Starting /dee2/code/volunteer_pipeline.sh SRR7168894 current disk space = 3059191320576 free memory = 1331338240 SRR7168894 SRAfilesize 1aedca7356d8cdc34e30b4ade45ef6ac SRR7168894.sra SRR7168894.sra file validated SRR7168894 is paired end SRR7168894 is conventional basespace SRR7168894 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168894_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.16875 34.0 33.0 34.0 32.0 34.0 2 33.151 34.0 33.0 34.0 32.0 34.0 3 33.1465 34.0 33.0 34.0 31.0 34.0 4 33.2365 34.0 33.0 34.0 33.0 34.0 5 33.309 34.0 33.0 34.0 33.0 34.0 6 36.94475 38.0 37.0 38.0 36.0 38.0 7 37.24375 38.0 38.0 38.0 36.0 38.0 8 37.412 38.0 38.0 38.0 37.0 38.0 9 37.47425 38.0 38.0 38.0 37.0 38.0 10-14 37.495050000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.497249999999994 38.0 38.0 38.0 37.4 38.0 20-24 37.4454 38.0 38.0 38.0 37.0 38.0 25-29 37.31105 38.0 38.0 38.0 37.0 38.0 30-34 37.38645 38.0 38.0 38.0 37.0 38.0 35-39 37.3546 38.0 38.0 38.0 37.0 38.0 40-44 37.2968 38.0 38.0 38.0 37.0 38.0 45-49 37.284349999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.22815 38.0 38.0 38.0 36.6 38.0 55-59 37.1621 38.0 38.0 38.0 36.0 38.0 60-64 37.101099999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.084199999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.9653 38.0 38.0 38.0 35.8 38.0 75-79 36.88205000000001 38.0 38.0 38.0 35.2 38.0 80-84 36.761300000000006 38.0 38.0 38.0 35.0 38.0 85-89 36.7507 38.0 38.0 38.0 35.0 38.0 90-94 36.6246 38.0 38.0 38.0 34.2 38.0 95-99 36.4338 38.0 38.0 38.0 34.0 38.0 100-104 36.33290000000001 38.0 37.8 38.0 34.0 38.0 105-109 36.122 38.0 37.0 38.0 33.4 38.0 110-114 35.9031 38.0 37.0 38.0 32.6 38.0 115-119 35.764250000000004 38.0 36.6 38.0 31.4 38.0 120-124 35.48 38.0 36.0 38.0 31.0 38.0 125-129 35.2461 38.0 36.0 38.0 29.4 38.0 130-134 34.8882 38.0 35.0 38.0 28.0 38.0 135-139 34.47295 38.0 34.8 38.0 25.8 38.0 140-144 33.88875 38.0 33.8 38.0 23.2 38.0 145-149 32.814049999999995 38.0 33.4 38.0 15.2 38.0 150-151 28.372875 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 2.0 17 1.0 18 3.0 19 4.0 20 0.0 21 5.0 22 4.0 23 4.0 24 7.0 25 10.0 26 21.0 27 22.0 28 36.0 29 33.0 30 48.0 31 82.0 32 76.0 33 146.0 34 149.0 35 258.0 36 743.0 37 2341.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.716142448661294 11.48947231609046 11.9833636599948 40.81102157525344 2 21.075 16.3 34.225 28.4 3 20.525 23.175 24.425 31.874999999999996 4 22.900000000000002 31.525 21.675 23.9 5 22.375 34.075 22.900000000000002 20.65 6 18.9 36.05 25.6 19.45 7 15.049999999999999 24.6 41.3 19.05 8 18.0 23.974999999999998 31.075000000000003 26.950000000000003 9 18.975 24.975 31.924999999999997 24.125 10-14 19.7 29.835 26.63 23.835 15-19 19.515 28.325 27.694999999999997 24.465 20-24 19.900000000000002 28.15 27.665 24.285 25-29 19.994999999999997 27.83 28.01 24.165 30-34 20.294999999999998 28.999999999999996 26.825 23.880000000000003 35-39 20.01 29.25 27.089999999999996 23.65 40-44 20.380000000000003 27.93 27.715 23.974999999999998 45-49 20.745 27.92 28.01 23.325000000000003 50-54 20.169999999999998 27.715 27.894999999999996 24.22 55-59 20.195 27.565 28.17 24.07 60-64 20.07 28.494999999999997 27.715 23.72 65-69 20.150000000000002 28.43 27.605 23.815 70-74 20.45 28.494999999999997 27.41 23.645 75-79 20.349999999999998 28.444999999999997 27.355 23.849999999999998 80-84 20.16 28.34 27.134999999999998 24.365000000000002 85-89 19.955000000000002 28.34 27.474999999999998 24.23 90-94 20.875 27.955000000000002 27.675 23.494999999999997 95-99 20.765 27.805000000000003 27.400000000000002 24.03 100-104 20.925 28.425 26.834999999999997 23.815 105-109 20.71 28.389999999999997 27.21 23.69 110-114 20.669999999999998 28.32 27.52 23.49 115-119 20.8 28.449999999999996 27.115000000000002 23.635 120-124 20.89 27.97 27.27 23.87 125-129 20.735 27.41 27.205000000000002 24.65 130-134 20.855 28.044999999999998 26.69 24.41 135-139 21.36 27.87 26.369999999999997 24.4 140-144 21.29 27.67 26.465 24.575 145-149 21.45 27.775 26.619999999999997 24.154999999999998 150-151 21.36762860727729 28.180677540777914 26.524466750313675 23.927227101631114 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.5 24 2.0 25 3.0 26 7.0 27 6.0 28 7.5 29 12.5 30 15.5 31 23.0 32 29.0 33 33.0 34 50.0 35 73.5 36 90.5 37 119.5 38 144.5 39 155.0 40 176.0 41 185.5 42 203.5 43 239.5 44 270.5 45 283.0 46 267.5 47 257.5 48 238.0 49 212.5 50 183.0 51 148.5 52 111.5 53 96.0 54 89.0 55 59.0 56 47.5 57 39.5 58 29.0 59 25.5 60 19.0 61 13.0 62 10.5 63 6.5 64 4.0 65 2.5 66 1.0 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8249999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7312153303076148 1.4500000000000002 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15000000000000002 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.1375 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.8499999999999996 0.0 0.0 0.0 0.0 110-111 3.0625 0.0 0.0 0.0 0.0 112-113 3.3499999999999996 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.0875 0.0 0.0 0.0 0.0 118-119 4.625 0.0 0.0 0.0 0.0 120-121 5.1875 0.0 0.0 0.0 0.0 122-123 5.637499999999999 0.0 0.0 0.0 0.0 124-125 6.1375 0.0 0.0 0.0 0.0 126-127 6.75 0.0 0.0 0.0 0.0 128-129 7.275 0.0 0.0 0.0 0.0 130-131 7.9625 0.0 0.0 0.0 0.0 132-133 8.587499999999999 0.0 0.0 0.0 0.0 134-135 9.125 0.0 0.0 0.0 0.0 136-137 9.7875 0.0 0.0 0.0 0.0 138-139 10.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGCA 10 0.006836113 144.9625 7 TATGTCC 10 0.006836113 144.9625 5 AGCAGTC 10 0.006836113 144.9625 3 CTATGTC 10 0.006836113 144.9625 4 AGTCAAC 10 0.006836113 144.9625 145 ACTATGT 10 0.006836113 144.9625 3 >>END_MODULE SRR7168894 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168894_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85925 33.0 33.0 34.0 32.0 34.0 2 32.98675 34.0 33.0 34.0 32.0 34.0 3 33.0255 34.0 33.0 34.0 32.0 34.0 4 32.935 34.0 33.0 34.0 32.0 34.0 5 33.01175 34.0 33.0 34.0 32.0 34.0 6 37.1625 38.0 38.0 38.0 37.0 38.0 7 37.1865 38.0 38.0 38.0 37.0 38.0 8 37.15075 38.0 38.0 38.0 37.0 38.0 9 37.095 38.0 38.0 38.0 37.0 38.0 10-14 37.11515 38.0 38.0 38.0 37.0 38.0 15-19 37.112449999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.08455 38.0 38.0 38.0 37.0 38.0 25-29 37.04355 38.0 38.0 38.0 37.0 38.0 30-34 37.02255 38.0 38.0 38.0 37.0 38.0 35-39 37.07025 38.0 38.0 38.0 37.0 38.0 40-44 37.0283 38.0 38.0 38.0 37.0 38.0 45-49 36.980599999999995 38.0 38.0 38.0 36.6 38.0 50-54 36.9074 38.0 38.0 38.0 36.6 38.0 55-59 36.8262 38.0 38.0 38.0 36.0 38.0 60-64 36.81445 38.0 38.0 38.0 36.0 38.0 65-69 36.81145 38.0 38.0 38.0 36.0 38.0 70-74 36.689949999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.5378 38.0 38.0 38.0 35.2 38.0 80-84 36.4075 38.0 38.0 38.0 34.4 38.0 85-89 36.2856 38.0 38.0 38.0 34.0 38.0 90-94 36.15665 38.0 38.0 38.0 33.8 38.0 95-99 36.030899999999995 38.0 38.0 38.0 33.6 38.0 100-104 35.96065 38.0 38.0 38.0 33.2 38.0 105-109 35.773849999999996 38.0 37.6 38.0 32.6 38.0 110-114 35.5787 38.0 37.0 38.0 31.0 38.0 115-119 35.3714 38.0 37.0 38.0 30.6 38.0 120-124 35.003 38.0 36.2 38.0 28.2 38.0 125-129 34.64275 38.0 35.6 38.0 27.4 38.0 130-134 34.216 38.0 35.0 38.0 23.8 38.0 135-139 33.559749999999994 38.0 33.8 38.0 21.0 38.0 140-144 32.84495 38.0 33.0 38.0 15.8 38.0 145-149 31.87625 38.0 32.2 38.0 10.2 38.0 150-151 27.099 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 2.0 5 2.0 6 0.0 7 1.0 8 0.0 9 1.0 10 4.0 11 1.0 12 4.0 13 2.0 14 4.0 15 2.0 16 6.0 17 9.0 18 8.0 19 6.0 20 12.0 21 7.0 22 12.0 23 16.0 24 11.0 25 12.0 26 23.0 27 31.0 28 31.0 29 25.0 30 43.0 31 56.0 32 79.0 33 106.0 34 144.0 35 277.0 36 727.0 37 2318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.83370842710677 19.079769942485623 17.779444861215303 28.307076769192296 2 25.594195646735052 26.494871153365025 32.24918689016762 15.6617463097323 3 20.72590738423029 28.986232790988737 29.987484355444305 20.30037546933667 4 23.335002503755632 33.475212819228844 22.8592889334001 20.330495743615423 5 25.131414267834796 35.59449311639549 22.62828535669587 16.64580725907384 6 20.94070552914686 36.5774330748061 23.492619464598448 18.989241931448586 7 18.263697773329998 19.864898674005506 40.63047285464098 21.240930698023515 8 21.877346683354194 25.381727158948685 27.55944931163955 25.18147684605757 9 22.66700025018764 24.518388791593697 29.92244183137353 22.892169126845133 10-14 23.524700935982782 28.685119375344108 26.047349717203062 21.742829971470044 15-19 23.395735308839726 28.466312944238663 27.28000800880969 20.857943738111924 20-24 23.49141168811658 27.547698933346688 27.63783864990736 21.323050728629376 25-29 22.8597176329228 28.52207870231301 27.69099829778712 20.92720536697707 30-34 23.118144939149595 27.214904592577753 28.346772174087242 21.320178294185403 35-39 23.72915310261932 27.590524365202583 27.66064005609255 21.019682476085542 40-44 23.915873810716075 27.86179268903355 27.366049073610416 20.85628442663996 45-49 23.395735308839726 27.965762338572432 27.670437481229353 20.968064871358493 50-54 23.58448060075094 28.370463078848562 27.359198998748436 20.685857321652065 55-59 23.237885462555067 27.392871445734883 28.298958750500603 21.07028434120945 60-64 23.542365246984637 27.666282968820376 27.70632100495471 21.085030779240277 65-69 23.44016024036054 27.57135703555333 27.74161241862794 21.246870305458188 70-74 23.983373397435898 27.549078525641026 27.744391025641026 20.72315705128205 75-79 23.598037252153013 27.758862407370316 27.73382735830162 20.909272982175047 80-84 23.686451289757073 27.628349611820685 27.698472326571498 20.98672677185074 85-89 24.099764611609157 28.316722592277255 26.854309610857918 20.72920318525567 90-94 23.837180193260902 28.122966004105542 27.271816952886397 20.76803684974716 95-99 24.325676825301507 27.783616073662614 27.308211980183156 20.582495120852727 100-104 23.879849812265334 27.639549436795996 27.644555694618273 20.8360450563204 105-109 23.967769380911864 27.966568239827836 27.571192633001353 20.494469746258943 110-114 23.917721835743958 27.756368550122616 27.601221160102096 20.72468845403133 115-119 24.243941518125375 28.029240937312238 27.158021229721612 20.568796314840775 120-124 25.013771345585656 27.582753267564726 27.44754369272372 19.955931694125894 125-129 24.911121125632167 27.66511441590306 26.98913424465475 20.434630213810024 130-134 25.482045374868534 27.520408674312613 26.789202183602946 20.208343767215904 135-139 25.38688836580358 27.755797065157513 27.269995492562728 19.587319076476188 140-144 25.80322290061055 27.985186668001198 26.443799419477532 19.76779101191072 145-149 25.78723404255319 28.155193992490613 26.72340425531915 19.334167709637047 150-151 25.887500000000003 28.9125 25.8125 19.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.5 27 3.0 28 5.5 29 10.5 30 15.0 31 14.5 32 19.0 33 32.0 34 48.5 35 65.0 36 82.5 37 113.0 38 138.0 39 152.5 40 178.0 41 209.5 42 242.5 43 266.0 44 269.0 45 267.5 46 263.0 47 263.0 48 238.0 49 205.5 50 180.0 51 138.5 52 117.0 53 96.5 54 81.5 55 67.0 56 49.0 57 38.0 58 29.5 59 30.5 60 21.5 61 12.0 62 9.0 63 5.5 64 3.5 65 2.0 66 1.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.075 3 0.125 4 0.15 5 0.125 6 0.075 7 0.075 8 0.125 9 0.075 10-14 0.105 15-19 0.11 20-24 0.155 25-29 0.13 30-34 0.165 35-39 0.165 40-44 0.15 45-49 0.11 50-54 0.125 55-59 0.12 60-64 0.095 65-69 0.15 70-74 0.16 75-79 0.13999999999999999 80-84 0.17500000000000002 85-89 0.165 90-94 0.135 95-99 0.08499999999999999 100-104 0.125 105-109 0.095 110-114 0.095 115-119 0.13999999999999999 120-124 0.155 125-129 0.145 130-134 0.165 135-139 0.165 140-144 0.09 145-149 0.125 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31818181818181 98.32499999999999 2 0.4797979797979798 0.95 3 0.12626262626262627 0.375 4 0.025252525252525252 0.1 5 0.050505050505050504 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15000000000000002 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 0.9874999999999999 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.8875000000000002 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.5999999999999996 0.0 0.0 0.0 0.0 116-117 4.0125 0.0 0.0 0.0 0.0 118-119 4.55 0.0 0.0 0.0 0.0 120-121 5.0875 0.0 0.0 0.0 0.0 122-123 5.5375 0.0 0.0 0.0 0.0 124-125 6.050000000000001 0.0 0.0 0.0 0.0 126-127 6.6625 0.0 0.0 0.0 0.0 128-129 7.2 0.0 0.0 0.0 0.0 130-131 7.925000000000001 0.0 0.0 0.0 0.0 132-133 8.537500000000001 0.0 0.0 0.0 0.0 134-135 9.1125 0.0 0.0 0.0 0.0 136-137 9.7125 0.0 0.0 0.0 0.0 138-139 10.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGCA 10 0.006830828 145.0 9 >>END_MODULE Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801757 spots for SRR7168894.sra Written 801757 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra Read 801756 spots for SRR7168894.sra Written 801756 spots for SRR7168894.sra SRR ids: ['SRR7168894.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__se51v98 SRR7168894.sra spots: 16035121 blocks: [[1, 801756], [801757, 1603512], [1603513, 2405268], [2405269, 3207024], [3207025, 4008780], [4008781, 4810536], [4810537, 5612292], [5612293, 6414048], [6414049, 7215804], [7215805, 8017560], [8017561, 8819316], [8819317, 9621072], [9621073, 10422828], [10422829, 11224584], [11224585, 12026340], [12026341, 12828096], [12828097, 13629852], [13629853, 14431608], [14431609, 15233364], [15233365, 16035121]] SRR7168894 file size 5412075 SRR7168894 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168894 SRR7168894_1.fastq SRR7168894_2.fastq Input file: SRR7168894_1.fastq Paired file: SRR7168894_2.fastq trimmed: SRR7168894-trimmed-pair1.fastq, SRR7168894-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:41:28 2025 >> started Mon Feb 10 10:41:45 2025 >> done (17.045s) 16035121 read pairs processed; of these: 19196 ( 0.12%) short read pairs filtered out after trimming by size control 53777 ( 0.34%) empty read pairs filtered out after trimming by size control 15962148 (99.54%) read pairs available; of these: 8852503 (55.46%) trimmed read pairs available after processing 7109645 (44.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 3 0.00% 20 4 0.00% 21 10 0.00% 22 3 0.00% 23 7 0.00% 24 5 0.00% 25 2 0.00% 26 8 0.00% 27 4 0.00% 28 6 0.00% 29 9 0.00% 30 10 0.00% 31 17 0.00% 32 17 0.00% 33 19 0.00% 34 12 0.00% 35 23 0.00% 36 23 0.00% 37 24 0.00% 38 28 0.00% 39 36 0.00% 40 46 0.00% 41 39 0.00% 42 63 0.00% 43 56 0.00% 44 72 0.00% 45 84 0.00% 46 97 0.00% 47 79 0.00% 48 115 0.00% 49 118 0.00% 50 161 0.00% 51 162 0.00% 52 176 0.00% 53 183 0.00% 54 210 0.00% 55 255 0.00% 56 256 0.00% 57 300 0.00% 58 332 0.00% 59 372 0.00% 60 477 0.00% 61 464 0.00% 62 591 0.00% 63 645 0.00% 64 745 0.00% 65 873 0.01% 66 927 0.01% 67 1026 0.01% 68 1292 0.01% 69 2650 0.02% 70 2157 0.01% 71 1787 0.01% 72 2038 0.01% 73 2229 0.01% 74 2405 0.02% 75 2724 0.02% 76 2971 0.02% 77 3257 0.02% 78 3565 0.02% 79 3978 0.02% 80 4539 0.03% 81 4951 0.03% 82 5785 0.04% 83 6571 0.04% 84 7629 0.05% 85 8585 0.05% 86 9328 0.06% 87 10110 0.06% 88 10700 0.07% 89 11352 0.07% 90 11967 0.07% 91 13118 0.08% 92 14190 0.09% 93 15467 0.10% 94 16754 0.10% 95 17785 0.11% 96 18680 0.12% 97 19488 0.12% 98 20651 0.13% 99 21298 0.13% 100 22370 0.14% 101 23261 0.15% 102 24965 0.16% 103 26348 0.17% 104 27868 0.17% 105 29477 0.18% 106 30465 0.19% 107 31909 0.20% 108 32821 0.21% 109 33569 0.21% 110 34559 0.22% 111 35448 0.22% 112 37192 0.23% 113 38842 0.24% 114 40596 0.25% 115 42399 0.27% 116 43966 0.28% 117 44779 0.28% 118 45884 0.29% 119 46805 0.29% 120 48465 0.30% 121 49632 0.31% 122 51162 0.32% 123 53422 0.33% 124 55206 0.35% 125 57694 0.36% 126 59481 0.37% 127 61808 0.39% 128 63444 0.40% 129 64483 0.40% 130 66684 0.42% 131 68337 0.43% 132 71296 0.45% 133 73693 0.46% 134 77007 0.48% 135 80522 0.50% 136 85069 0.53% 137 89413 0.56% 138 93766 0.59% 139 99280 0.62% 140 104379 0.65% 141 112104 0.70% 142 121326 0.76% 143 134842 0.84% 144 154275 0.97% 145 181446 1.14% 146 222389 1.39% 147 296613 1.86% 148 444276 2.78% 149 862530 5.40% 150 3865732 24.22% 151 7109645 44.54% 15962148 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=231.22 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=14.65 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.2 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7168894 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:42:47 Started mapping on | Feb 10 10:42:48 Finished on | Feb 10 10:44:42 Mapping speed, Million of reads per hour | 504.07 Number of input reads | 15962148 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14752849 Uniquely mapped reads % | 92.42% Average mapped length | 290.34 Number of splices: Total | 13790977 Number of splices: Annotated (sjdb) | 13470445 Number of splices: GT/AG | 13521790 Number of splices: GC/AG | 221056 Number of splices: AT/AC | 7876 Number of splices: Non-canonical | 40255 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455339 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 184574 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 767308 767308 767308 N_multimapping 455339 455339 455339 N_noFeature 564330 14447683 715114 N_ambiguous 260970 1554 105444 UnstrandedReadsAssigned:13927549 PositiveStrandReadsAssigned:303612 NegativeStrandReadsAssigned:13932291 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168894 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168894-trimmed-pair1.fastq SRR7168894-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,962,148 reads, 14,097,277 reads pseudoaligned [quant] estimated average fragment length: 223.442 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7168894.ke.tsv 34699 SRR7168894.se.tsv 87100 total ==> SRR7168894.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.56 499 18.291 Potri.005G024800.1.v4.1 1035 812.558 85 6.88494 Potri.004G059700.1.v4.1 961 738.574 10 0.891132 Potri.007G009000.2.v4.1 1416 1193.56 0 0 Potri.003G141000.2.v4.1 2943 2720.56 914.65 22.1275 Potri.016G087400.1.v4.1 270 89.1348 675 498.417 Potri.015G069301.1.v4.1 564 345.118 0 0 Potri.010G195200.1.v4.1 1773 1550.56 10 0.424471 Potri.012G127500.1.v4.1 977 754.574 54 4.71007 ==> SRR7168894.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 855 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 218 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 30 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR7168894 completed mapping pipeline successfully