20-24 37.1896 38.0 38.0 38.0 37.0 38.0 25-29 37.228249999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.2599 38.0 38.0 38.0 37.0 38.0 35-39 37.27565 38.0 38.0 38.0 37.0 38.0 40-44 37.2555 38.0 38.0 38.0 37.0 38.0 45-49 37.1953 38.0 38.0 38.0 37.0 38.0 50-54 37.099599999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.07455 38.0 38.0 38.0 36.8 38.0 60-64 37.096349999999994 38.0 38.0 38.0 36.8 38.0 65-69 37.0164 38.0 38.0 38.0 36.4 38.0 70-74 36.953050000000005 38.0 38.0 38.0 36.2 38.0 75-79 36.942699999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.760749999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.70025 38.0 38.0 38.0 35.4 38.0 90-94 36.64645 38.0 38.0 38.0 35.0 38.0 95-99 36.627050000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.4012 38.0 38.0 38.0 34.2 38.0 105-109 36.34095 38.0 38.0 38.0 34.0 38.0 110-114 36.11365000000001 38.0 38.0 38.0 33.8 38.0 115-119 35.89245 38.0 37.6 38.0 33.0 38.0 120-124 35.86925 38.0 37.8 38.0 33.0 38.0 125-129 35.5295 38.0 36.8 38.0 31.0 38.0 130-134 35.27675 38.0 36.0 38.0 30.4 38.0 135-139 34.75085 38.0 36.0 38.0 28.8 38.0 140-144 34.1527 38.0 34.8 38.0 25.4 38.0 145-149 33.054950000000005 38.0 33.0 38.0 14.2 38.0 150-151 27.9575 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 2.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 2.0 14 4.0 15 6.0 16 1.0 17 4.0 18 4.0 19 7.0 20 6.0 21 6.0 22 6.0 23 8.0 24 15.0 25 19.0 26 19.0 27 19.0 28 24.0 29 29.0 30 38.0 31 46.0 32 67.0 33 80.0 34 134.0 35 223.0 36 549.0 37 2670.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.525 17.5 16.85 28.125 2 25.05 26.025 33.7 15.225 3 21.5 28.749999999999996 29.45 20.3 4 24.25 34.875 22.45 18.425 5 24.525 36.199999999999996 22.375 16.900000000000002 6 19.475 38.5 24.075 17.95 7 19.325 18.9 41.85 19.925 8 21.15 23.974999999999998 29.549999999999997 25.324999999999996 9 21.8 24.525 31.85 21.825 10-14 23.855 28.21 26.88 21.055 15-19 23.395 27.900000000000002 28.12 20.585 20-24 22.225 28.720000000000002 28.615000000000002 20.44 25-29 23.585 27.634999999999998 28.155 20.625 30-34 22.74 28.299999999999997 28.52 20.44 35-39 22.96 28.060000000000002 28.499999999999996 20.48 40-44 23.03 28.16 28.23 20.580000000000002 45-49 22.875 27.67 28.655 20.8 50-54 23.015 28.46 28.189999999999998 20.335 55-59 23.044999999999998 28.605000000000004 27.939999999999998 20.41 60-64 22.62 28.294999999999998 28.26 20.825 65-69 22.99 28.084999999999997 28.26 20.665 70-74 23.44 27.96 28.32 20.28 75-79 22.615 28.4 28.43 20.555 80-84 23.775 28.09 27.72 20.415 85-89 23.919999999999998 27.79 28.305000000000003 19.985 90-94 23.78 28.12 27.595 20.505000000000003 95-99 23.56 28.395 28.005000000000003 20.04 100-104 23.385 28.985 27.85 19.78 105-109 24.255 27.994999999999997 27.639999999999997 20.11 110-114 24.02 28.01 28.185 19.785 115-119 24.26 27.589999999999996 28.405 19.744999999999997 120-124 24.125 27.38 28.189999999999998 20.305 125-129 24.610000000000003 28.244999999999997 27.54 19.605 130-134 24.654999999999998 28.27 27.634999999999998 19.439999999999998 135-139 24.779999999999998 28.725 27.365000000000002 19.13 140-144 25.674999999999997 28.255000000000003 27.034999999999997 19.035 145-149 25.424999999999997 28.720000000000002 26.979999999999997 18.875 150-151 26.025 28.8875 26.625 18.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 2.5 24 3.5 25 3.5 26 4.5 27 6.5 28 8.5 29 12.5 30 19.5 31 25.0 32 34.5 33 51.5 34 58.5 35 70.5 36 95.0 37 120.0 38 140.5 39 160.5 40 181.0 41 234.5 42 285.5 43 284.0 44 292.0 45 287.5 46 252.5 47 225.5 48 209.0 49 188.0 50 150.5 51 118.0 52 104.0 53 80.5 54 63.0 55 63.0 56 49.0 57 28.0 58 19.5 59 18.0 60 13.5 61 9.0 62 5.0 63 4.5 64 5.5 65 3.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01515151515152 98.02499999999999 2 0.9595959595959596 1.9 3 0.025252525252525252 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.8375 0.0 0.0 0.0 0.0 112-113 3.2750000000000004 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.1125 0.0 0.0 0.0 0.0 118-119 4.6625 0.0 0.0 0.0 0.0 120-121 5.0375 0.0 0.0 0.0 0.0 122-123 5.3625 0.0 0.0 0.0 0.0 124-125 5.800000000000001 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 6.925 0.0 0.0 0.0 0.0 130-131 7.375 0.0 0.0 0.0 0.0 132-133 7.9875 0.0 0.0 0.0 0.0 134-135 8.725 0.0 0.0 0.0 0.0 136-137 9.325 0.0 0.0 0.0 0.0 138-139 10.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 155 0.0030531995 8.419354 10-14 >>END_MODULE Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724343 spots for SRR7168892.sra Written 724343 spots for SRR7168892.sra Read 724351 spots for SRR7168892.sra Written 724351 spots for SRR7168892.sra SRR ids: ['SRR7168892.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0nfpngbd SRR7168892.sra spots: 14486868 blocks: [[1, 724343], [724344, 1448686], [1448687, 2173029], [2173030, 2897372], [2897373, 3621715], [3621716, 4346058], [4346059, 5070401], [5070402, 5794744], [5794745, 6519087], [6519088, 7243430], [7243431, 7967773], [7967774, 8692116], [8692117, 9416459], [9416460, 10140802], [10140803, 10865145], [10865146, 11589488], [11589489, 12313831], [12313832, 13038174], [13038175, 13762517], [13762518, 14486868]] SRR7168892 file size 4887423 SRR7168892 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168892 SRR7168892_1.fastq SRR7168892_2.fastq Input file: SRR7168892_1.fastq Paired file: SRR7168892_2.fastq trimmed: SRR7168892-trimmed-pair1.fastq, SRR7168892-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sun Feb 16 02:26:59 2025 >> started Sun Feb 16 02:27:15 2025 >> done (15.838s) 14486868 read pairs processed; of these: 12230 ( 0.08%) short read pairs filtered out after trimming by size control 16014 ( 0.11%) empty read pairs filtered out after trimming by size control 14458624 (99.81%) read pairs available; of these: 7507670 (51.93%) trimmed read pairs available after processing 6950954 (48.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 3 0.00% 21 3 0.00% 22 6 0.00% 23 6 0.00% 24 4 0.00% 25 2 0.00% 26 5 0.00% 27 7 0.00% 28 4 0.00% 29 10 0.00% 30 14 0.00% 31 12 0.00% 32 9 0.00% 33 14 0.00% 34 19 0.00% 35 17 0.00% 36 16 0.00% 37 19 0.00% 38 22 0.00% 39 33 0.00% 40 41 0.00% 41 38 0.00% 42 45 0.00% 43 50 0.00% 44 61 0.00% 45 48 0.00% 46 90 0.00% 47 83 0.00% 48 90 0.00% 49 117 0.00% 50 145 0.00% 51 141 0.00% 52 171 0.00% 53 186 0.00% 54 213 0.00% 55 264 0.00% 56 249 0.00% 57 319 0.00% 58 329 0.00% 59 363 0.00% 60 460 0.00% 61 524 0.00% 62 538 0.00% 63 705 0.00% 64 717 0.00% 65 781 0.01% 66 917 0.01% 67 1072 0.01% 68 1335 0.01% 69 2437 0.02% 70 2265 0.02% 71 1827 0.01% 72 1933 0.01% 73 2277 0.02% 74 2401 0.02% 75 2717 0.02% 76 2942 0.02% 77 3192 0.02% 78 3553 0.02% 79 4030 0.03% 80 4657 0.03% 81 5082 0.04% 82 5534 0.04% 83 6407 0.04% 84 7503 0.05% 85 8055 0.06% 86 8521 0.06% 87 9413 0.07% 88 10256 0.07% 89 10917 0.08% 90 11765 0.08% 91 12481 0.09% 92 13483 0.09% 93 14813 0.10% 94 15587 0.11% 95 16511 0.11% 96 17376 0.12% 97 18306 0.13% 98 19250 0.13% 99 20208 0.14% 100 21096 0.15% 101 22043 0.15% 102 23194 0.16% 103 24588 0.17% 104 25558 0.18% 105 26604 0.18% 106 27802 0.19% 107 28404 0.20% 108 29860 0.21% 109 30839 0.21% 110 31587 0.22% 111 32521 0.22% 112 34021 0.24% 113 35312 0.24% 114 36312 0.25% 115 37814 0.26% 116 38595 0.27% 117 39531 0.27% 118 41258 0.29% 119 41565 0.29% 120 42379 0.29% 121 43599 0.30% 122 44539 0.31% 123 46740 0.32% 124 48388 0.33% 125 49649 0.34% 126 51120 0.35% 127 52157 0.36% 128 53394 0.37% 129 55294 0.38% 130 56984 0.39% 131 58425 0.40% 132 60171 0.42% 133 62210 0.43% 134 65112 0.45% 135 68513 0.47% 136 70064 0.48% 137 73561 0.51% 138 76821 0.53% 139 81536 0.56% 140 85899 0.59% 141 91848 0.64% 142 99017 0.68% 143 108780 0.75% 144 123605 0.85% 145 144799 1.00% 146 176119 1.22% 147 231519 1.60% 148 347242 2.40% 149 667068 4.61% 150 3366591 23.28% 151 6950954 48.07% 14458624 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=26 prefix-density=0.33 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=291.01 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=17.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.27 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=42.66 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.6 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7168892 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 16 02:28:58 Started mapping on | Feb 16 02:28:58 Finished on | Feb 16 02:30:35 Mapping speed, Million of reads per hour | 536.61 Number of input reads | 14458624 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13479878 Uniquely mapped reads % | 93.23% Average mapped length | 290.42 Number of splices: Total | 12605720 Number of splices: Annotated (sjdb) | 12284527 Number of splices: GT/AG | 12368952 Number of splices: GC/AG | 190710 Number of splices: AT/AC | 7685 Number of splices: Non-canonical | 38373 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394957 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 141597 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 594614 594614 594614 N_multimapping 394957 394957 394957 N_noFeature 653911 13130945 887086 N_ambiguous 207528 1921 90229 UnstrandedReadsAssigned:12618439 PositiveStrandReadsAssigned:347012 NegativeStrandReadsAssigned:12502563 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168892 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168892-trimmed-pair1.fastq SRR7168892-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,458,624 reads, 12,548,397 reads pseudoaligned [quant] estimated average fragment length: 231.18 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR7168892.ke.tsv 34699 SRR7168892.se.tsv 87100 total ==> SRR7168892.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.82 803 36.5325 Potri.005G024800.1.v4.1 1035 804.82 260 26.2762 Potri.004G059700.1.v4.1 961 730.899 13 1.44668 Potri.007G009000.2.v4.1 1416 1185.82 0 0 Potri.003G141000.2.v4.1 2943 2712.82 943 28.2734 Potri.016G087400.1.v4.1 270 89.861 641 580.196 Potri.015G069301.1.v4.1 564 339.422 0 0 Potri.010G195200.1.v4.1 1773 1542.82 107 5.641 Potri.012G127500.1.v4.1 977 746.842 35 3.81178 ==> SRR7168892.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 896 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 199 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7168892 completed mapping pipeline successfully