Starting /dee2/code/volunteer_pipeline.sh SRR7168893 current disk space = 2796537421824 free memory = 1561737464 SRR7168893_1.fastq is conventional basespace SRR7168893_1.fastq read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168893_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 17150866 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 1.7150866E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.34922967938486 12.246082787051366 13.00159448335377 38.403093050209996 2 22.27491019986979 17.53410585797825 33.54448107751527 26.64650286463669 3 20.380183717836754 22.797950843998198 24.981129232774602 31.840736205390446 4 22.756127882988533 31.05478172355845 21.691796787404204 24.497293606048814 5 22.442880311267725 34.56679367286012 23.544742490077645 19.4455835257945 6 18.767472149802813 35.74681884868088 25.40393587122656 20.081773130289747 7 14.1608417907294 24.732366284011547 42.941376837764345 18.165415087494708 8 18.23004327420199 24.780751545394768 30.711611010998197 26.27759416940505 9 17.853133888781606 24.27237932247252 33.17984223739116 24.69464455135471 10-14 19.9088929699384 29.42846629405468 26.887603080366375 23.775037655640542 15-19 19.88555817728307 28.30478126150015 27.873232126840875 23.93642843437591 20-24 19.926759383462038 28.488392364560482 27.835872544278523 23.748975707698957 25-29 19.905108483190027 28.543296235527787 27.72975146219886 23.821843819083327 30-34 19.80164036324495 28.458060882129647 27.83948790252515 23.90081085210025 35-39 20.03547622692583 28.40690792889194 27.664480094812237 23.89313574936999 40-44 20.053935468914514 28.55941268505042 27.70326233089338 23.683389515141684 45-49 20.25130509444829 28.309757653053786 27.624933924619317 23.814003327878606 50-54 20.130185846009173 28.325015191652714 27.663082435604124 23.881716526733985 55-59 20.15585801906446 28.230148844962116 27.783608128009398 23.83038500796403 60-64 20.206530678975625 28.22582486505346 27.752191638602973 23.815452817367937 65-69 20.118093162176184 28.438382061873728 27.627676643266874 23.81584813268321 70-74 20.18627864039052 28.513689046372352 27.541172556534466 23.758859756702662 75-79 20.176419079946168 28.3040156689464 27.686575126876978 23.83299012423046 80-84 20.248483079513303 28.315383024973784 27.547323849419612 23.8888100460933 85-89 20.342406033607865 28.284712853566695 27.541837246002622 23.831043866822817 90-94 20.40250095826065 28.14494848248479 27.574225114930055 23.878325444324503 95-99 20.434167236035396 28.10957683547381 27.626903826627807 23.829352101862984 100-104 20.54094294713748 28.301545822817342 27.390762658865153 23.76674857118002 105-109 20.58764379594593 28.187966718415268 27.422944124220898 23.8014453614179 110-114 20.67299225590125 28.1819996727862 27.360823645873044 23.78418442543951 115-119 20.793495791990914 28.269021517630655 27.16317998169888 23.77430270867955 120-124 20.76977570695264 28.237087270112195 26.998418622126717 23.99471840080845 125-129 20.839245085350207 28.161436279660744 26.936150046300867 24.063168588688175 130-134 20.926336951518188 28.19593064256526 26.804319199060807 24.073413206855747 135-139 20.980537892458987 28.177536190351503 26.651297482193282 24.190628434996228 140-144 20.964486687084687 28.058350879582513 26.604257371523676 24.37290506180913 145-149 20.896461342452593 28.1481594724875 26.496334972154408 24.459044212905496 150-151 20.82933053915822 28.20616032617153 26.33533520530597 24.629173929364278 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 434.0 1 356.0 2 243.0 3 218.5 4 222.0 5 228.5 6 243.0 7 272.0 8 283.5 9 300.0 10 344.5 11 397.0 12 501.5 13 579.0 14 661.0 15 791.0 16 957.0 17 1213.5 18 1600.0 19 2017.5 20 2628.5 21 3625.0 22 4922.0 23 6934.5 24 9966.0 25 13835.5 26 18445.5 27 25480.5 28 36369.0 29 51463.0 30 71906.5 31 99917.5 32 135718.5 33 180390.0 34 242314.5 35 321716.0 36 402080.5 37 490854.0 38 597373.5 39 709747.5 40 823499.5 41 932051.5 42 1016336.0 43 1077129.5 44 1113514.5 45 1110740.5 46 1081283.0 47 1037509.5 48 961976.5 49 852257.5 50 728541.0 51 597857.5 52 484594.5 53 404809.5 54 338162.0 55 271039.5 56 217952.0 57 172364.5 58 126783.5 59 97656.5 60 74411.0 61 52731.5 62 38578.0 63 26081.5 64 16318.5 65 12071.5 66 10119.5 67 9183.0 68 7526.5 69 5373.0 70 3945.5 71 2347.5 72 2172.0 73 2804.0 74 2004.0 75 735.0 76 552.0 77 251.5 78 120.0 79 89.5 80 35.5 81 3.0 82 4.5 83 3.5 84 0.5 85 0.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.5 91 1.0 92 0.5 93 0.5 94 0.5 95 0.5 96 1.0 97 0.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.11251909961864316 2 0.0 3 0.0 4 0.0 5 0.02905392648977608 6 0.0 7 0.0 8 0.0013527013737965185 9 1.982407185736277E-4 10-14 2.856998591208164E-4 15-19 1.8657949983400255E-5 20-24 0.0 25-29 0.0017013718141113108 30-34 0.005865593026031455 35-39 2.332243747925032E-6 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 1.166121873962516E-6 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 5.83060936981258E-6 135-139 5.947221557208832E-5 140-144 1.166121873962516E-5 145-149 2.332243747925032E-6 150-151 0.24175747160522387 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 1.7150866E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 45.21378714463502 #Duplication Level Percentage of deduplicated Percentage of total 1 68.66016552411219 31.043861093226166 2 15.894083964499936 14.372634584597135 3 5.802569543760006 7.870684327305204 4 2.938799312878353 5.31496986373126 5 1.6736613506225715 3.7836284029625653 6 1.0725919522379361 2.909756653292074 7 0.783375716237725 2.4793568021773944 8 0.5425451154828339 1.962441549424182 9 0.40372462946037124 1.6428527515321083 >10 2.020110155156584 16.118258461584347 >50 0.13099232317747306 4.087251251464349 >100 0.07249334490487681 5.998561773670506 >500 0.003558016576039817 1.1131656809615307 >1k 0.0012903574337959167 0.9624316599138587 >5k 2.579563958961015E-5 0.06731990714838647 >10k+ 1.2897819794805056E-5 0.27282523700884515 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCCATGATCTCGTATGC 46784 0.27277922875731175 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.001690876717245648 1.166121873962516E-5 0.0 0.0 0.0 2 0.0017491828109437739 1.749182810943774E-5 0.0 0.0 0.0 3 0.0017783358577928368 3.498365621887548E-5 0.0 5.83060936981258E-6 0.0 4 0.001842472560860775 3.498365621887548E-5 0.0 5.83060936981258E-6 0.0 5 0.001842472560860775 3.498365621887548E-5 0.0 5.83060936981258E-6 0.0 6 0.001859964388970213 3.498365621887548E-5 0.0 1.749182810943774E-5 0.0 7 0.0018949480451890884 4.081426558868806E-5 0.0 1.749182810943774E-5 0.0 8 0.0019007786545589009 4.081426558868806E-5 0.0 1.749182810943774E-5 0.0 9 0.001912439873298526 4.081426558868806E-5 0.0 1.749182810943774E-5 0.0 10-11 0.0019357623107777765 4.081426558868806E-5 0.0 1.749182810943774E-5 0.0 12-13 0.001970745966996652 4.372957027359435E-5 0.0 1.749182810943774E-5 0.0 14-15 0.002031967365379684 4.664487495850064E-5 0.0 1.749182810943774E-5 0.0 16-17 0.0020698663262834656 6.413670306793838E-5 0.0 3.498365621887548E-5 0.0 18-19 0.0021077652871872472 9.037444523209498E-5 0.0 4.081426558868806E-5 0.0 20-21 0.002171901990255186 9.328974991700128E-5 0.0 4.081426558868806E-5 0.0 22-23 0.002241869302692937 1.0495096865662643E-4 0.0 4.081426558868806E-5 0.0 24-25 0.0022885141776514376 1.1078157802643902E-4 0.0 4.956017964340693E-5 0.0 26-27 0.002343904966664657 1.136968827113453E-4 0.0 5.83060936981258E-5 0.0 28-29 0.002434279411896752 1.166121873962516E-4 0.0 6.705200775284467E-5 0.0 30-31 0.0025625528180326287 1.166121873962516E-4 0.0 8.162853117737612E-5 0.0 32-33 0.002664588482004349 1.166121873962516E-4 0.0 9.912035928681386E-5 0.0 34-35 0.0027782853647156944 1.2244279676606418E-4 0.0 1.0495096865662643E-4 0.0 36-37 0.0029123893802213835 1.2244279676606418E-4 0.0 1.0495096865662643E-4 0.0 38-39 0.0030581546144666984 1.2244279676606418E-4 0.0 1.1078157802643902E-4 0.0 40-41 0.0032855483798893883 1.2244279676606418E-4 0.0 1.136968827113453E-4 0.0 42-43 0.0036295543327083306 1.2827340613587676E-4 0.0 1.166121873962516E-4 0.0 44-45 0.00404644290264993 1.428499295604082E-4 0.0 1.166121873962516E-4 0.0 46-47 0.004509976347550031 1.6034175766984596E-4 0.0 1.428499295604082E-4 0.0 48-49 0.0050667995423671315 1.690876717245648E-4 5.83060936981258E-6 1.5451114830003336E-4 0.0 50-51 0.005856847111976737 1.982407185736277E-4 5.83060936981258E-6 1.6325706235475223E-4 0.0 52-53 0.0067955752205165615 2.1281724199815916E-4 5.83060936981258E-6 1.7491828109437738E-4 0.0 54-55 0.007935459352314921 2.273937654226906E-4 5.83060936981258E-6 1.8949480451890886E-4 0.0 56-57 0.009431010655671847 2.3905498416231576E-4 5.83060936981258E-6 1.953254138887214E-4 0.0 58-59 0.01146297802105153 2.448855935321283E-4 5.83060936981258E-6 1.982407185736277E-4 0.0 60-61 0.01410424406557663 2.6529272632647236E-4 5.83060936981258E-6 2.0407132794344029E-4 0.0 62-63 0.017605524992149083 2.798692497510038E-4 5.83060936981258E-6 2.0698663262834656E-4 0.0 64-65 0.02202804219915193 2.798692497510038E-4 5.83060936981258E-6 2.1281724199815916E-4 0.0 66-67 0.02741552525685875 2.856998591208164E-4 5.83060936981258E-6 2.3905498416231576E-4 0.0 68-69 0.03432188205540175 2.9736107786044157E-4 5.83060936981258E-6 2.7403864038119127E-4 0.0 70-71 0.04341763267230937 3.0319168723025417E-4 5.83060936981258E-6 2.798692497510038E-4 0.0 72-73 0.05576977862225732 3.2359882002459817E-4 5.83060936981258E-6 2.8861516380572266E-4 0.0 74-75 0.07227914905288164 3.2651412470950447E-4 5.83060936981258E-6 3.0027638254534787E-4 0.0 76-77 0.0927445879409238 3.2651412470950447E-4 5.83060936981258E-6 3.381753434491296E-4 0.0 78-79 0.11807567034807455 3.381753434491296E-4 5.83060936981258E-6 3.673283902981925E-4 0.0 80-81 0.15107400407652885 3.4983656218875477E-4 5.83060936981258E-6 3.8482021840763027E-4 0.0 82-83 0.19246258468814345 3.5858247624347367E-4 5.83060936981258E-6 3.964814371472554E-4 0.0 84-85 0.24473399768851323 3.7898960903781767E-4 5.83060936981258E-6 4.1397326525669317E-4 0.0 86-87 0.30980068295093666 3.964814371472554E-4 5.83060936981258E-6 4.1397326525669317E-4 0.0 88-89 0.38753145176459314 4.02312046517068E-4 5.83060936981258E-6 4.1397326525669317E-4 0.0 90-91 0.47918571575336194 4.256344839963183E-4 5.83060936981258E-6 4.198038746265057E-4 0.0 92-93 0.5864660128532284 4.314650933661309E-4 5.83060936981258E-6 4.3729570273594347E-4 0.0 94-95 0.7152874962698677 4.3438039805103717E-4 5.83060936981258E-6 4.489569214755686E-4 0.0 96-97 0.8682477024775308 4.43126312105756E-4 5.83060936981258E-6 4.518722261604749E-4 0.0 98-99 1.0408133326911888 4.5770283553028747E-4 5.83060936981258E-6 4.5770283553028747E-4 0.0 100-101 1.231450936646581 4.985171011189756E-4 5.83060936981258E-6 4.781099683246315E-4 0.0 102-103 1.4429329690990529 5.072630151736944E-4 5.83060936981258E-6 4.897711870642567E-4 0.0 104-105 1.682979156854237 5.189242339133195E-4 5.83060936981258E-6 5.014324058038818E-4 0.0 106-107 1.9527206381298763 5.364160620227573E-4 5.83060936981258E-6 5.072630151736944E-4 0.0 108-109 2.2436184855038808 5.568231948171014E-4 5.83060936981258E-6 5.160089292284133E-4 0.0 110-111 2.5558184642104953 5.684844135567266E-4 5.83060936981258E-6 5.189242339133196E-4 0.0 112-113 2.889390541562158 5.772303276114453E-4 5.83060936981258E-6 5.218395385982259E-4 0.0 114-115 3.25065218281106 6.005527650906957E-4 5.83060936981258E-6 5.364160620227573E-4 0.0 116-117 3.6446876793276797 6.267905072548524E-4 5.83060936981258E-6 5.480772807623824E-4 2.91530468490629E-6 118-119 4.062660742612064 6.471976400491963E-4 5.83060936981258E-6 5.626538041869139E-4 5.83060936981258E-6 120-121 4.497551318982961 6.471976400491963E-4 5.83060936981258E-6 5.684844135567266E-4 5.83060936981258E-6 122-123 4.954732314974649 6.530282494190089E-4 5.83060936981258E-6 5.743150229265391E-4 5.83060936981258E-6 124-125 5.44033461633949 6.617741634737278E-4 5.83060936981258E-6 5.801456322963517E-4 5.83060936981258E-6 126-127 5.955524344951444 7.025884290624159E-4 5.83060936981258E-6 6.151292885152272E-4 5.83060936981258E-6 128-129 6.497870136703301 7.142496478020411E-4 5.83060936981258E-6 6.23875202569946E-4 5.83060936981258E-6 130-131 7.053113236381183 7.259108665416661E-4 5.83060936981258E-6 6.23875202569946E-4 5.83060936981258E-6 132-133 7.627203780846985 7.288261712265724E-4 5.83060936981258E-6 6.23875202569946E-4 5.83060936981258E-6 134-135 8.220675270858044 7.34656780596385E-4 5.83060936981258E-6 6.267905072548524E-4 5.83060936981258E-6 136-137 8.845305537341378 7.34656780596385E-4 5.83060936981258E-6 6.384517259944775E-4 5.83060936981258E-6 138-139 9.498482467299318 7.608945227605417E-4 5.83060936981258E-6 6.559435541039153E-4 5.83060936981258E-6 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGGTT 5795 0.0 15.533982 1 CGCGTAT 1245 0.0 15.160676 1 GCCCGAT 5395 0.0 13.321659 1 CGATTCA 8455 0.0 11.836377 4 CGCGTCG 2505 0.0 11.053564 145 TCGGTTC 6875 0.0 10.758937 2 GTCCGAT 3445 0.0 10.325746 1 GTCCGGT 3275 0.0 9.975065 1 CCCGTCT 4775 0.0 9.426118 1 GGCGAAT 4410 0.0 9.383197 1 GCCGAAT 5510 0.0 9.354516 1 GTCCGTT 3820 0.0 9.312093 1 GGCGGAT 4845 0.0 9.289931 1 GTCCGCT 3445 0.0 9.272099 1 TATGCCG 27335 0.0 9.249896 145 CCGACAT 6920 0.0 9.231901 1 CCGGAAT 5555 0.0 9.148049 1 CGGGTAT 2635 0.0 9.091759 1 CCGATTC 8540 0.0 9.085923 3 GGTTCGG 6310 0.0 9.079271 4 >>END_MODULE SRR7168893 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168893_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 17150866 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 1.7150866E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.08731259966381 17.9254727153813 18.376544145640068 27.610670539314825 2 26.997579010334054 25.252876066530337 30.75411228988447 16.99543263325113 3 21.842931092659814 28.437083067365986 29.694894162210726 20.025091677763474 4 24.403981247688876 34.31226702013618 22.301740672401362 18.982011059773576 5 25.12412276511172 35.765899255826646 21.92489114288314 17.185086836178495 6 20.665102304040765 37.228829288490815 23.576639686526843 18.529428720941578 7 19.6578854954696 20.118558240483953 39.91629988491497 20.30725637913148 8 22.3409761364779 24.7596056070112 27.25860434667493 25.640813909835973 9 22.675819063056505 25.118579484096458 29.038565998008714 23.167035454838324 10-14 23.725815988524275 28.63656611120654 26.153636412634363 21.48398148763482 15-19 23.417325998048106 27.966238908875912 27.72662689089659 20.889808202179385 20-24 23.432454054484985 28.264624384054915 27.490149309649837 20.81277225181026 25-29 23.48465781644647 28.300953324888823 27.4405617716827 20.773827086982006 30-34 23.230415556866376 28.15112058887953 27.782754462436326 20.835709391817765 35-39 23.290702688577376 27.97045596163429 27.683708600757807 21.05513274903053 40-44 23.65827823735745 27.906708046698718 27.612538298208705 20.822475417735124 45-49 23.40595280461923 27.835886842483994 27.641915235160447 21.116245117736334 50-54 23.428649858929163 27.965177348069993 27.67890687585515 20.92726591714569 55-59 23.530209947661337 27.825045794579733 27.74478796280775 20.89995629495118 60-64 23.466687127071534 27.972423604527545 27.678708002474302 20.88218126592662 65-69 23.59908024743414 27.91894195693852 27.581382635722296 20.90059515990504 70-74 23.6587751596051 27.992792089466008 27.458125451008147 20.89030729992075 75-79 23.555937523552927 27.911064980447392 27.59508215308351 20.93791534291617 80-84 23.741644738005373 27.99157614269096 27.397119232706025 20.869659886597645 85-89 23.847024546689596 27.875456501334057 27.526224100057323 20.751294851919024 90-94 23.827515775468743 27.940954433178195 27.52111336137324 20.710416429979823 95-99 23.794533792130583 27.994211299133813 27.555305996984643 20.65594891175096 100-104 24.03897886478507 27.923471759725345 27.507263378302042 20.530285997187544 105-109 23.91240760871582 28.007399309078192 27.638848387084654 20.441344695121337 110-114 24.205641291332807 28.117530151341157 27.350016532714527 20.32681202461151 115-119 24.439720465777054 28.129743400105617 27.256405587901316 20.174130546216013 120-124 24.536755960786923 28.10437542878372 27.207025786488494 20.151842823940864 125-129 24.78623731566814 28.10967141266213 27.067587703880214 20.036503567789516 130-134 25.08679652700377 27.990411092615187 27.011840876774844 19.9109515036062 135-139 25.207329355831327 28.018041941070205 27.010686298029952 19.763942405068516 140-144 25.42598088777655 28.1115944481179 26.796699762388542 19.66572490171701 145-149 25.741408455137005 28.208945616469926 26.60322049514761 19.446425433245462 150-151 25.92067411157043 28.257009294279094 26.49213686407952 19.330179730070956 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 6464.0 1 4578.0 2 1924.0 3 984.0 4 750.0 5 652.5 6 609.0 7 625.5 8 643.5 9 633.5 10 654.0 11 685.5 12 703.0 13 765.0 14 876.5 15 943.0 16 1040.0 17 1229.0 18 1469.5 19 1751.0 20 2204.5 21 2838.0 22 3564.5 23 4726.0 24 6360.5 25 8668.0 26 12094.0 27 16797.5 28 23328.5 29 33393.0 30 47917.0 31 68005.0 32 96205.5 33 135148.0 34 190127.5 35 262432.5 36 348230.5 37 452749.0 38 573641.5 39 704179.0 40 836124.0 41 961588.5 42 1076130.0 43 1146642.0 44 1174539.0 45 1168327.0 46 1125591.5 47 1064088.5 48 980054.0 49 863613.5 50 725779.5 51 595535.5 52 489791.5 53 410265.5 54 352117.0 55 284301.0 56 210326.5 57 161662.5 58 125127.0 59 98593.0 60 76546.5 61 55309.5 62 44277.5 63 32491.0 64 18661.0 65 10655.5 66 7724.5 67 7037.5 68 6375.0 69 5448.0 70 4455.0 71 3301.5 72 2514.0 73 2293.5 74 1772.0 75 1076.0 76 846.0 77 729.5 78 611.5 79 302.5 80 144.5 81 72.0 82 61.0 83 55.5 84 54.0 85 43.0 86 30.0 87 31.5 88 34.5 89 29.5 90 32.0 91 27.5 92 20.0 93 24.5 94 27.5 95 21.0 96 15.5 97 19.5 98 22.0 99 29.5 100 53.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.03704186132641932 2 0.060375960024409266 3 0.08923164579561173 4 0.09526049588399793 5 0.10277615136168636 6 0.07767537802464318 7 0.08146527411502136 8 0.08724340800050563 9 0.07699319672837511 10-14 0.08588720826108723 15-19 0.09863875095286734 20-24 0.12510971749181643 25-29 0.10585354698707343 30-34 0.12627933773140085 35-39 0.1481417906244501 40-44 0.11150923807579163 45-49 0.09261339923010302 50-54 0.10237733768079116 55-59 0.10398308750123755 60-64 0.10078324907908441 65-69 0.12116356107032729 70-74 0.12514586726990928 75-79 0.11217392754395027 80-84 0.15036908340371852 85-89 0.12284744105632917 90-94 0.0977408371099162 95-99 0.06570513698841796 100-104 0.09209680723993761 105-109 0.0842826245625148 110-114 0.0882987482964417 115-119 0.1117587881568196 120-124 0.12594582687544756 125-129 0.12711078262753614 130-134 0.14816278081818143 135-139 0.1260729341597095 140-144 0.1016450131439427 145-149 0.10826741926617584 150-151 0.040108761854940736 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 1.7150866E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 46.33983659245441 #Duplication Level Percentage of deduplicated Percentage of total 1 68.73166871140613 31.850142968132722 2 16.235936941574998 15.047413295959592 3 5.9552064538720835 8.278898818402865 4 2.8382797524767036 5.261016797337696 5 1.6186232971608367 3.7503369547586476 6 1.0232356682329486 2.844994419689144 7 0.6879009335076569 2.2314051795379166 8 0.5047879621621618 1.8713433344346113 9 0.35287930657763616 1.4717132463299654 >10 1.855789992726542 15.325075367302993 >50 0.1258612810108614 4.0187401004003975 >100 0.06515758237554109 5.369176165128027 >500 0.0030965979019297487 0.9681113734626083 >1k 0.0014495303990841057 1.069951162790518 >5k 1.0079089190761743E-4 0.29753102804978093 >10k+ 2.5197722976904326E-5 0.34414978828245396 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 48724 0.28409061093474813 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.001720029764094711 2.332243747925032E-5 5.83060936981258E-6 5.83060936981258E-6 0.0 2 0.0017725052484230243 2.332243747925032E-5 5.83060936981258E-6 2.91530468490629E-5 0.0 3 0.001789997076532462 2.332243747925032E-5 5.83060936981258E-6 3.498365621887548E-5 0.0 4 0.0018133195140117124 2.332243747925032E-5 1.749182810943774E-5 3.498365621887548E-5 0.0 5 0.0018133195140117124 2.332243747925032E-5 5.83060936981258E-5 4.081426558868806E-5 0.0 6 0.0018249807327513374 2.332243747925032E-5 5.83060936981258E-5 4.081426558868806E-5 0.0 7 0.0018366419514909626 2.332243747925032E-5 5.83060936981258E-5 4.081426558868806E-5 0.0 8 0.001842472560860775 2.332243747925032E-5 5.83060936981258E-5 4.664487495850064E-5 0.0 9 0.0018541337796004003 2.91530468490629E-5 5.83060936981258E-5 5.2475484328313215E-5 0.0 10-11 0.0018657949983400255 2.91530468490629E-5 5.83060936981258E-5 5.2475484328313215E-5 0.0 12-13 0.0019095245686136198 3.498365621887548E-5 5.83060936981258E-5 6.705200775284467E-5 0.0 14-15 0.0019794918810513706 3.498365621887548E-5 5.83060936981258E-5 8.745914054718869E-5 0.0 16-17 0.0020057296232155273 3.498365621887548E-5 6.413670306793838E-5 8.745914054718869E-5 0.0 18-19 0.0020290520606947777 3.498365621887548E-5 6.413670306793838E-5 9.037444523209498E-5 0.0 20-21 0.002052374498174028 3.498365621887548E-5 6.705200775284467E-5 9.328974991700128E-5 0.0 22-23 0.0020844428497079973 4.664487495850064E-5 7.288261712265725E-5 9.620505460190757E-5 0.0 24-25 0.0021281724199815914 4.664487495850064E-5 7.579792180756354E-5 1.2827340613587676E-4 0.0 26-27 0.0021631560762004672 4.664487495850064E-5 8.162853117737612E-5 1.4868053893022078E-4 0.0 28-29 0.0022360386933231243 4.956017964340693E-5 8.162853117737612E-5 1.690876717245648E-4 0.0 30-31 0.002311836615130688 5.83060936981258E-5 8.162853117737612E-5 1.7783358577928368E-4 0.0 32-33 0.002384719232253345 6.413670306793838E-5 8.745914054718869E-5 1.982407185736277E-4 0.0 34-35 0.0024838395915401587 6.413670306793838E-5 9.037444523209498E-5 2.0407132794344029E-4 0.0 36-37 0.002626689521100567 6.413670306793838E-5 1.1661218739625161E-4 2.0407132794344029E-4 0.0 38-39 0.002760793536606257 6.413670306793838E-5 1.2244279676606418E-4 2.1573254668306546E-4 0.0 40-41 0.002976526083289322 6.413670306793838E-5 1.2535810145097046E-4 2.2156315605287804E-4 0.0 42-43 0.0033117861220535454 6.996731243775095E-5 1.2827340613587676E-4 2.2156315605287804E-4 0.0 44-45 0.0037053522545158948 7.579792180756354E-5 1.2827340613587676E-4 2.536315075868472E-4 0.0 46-47 0.0041455632619367445 8.162853117737612E-5 1.2827340613587676E-4 2.6237742164156606E-4 0.0 48-49 0.0047198782848632825 8.162853117737612E-5 1.3118871082078306E-4 2.8861516380572266E-4 0.0 50-51 0.005501179940418169 8.162853117737612E-5 1.3410401550568933E-4 3.090222966000667E-4 0.0 52-53 0.00641950091616365 8.162853117737612E-5 1.3410401550568933E-4 3.2359882002459817E-4 0.0 54-55 0.007571046266701634 8.162853117737612E-5 1.4868053893022078E-4 3.381753434491296E-4 0.0 56-57 0.009087004702852905 8.162853117737612E-5 1.661723670396585E-4 3.5566717155856737E-4 0.0 58-59 0.011104395544808058 8.162853117737612E-5 1.690876717245648E-4 3.5858247624347367E-4 0.0 60-61 0.013719423847169 8.162853117737612E-5 1.690876717245648E-4 3.8773552309253657E-4 0.0 62-63 0.01723236599248108 8.162853117737612E-5 1.7491828109437738E-4 4.02312046517068E-4 0.0 64-65 0.021582000582361264 8.162853117737612E-5 1.7491828109437738E-4 4.1105796057178687E-4 0.0 66-67 0.027019043819711493 8.745914054718869E-5 1.7491828109437738E-4 4.198038746265057E-4 0.0 68-69 0.03393414653230921 8.745914054718869E-5 1.8074889046418996E-4 4.256344839963183E-4 0.0 70-71 0.043053219586696084 8.745914054718869E-5 1.8657949983400256E-4 4.489569214755686E-4 0.0 72-73 0.055379127794479885 9.328974991700128E-5 1.8657949983400256E-4 4.810252730095378E-4 0.0 74-75 0.07189432883447401 9.328974991700128E-5 1.8949480451890886E-4 4.868558823793504E-4 0.0 76-77 0.09224315553511991 9.328974991700128E-5 1.982407185736277E-4 5.043477104887881E-4 0.0 78-79 0.11759172977038011 9.328974991700128E-5 2.0698663262834656E-4 5.276701479680385E-4 0.0 80-81 0.15064836959253253 1.0203566397172014E-4 2.0990193731325286E-4 5.364160620227573E-4 0.0 82-83 0.1921185787353245 1.0495096865662643E-4 2.1281724199815916E-4 5.422466713925699E-4 0.0 84-85 0.24437833051695465 1.0495096865662643E-4 2.2156315605287804E-4 5.53907890132195E-4 0.0 86-87 0.31003973793509904 1.0495096865662643E-4 2.623774216415661E-4 5.597384995020076E-4 0.0 88-89 0.3889074755758689 1.0495096865662643E-4 2.7403864038119127E-4 5.713997182416328E-4 0.0 90-91 0.4817395226573399 1.0495096865662643E-4 2.7403864038119127E-4 5.743150229265391E-4 0.0 92-93 0.5908302239665333 1.0786627334153273E-4 2.7403864038119127E-4 5.918068510359768E-4 0.0 94-95 0.7218440165062219 1.1078157802643902E-4 2.7403864038119127E-4 6.005527650906957E-4 0.0 96-97 0.8766379493606912 1.1078157802643902E-4 2.7403864038119127E-4 6.005527650906957E-4 0.0 98-99 1.0500402720189173 1.1078157802643902E-4 2.7403864038119127E-4 6.063833744605082E-4 0.0 100-101 1.2412201226457018 1.2244279676606418E-4 2.856998591208164E-4 6.180445932001334E-4 0.0 102-103 1.4538070555737534 1.2244279676606418E-4 2.856998591208164E-4 6.297058119397586E-4 0.0 104-105 1.6949173295389284 1.2535810145097046E-4 2.856998591208164E-4 6.413670306793838E-4 0.0 106-107 1.9656995745870791 1.2827340613587676E-4 2.9736107786044157E-4 6.588588587888215E-4 0.0 108-109 2.257445775624391 1.370193201905956E-4 2.9736107786044157E-4 6.763506868982592E-4 0.0 110-111 2.5714299207981686 1.399346248755019E-4 3.2068351533969187E-4 6.792659915831655E-4 0.0 112-113 2.907095186913594 1.457652342453145E-4 3.2068351533969187E-4 6.880119056378844E-4 0.0 114-115 3.2705112383246417 1.5451114830003336E-4 3.32344734079317E-4 6.938425150076969E-4 0.0 116-117 3.667750654689973 1.6325706235475223E-4 3.410906481340359E-4 6.996731243775095E-4 0.0 118-119 4.088586547174936 1.6325706235475223E-4 3.4983656218875477E-4 7.171649524869473E-4 0.0 120-121 4.526372021097943 1.6325706235475223E-4 3.5566717155856737E-4 7.200802571718536E-4 0.0 122-123 4.985689935423669 1.661723670396585E-4 3.5858247624347367E-4 7.229955618567598E-4 0.0 124-125 5.474364967926402 1.690876717245648E-4 3.614977809283799E-4 7.259108665416661E-4 0.0 126-127 5.990732479631058 1.720029764094711E-4 3.614977809283799E-4 7.288261712265724E-4 0.0 128-129 6.535602925240044 1.7491828109437738E-4 3.702436949830988E-4 7.404873899661976E-4 0.0 130-131 7.093245320673603 1.7491828109437738E-4 3.7898960903781767E-4 7.521486087058227E-4 0.0 132-133 7.670189948425929 1.7491828109437738E-4 3.7898960903781767E-4 7.608945227605417E-4 0.0 134-135 8.269451233541211 1.7491828109437738E-4 3.848202184076302E-4 7.638098274454479E-4 5.83060936981258E-6 136-137 8.899215351574666 1.7491828109437738E-4 3.906508277774428E-4 7.754710461850731E-4 5.83060936981258E-6 138-139 9.55771271258256 1.7783358577928366E-4 3.906508277774428E-4 7.929628742945108E-4 5.83060936981258E-6 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGTCGG 3275 0.0 30.990585 145 GCGGGAC 3040 0.0 18.118986 2 GCGCGGT 1530 0.0 14.211468 9 GAACACA 16850 0.0 12.73168 2 CTACCCG 4740 0.0 12.38531 8 TCTCGGG 6315 0.0 11.365143 145 CGGGACT 4750 0.0 11.290989 3 ACACATT 17885 0.0 11.184369 4 CATATAG 8740 0.0 11.028948 3 CGGTGGG 6860 0.0 10.9906225 145 AGAACAC 21045 0.0 10.88252 1 GTCTGAC 7060 0.0 10.470968 1 CACATTC 17065 0.0 10.448083 5 AACACAT 20645 0.0 10.250896 3 GCGACTT 4405 0.0 10.036338 1 ATTCATA 17765 0.0 9.995421 8 TTCATAC 17745 0.0 9.8435135 9 AGAGCGG 6210 0.0 9.455978 145 TCGCCGG 6410 0.0 9.3871355 145 TACCCGC 5890 0.0 9.352062 9 >>END_MODULE skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168893 SRR7168893_1.fastq SRR7168893_2.fastq Input file: SRR7168893_1.fastq Paired file: SRR7168893_2.fastq trimmed: SRR7168893-trimmed-pair1.fastq, SRR7168893-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Apr 15 04:23:05 2025 >> started Tue Apr 15 04:23:26 2025 >> done (20.908s) 17150866 read pairs processed; of these: 62 ( 0.00%) short read pairs filtered out after trimming by size control 51901 ( 0.30%) empty read pairs filtered out after trimming by size control 17098903 (99.70%) read pairs available; of these: 2519237 (14.73%) trimmed read pairs available after processing 14579666 (85.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 4 0.00% 23 4 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 7 0.00% 28 9 0.00% 29 7 0.00% 30 7 0.00% 31 4 0.00% 32 11 0.00% 33 10 0.00% 34 8 0.00% 35 13 0.00% 36 12 0.00% 37 10 0.00% 38 16 0.00% 39 21 0.00% 40 20 0.00% 41 33 0.00% 42 31 0.00% 43 35 0.00% 44 36 0.00% 45 37 0.00% 46 43 0.00% 47 45 0.00% 48 63 0.00% 49 65 0.00% 50 86 0.00% 51 79 0.00% 52 81 0.00% 53 108 0.00% 54 99 0.00% 55 141 0.00% 56 148 0.00% 57 185 0.00% 58 198 0.00% 59 228 0.00% 60 267 0.00% 61 318 0.00% 62 337 0.00% 63 405 0.00% 64 407 0.00% 65 483 0.00% 66 537 0.00% 67 603 0.00% 68 707 0.00% 69 805 0.00% 70 909 0.01% 71 1082 0.01% 72 1314 0.01% 73 1436 0.01% 74 1680 0.01% 75 1786 0.01% 76 2010 0.01% 77 2218 0.01% 78 2558 0.01% 79 2958 0.02% 80 3281 0.02% 81 3727 0.02% 82 4043 0.02% 83 4669 0.03% 84 5269 0.03% 85 5860 0.03% 86 6398 0.04% 87 6985 0.04% 88 7661 0.04% 89 8240 0.05% 90 8873 0.05% 91 9671 0.06% 92 10594 0.06% 93 11645 0.07% 94 12691 0.07% 95 13833 0.08% 96 14774 0.09% 97 15448 0.09% 98 16076 0.09% 99 16998 0.10% 100 17978 0.11% 101 18707 0.11% 102 20233 0.12% 103 21440 0.13% 104 22668 0.13% 105 24159 0.14% 106 25388 0.15% 107 25938 0.15% 108 26694 0.16% 109 28106 0.16% 110 28839 0.17% 111 29790 0.17% 112 31117 0.18% 113 32384 0.19% 114 33699 0.20% 115 35532 0.21% 116 36916 0.22% 117 37439 0.22% 118 38409 0.22% 119 38784 0.23% 120 40285 0.24% 121 41238 0.24% 122 41573 0.24% 123 44075 0.26% 124 45186 0.26% 125 46097 0.27% 126 47822 0.28% 127 49110 0.29% 128 49484 0.29% 129 49869 0.29% 130 51180 0.30% 131 51791 0.30% 132 52357 0.31% 133 53691 0.31% 134 55149 0.32% 135 56709 0.33% 136 57850 0.34% 137 59058 0.35% 138 59274 0.35% 139 60610 0.35% 140 60109 0.35% 141 61510 0.36% 142 62040 0.36% 143 62824 0.37% 144 64974 0.38% 145 65629 0.38% 146 66897 0.39% 147 67623 0.40% 148 69590 0.41% 149 70175 0.41% 150 69758 0.41% 151 14579666 85.27% 17098903 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=25 prefix-density=0.37 prefix-fanout=2.0 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=222.11 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=1.9 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=19.72 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.5 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7168893 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 15 04:24:17 Started mapping on | Apr 15 04:24:18 Finished on | Apr 15 04:27:08 Mapping speed, Million of reads per hour | 362.09 Number of input reads | 17098903 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15462870 Uniquely mapped reads % | 90.43% Average mapped length | 293.30 Number of splices: Total | 14571670 Number of splices: Annotated (sjdb) | 14174885 Number of splices: GT/AG | 14286073 Number of splices: GC/AG | 224114 Number of splices: AT/AC | 9065 Number of splices: Non-canonical | 52418 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 478254 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 219533 % of reads mapped to too many loci | 1.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.18% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1157779 1157779 1157779 N_multimapping 478254 478254 478254 N_noFeature 670022 15110140 854589 N_ambiguous 291309 1627 121932 UnstrandedReadsAssigned:14501539 PositiveStrandReadsAssigned:351103 NegativeStrandReadsAssigned:14486349 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7168893 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168893-trimmed-pair1.fastq SRR7168893-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,098,903 reads, 14,735,841 reads pseudoaligned [quant] estimated average fragment length: 224.871 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7168893.ke.tsv 34699 SRR7168893.se.tsv 87100 total ==> SRR7168893.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.13 980 33.9122 Potri.005G024800.1.v4.1 1035 811.129 256 19.5945 Potri.004G059700.1.v4.1 961 737.14 6 0.505342 Potri.007G009000.2.v4.1 1416 1192.13 0 0 Potri.003G141000.2.v4.1 2943 2719.13 750 17.1244 Potri.016G087400.1.v4.1 270 88.1071 895 630.661 Potri.015G069301.1.v4.1 564 343.355 0 0 Potri.010G195200.1.v4.1 1773 1549.13 224 8.97727 Potri.012G127500.1.v4.1 977 753.134 224 18.4654 ==> SRR7168893.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 817 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 39 Potri.001G416900.v4.1 16 Potri.001G452600.v4.1 8 SRR7168893 completed mapping pipeline successfully