Starting /dee2/code/volunteer_pipeline.sh SRR7168896 current disk space = 3059007070208 free memory = 1385557904 SRR7168896 SRAfilesize a79f02e51e10f05a3d9c6bb19a0f3488 SRR7168896.sra SRR7168896.sra file validated SRR7168896 is paired end SRR7168896 is conventional basespace SRR7168896 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168896_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09 34.0 33.0 34.0 32.0 34.0 2 33.1635 34.0 33.0 34.0 32.0 34.0 3 33.204 34.0 33.0 34.0 32.0 34.0 4 33.24875 34.0 33.0 34.0 32.0 34.0 5 33.266 34.0 33.0 34.0 33.0 34.0 6 37.00375 38.0 37.0 38.0 36.0 38.0 7 37.33175 38.0 38.0 38.0 37.0 38.0 8 37.3985 38.0 38.0 38.0 37.0 38.0 9 37.50275 38.0 38.0 38.0 37.0 38.0 10-14 37.46395 38.0 38.0 38.0 37.0 38.0 15-19 37.476549999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.439 38.0 38.0 38.0 37.2 38.0 25-29 37.40605 38.0 38.0 38.0 37.0 38.0 30-34 37.35365 38.0 38.0 38.0 37.0 38.0 35-39 37.34375 38.0 38.0 38.0 37.0 38.0 40-44 37.2792 38.0 38.0 38.0 37.0 38.0 45-49 37.202549999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.13005 38.0 38.0 38.0 36.2 38.0 55-59 37.0692 38.0 38.0 38.0 36.2 38.0 60-64 36.9063 38.0 38.0 38.0 35.6 38.0 65-69 36.91575 38.0 38.0 38.0 35.8 38.0 70-74 36.90905 38.0 38.0 38.0 35.8 38.0 75-79 36.83165 38.0 38.0 38.0 35.4 38.0 80-84 36.64765 38.0 38.0 38.0 34.8 38.0 85-89 36.408550000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.3521 38.0 38.0 38.0 34.0 38.0 95-99 36.085 38.0 37.6 38.0 33.2 38.0 100-104 36.015499999999996 38.0 37.4 38.0 33.0 38.0 105-109 35.947500000000005 38.0 37.4 38.0 32.4 38.0 110-114 35.71340000000001 38.0 37.0 38.0 31.2 38.0 115-119 35.482 38.0 37.0 38.0 30.6 38.0 120-124 35.1432 38.0 36.0 38.0 28.4 38.0 125-129 34.78575 38.0 36.0 38.0 27.0 38.0 130-134 34.332 38.0 35.2 38.0 24.4 38.0 135-139 33.69075 38.0 33.8 38.0 21.2 38.0 140-144 33.09304999999999 38.0 33.2 38.0 17.0 38.0 145-149 31.714 38.0 31.0 38.0 10.8 38.0 150-151 27.612625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 1.0 16 1.0 17 9.0 18 7.0 19 9.0 20 9.0 21 6.0 22 11.0 23 15.0 24 15.0 25 11.0 26 21.0 27 32.0 28 35.0 29 44.0 30 57.0 31 65.0 32 87.0 33 116.0 34 163.0 35 296.0 36 696.0 37 2290.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.164669098488794 11.959353830119854 11.907243355914538 39.96873371547681 2 22.075 16.275000000000002 35.675000000000004 25.974999999999998 3 19.575 23.775 25.45 31.2 4 23.5 32.75 21.4 22.35 5 21.65 36.625 22.675 19.05 6 18.9 35.949999999999996 24.575 20.575 7 15.125 24.925 43.55 16.400000000000002 8 18.375 25.1 29.575000000000003 26.950000000000003 9 17.25 24.775 33.925 24.05 10-14 20.5 29.555 26.66 23.285 15-19 19.925 28.705000000000002 27.715 23.655 20-24 20.025000000000002 28.065 28.63 23.28 25-29 20.02 29.03 27.35 23.599999999999998 30-34 20.5 28.955 27.200000000000003 23.345 35-39 20.215 29.25 27.105 23.43 40-44 19.735 28.725 27.755000000000003 23.785 45-49 19.845 29.175 27.589999999999996 23.39 50-54 20.424999999999997 28.735 27.63 23.21 55-59 19.96 29.244999999999997 27.229999999999997 23.565 60-64 20.645 28.33 27.51 23.515 65-69 20.365 28.9 27.18 23.555 70-74 20.8 28.560000000000002 27.515 23.125 75-79 20.455000000000002 28.67 27.384999999999998 23.49 80-84 20.549999999999997 28.9 26.82 23.73 85-89 20.285 29.125 27.465 23.125 90-94 20.1 28.26 27.73 23.91 95-99 20.355 28.235 28.28 23.13 100-104 20.41 28.615000000000002 27.584999999999997 23.39 105-109 20.49 28.92 27.615000000000002 22.975 110-114 21.05 28.804999999999996 27.284999999999997 22.86 115-119 20.599999999999998 29.205 27.229999999999997 22.965 120-124 20.674999999999997 28.68 26.935 23.71 125-129 20.875 28.754999999999995 27.18 23.189999999999998 130-134 21.255 28.71 26.415 23.62 135-139 21.21 28.499999999999996 26.619999999999997 23.669999999999998 140-144 21.37 27.255000000000003 27.095000000000002 24.279999999999998 145-149 21.07 28.555000000000003 25.990000000000002 24.385 150-151 21.2 27.85 27.1375 23.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 3.0 24 2.5 25 5.5 26 9.0 27 6.0 28 5.5 29 10.5 30 16.0 31 20.5 32 34.0 33 52.5 34 59.5 35 72.0 36 101.0 37 125.0 38 143.0 39 177.5 40 195.5 41 213.0 42 238.5 43 246.0 44 255.0 45 252.5 46 241.5 47 251.5 48 240.5 49 205.5 50 170.0 51 142.5 52 118.5 53 89.5 54 77.0 55 60.0 56 41.0 57 30.5 58 25.0 59 19.5 60 13.5 61 8.5 62 6.5 63 5.0 64 2.0 65 0.0 66 0.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 3.175 0.0 0.0 0.0 0.0 116-117 3.5999999999999996 0.0 0.0 0.0 0.0 118-119 3.975 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.987500000000001 0.0 0.0 0.0 0.0 124-125 5.3875 0.0 0.0 0.0 0.0 126-127 5.85 0.0 0.0 0.0 0.0 128-129 6.35 0.0 0.0 0.0 0.0 130-131 7.0 0.0 0.0 0.0 0.0 132-133 7.675 0.0 0.0 0.0 0.0 134-135 8.2375 0.0 0.0 0.0 0.0 136-137 8.7875 0.0 0.0 0.0 0.0 138-139 9.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCTTT 10 0.006843168 144.91249 7 >>END_MODULE SRR7168896 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168896_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86025 33.0 33.0 34.0 32.0 34.0 2 32.97175 33.0 33.0 34.0 32.0 34.0 3 32.95625 34.0 33.0 34.0 32.0 34.0 4 32.9255 34.0 33.0 34.0 32.0 34.0 5 32.919 34.0 33.0 34.0 32.0 34.0 6 37.103 38.0 38.0 38.0 37.0 38.0 7 37.06225 38.0 38.0 38.0 37.0 38.0 8 37.06275 38.0 38.0 38.0 37.0 38.0 9 37.1325 38.0 38.0 38.0 37.0 38.0 10-14 37.07665 38.0 38.0 38.0 37.0 38.0 15-19 37.07684999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.03574999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.04 38.0 38.0 38.0 37.0 38.0 30-34 37.03895 38.0 38.0 38.0 37.0 38.0 35-39 36.9692 38.0 38.0 38.0 36.6 38.0 40-44 36.88415 38.0 38.0 38.0 36.0 38.0 45-49 36.82495 38.0 38.0 38.0 36.0 38.0 50-54 36.68665 38.0 38.0 38.0 35.8 38.0 55-59 36.655100000000004 38.0 38.0 38.0 35.4 38.0 60-64 36.672700000000006 38.0 38.0 38.0 35.4 38.0 65-69 36.57735 38.0 38.0 38.0 35.2 38.0 70-74 36.51625 38.0 38.0 38.0 34.8 38.0 75-79 36.383849999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.36455 38.0 38.0 38.0 34.2 38.0 85-89 36.1938 38.0 38.0 38.0 33.8 38.0 90-94 36.249649999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.1194 38.0 38.0 38.0 33.8 38.0 100-104 35.837 38.0 37.8 38.0 32.4 38.0 105-109 35.65745 38.0 37.2 38.0 31.4 38.0 110-114 35.52515 38.0 37.0 38.0 31.0 38.0 115-119 35.44165 38.0 37.0 38.0 29.6 38.0 120-124 35.098400000000005 38.0 36.2 38.0 28.8 38.0 125-129 34.92139999999999 38.0 36.0 38.0 28.0 38.0 130-134 34.316449999999996 38.0 34.8 38.0 24.2 38.0 135-139 33.8803 38.0 34.2 38.0 22.2 38.0 140-144 33.28275 38.0 33.0 38.0 18.2 38.0 145-149 31.9971 38.0 33.0 38.0 8.4 38.0 150-151 26.770625 34.0 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 2.0 5 2.0 6 0.0 7 2.0 8 5.0 9 1.0 10 0.0 11 3.0 12 2.0 13 6.0 14 3.0 15 6.0 16 9.0 17 2.0 18 6.0 19 6.0 20 4.0 21 11.0 22 12.0 23 15.0 24 19.0 25 21.0 26 23.0 27 40.0 28 33.0 29 47.0 30 48.0 31 76.0 32 57.0 33 100.0 34 152.0 35 238.0 36 603.0 37 2434.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.05 18.275 17.7 28.975 2 26.375 25.85 32.1 15.675 3 21.825 27.175 30.099999999999998 20.9 4 24.25 33.775 23.599999999999998 18.375 5 24.925 34.300000000000004 23.7 17.075000000000003 6 19.325 38.525 25.074999999999996 17.075000000000003 7 18.5 18.8 41.925000000000004 20.775 8 21.5 24.5 28.299999999999997 25.7 9 21.65 25.074999999999996 30.8 22.475 10-14 22.59 28.744999999999997 26.66 22.005 15-19 23.150000000000002 27.900000000000002 28.165000000000003 20.785 20-24 22.595000000000002 28.475 27.87 21.060000000000002 25-29 23.119999999999997 28.335 27.855 20.69 30-34 22.71 27.82 28.754999999999995 20.715 35-39 23.155 28.225 27.794999999999998 20.825 40-44 22.85 27.72 28.38 21.05 45-49 23.169999999999998 27.634999999999998 28.16 21.035 50-54 23.155 27.560000000000002 27.860000000000003 21.425 55-59 22.915 27.474999999999998 28.595 21.015 60-64 23.044999999999998 27.939999999999998 28.050000000000004 20.965 65-69 22.91 27.77 28.144999999999996 21.175 70-74 23.305 28.215 27.839999999999996 20.64 75-79 23.195 28.185 27.805000000000003 20.815 80-84 23.305 27.800000000000004 28.09 20.805 85-89 23.395 27.58 28.110000000000003 20.915 90-94 23.205000000000002 27.905 28.225 20.665 95-99 22.845 27.76 28.22 21.175 100-104 23.925 28.025 27.715 20.335 105-109 23.095 27.939999999999998 28.27 20.695 110-114 23.76 27.77 27.625 20.845 115-119 23.69 28.244999999999997 27.85 20.215 120-124 24.03 26.96 28.465 20.544999999999998 125-129 24.335 28.16 27.339999999999996 20.165 130-134 24.98 27.634999999999998 27.725 19.66 135-139 24.68 27.384999999999998 27.88 20.055 140-144 24.94 28.23 26.76 20.07 145-149 25.629999999999995 27.779999999999998 27.115000000000002 19.475 150-151 25.650000000000002 27.675 27.275 19.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 0.5 25 2.5 26 5.0 27 6.0 28 7.5 29 10.0 30 14.5 31 19.5 32 27.5 33 38.5 34 45.0 35 57.0 36 92.5 37 123.0 38 150.5 39 182.5 40 191.5 41 220.5 42 254.5 43 272.0 44 281.0 45 271.5 46 267.5 47 240.5 48 208.5 49 200.0 50 178.0 51 146.0 52 114.5 53 87.5 54 69.0 55 49.5 56 40.5 57 33.0 58 22.0 59 19.0 60 14.5 61 10.0 62 7.5 63 6.5 64 3.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.4278882456581928 0.8500000000000001 3 0.05033979360684621 0.15 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.225 0.0 0.0 0.0 0.0 116-117 3.5999999999999996 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.525 0.0 0.0 0.0 0.0 122-123 5.012499999999999 0.0 0.0 0.0 0.0 124-125 5.4 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.387499999999999 0.0 0.0 0.0 0.0 130-131 7.0625 0.0 0.0 0.0 0.0 132-133 7.725 0.0 0.0 0.0 0.0 134-135 8.287500000000001 0.0 0.0 0.0 0.0 136-137 8.850000000000001 0.0 0.0 0.0 0.0 138-139 9.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTGC 10 0.006830828 145.0 6 CCTTGCT 10 0.006830828 145.0 7 >>END_MODULE Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882180 spots for SRR7168896.sra Written 882180 spots for SRR7168896.sra Read 882183 spots for SRR7168896.sra Written 882183 spots for SRR7168896.sra SRR ids: ['SRR7168896.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9dmqq34l SRR7168896.sra spots: 17643603 blocks: [[1, 882180], [882181, 1764360], [1764361, 2646540], [2646541, 3528720], [3528721, 4410900], [4410901, 5293080], [5293081, 6175260], [6175261, 7057440], [7057441, 7939620], [7939621, 8821800], [8821801, 9703980], [9703981, 10586160], [10586161, 11468340], [11468341, 12350520], [12350521, 13232700], [13232701, 14114880], [14114881, 14997060], [14997061, 15879240], [15879241, 16761420], [16761421, 17643603]] SRR7168896 file size 5957137 SRR7168896 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168896 SRR7168896_1.fastq SRR7168896_2.fastq Input file: SRR7168896_1.fastq Paired file: SRR7168896_2.fastq trimmed: SRR7168896-trimmed-pair1.fastq, SRR7168896-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:50:38 2025 >> started Mon Feb 10 10:50:58 2025 >> done (20.132s) 17643603 read pairs processed; of these: 16729 ( 0.09%) short read pairs filtered out after trimming by size control 18352 ( 0.10%) empty read pairs filtered out after trimming by size control 17608522 (99.80%) read pairs available; of these: 9371445 (53.22%) trimmed read pairs available after processing 8237077 (46.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 2 0.00% 23 5 0.00% 24 1 0.00% 25 4 0.00% 26 8 0.00% 27 9 0.00% 28 2 0.00% 29 11 0.00% 30 16 0.00% 31 13 0.00% 32 7 0.00% 33 9 0.00% 34 13 0.00% 35 27 0.00% 36 6 0.00% 37 17 0.00% 38 21 0.00% 39 26 0.00% 40 28 0.00% 41 38 0.00% 42 36 0.00% 43 44 0.00% 44 42 0.00% 45 69 0.00% 46 59 0.00% 47 64 0.00% 48 80 0.00% 49 75 0.00% 50 110 0.00% 51 161 0.00% 52 161 0.00% 53 183 0.00% 54 176 0.00% 55 193 0.00% 56 209 0.00% 57 262 0.00% 58 262 0.00% 59 370 0.00% 60 408 0.00% 61 449 0.00% 62 494 0.00% 63 560 0.00% 64 657 0.00% 65 769 0.00% 66 819 0.00% 67 952 0.01% 68 1131 0.01% 69 2088 0.01% 70 1831 0.01% 71 1643 0.01% 72 1816 0.01% 73 2016 0.01% 74 2336 0.01% 75 2563 0.01% 76 2780 0.02% 77 3080 0.02% 78 3628 0.02% 79 4064 0.02% 80 4411 0.03% 81 5078 0.03% 82 5637 0.03% 83 6225 0.04% 84 7674 0.04% 85 8539 0.05% 86 9281 0.05% 87 10001 0.06% 88 10853 0.06% 89 11425 0.06% 90 12466 0.07% 91 13640 0.08% 92 14619 0.08% 93 15923 0.09% 94 17037 0.10% 95 18250 0.10% 96 19353 0.11% 97 20074 0.11% 98 21409 0.12% 99 22242 0.13% 100 23879 0.14% 101 24635 0.14% 102 26349 0.15% 103 27938 0.16% 104 29250 0.17% 105 30845 0.18% 106 32137 0.18% 107 33745 0.19% 108 34318 0.19% 109 36210 0.21% 110 37336 0.21% 111 38695 0.22% 112 39985 0.23% 113 41720 0.24% 114 43203 0.25% 115 45183 0.26% 116 47150 0.27% 117 47393 0.27% 118 49060 0.28% 119 49879 0.28% 120 51321 0.29% 121 53008 0.30% 122 55007 0.31% 123 57461 0.33% 124 58989 0.34% 125 61548 0.35% 126 63330 0.36% 127 65104 0.37% 128 67130 0.38% 129 69407 0.39% 130 71102 0.40% 131 73023 0.41% 132 75612 0.43% 133 79073 0.45% 134 81361 0.46% 135 85408 0.49% 136 89209 0.51% 137 93450 0.53% 138 98389 0.56% 139 104628 0.59% 140 110648 0.63% 141 118209 0.67% 142 128828 0.73% 143 142755 0.81% 144 161723 0.92% 145 189605 1.08% 146 231939 1.32% 147 305893 1.74% 148 457738 2.60% 149 878753 4.99% 150 4161825 23.64% 151 8237077 46.78% 17608522 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=18 prefix-density=0.42 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=525.28 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=19.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=34.80 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.4 sequence=CACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7168896 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:51:48 Started mapping on | Feb 10 10:51:49 Finished on | Feb 10 10:54:20 Mapping speed, Million of reads per hour | 419.81 Number of input reads | 17608522 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16425213 Uniquely mapped reads % | 93.28% Average mapped length | 290.78 Number of splices: Total | 15407100 Number of splices: Annotated (sjdb) | 15047822 Number of splices: GT/AG | 15111131 Number of splices: GC/AG | 241836 Number of splices: AT/AC | 9266 Number of splices: Non-canonical | 44867 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465743 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 104870 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 734185 734185 734185 N_multimapping 465743 465743 465743 N_noFeature 667894 16067781 881560 N_ambiguous 252022 1629 107042 UnstrandedReadsAssigned:15505297 PositiveStrandReadsAssigned:355803 NegativeStrandReadsAssigned:15436611 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168896 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168896-trimmed-pair1.fastq SRR7168896-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,608,522 reads, 15,546,890 reads pseudoaligned [quant] estimated average fragment length: 229.053 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7168896.ke.tsv 34699 SRR7168896.se.tsv 87100 total ==> SRR7168896.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.95 501 19.0516 Potri.005G024800.1.v4.1 1035 806.947 168 14.1709 Potri.004G059700.1.v4.1 961 732.988 4 0.371446 Potri.007G009000.2.v4.1 1416 1187.95 0 0 Potri.003G141000.2.v4.1 2943 2714.95 798.709 20.0244 Potri.016G087400.1.v4.1 270 89.2315 783 597.279 Potri.015G069301.1.v4.1 564 340.619 0 0 Potri.010G195200.1.v4.1 1773 1544.95 17 0.748977 Potri.012G127500.1.v4.1 977 748.963 174 15.8133 ==> SRR7168896.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1169 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7168896 completed mapping pipeline successfully