Starting /dee2/code/volunteer_pipeline.sh SRR7168897 current disk space = 3058958041088 free memory = 1402574956 SRR7168897 SRAfilesize a24aec8da818f2e57a8380a8a20e6f76 SRR7168897.sra SRR7168897.sra file validated SRR7168897 is paired end SRR7168897 is conventional basespace SRR7168897 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168897_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71075 34.0 33.0 34.0 32.0 34.0 2 33.27625 34.0 33.0 34.0 32.0 34.0 3 33.39125 34.0 33.0 34.0 33.0 34.0 4 33.42525 34.0 33.0 34.0 33.0 34.0 5 33.43275 34.0 34.0 34.0 33.0 34.0 6 37.1445 38.0 38.0 38.0 36.0 38.0 7 37.40125 38.0 38.0 38.0 37.0 38.0 8 37.528 38.0 38.0 38.0 37.0 38.0 9 37.56 38.0 38.0 38.0 38.0 38.0 10-14 37.565 38.0 38.0 38.0 38.0 38.0 15-19 37.594100000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.52915 38.0 38.0 38.0 37.8 38.0 25-29 37.54835 38.0 38.0 38.0 38.0 38.0 30-34 37.54425 38.0 38.0 38.0 38.0 38.0 35-39 37.521 38.0 38.0 38.0 37.4 38.0 40-44 37.43505 38.0 38.0 38.0 37.0 38.0 45-49 37.44369999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.38295 38.0 38.0 38.0 37.0 38.0 55-59 37.3899 38.0 38.0 38.0 37.0 38.0 60-64 37.333000000000006 38.0 38.0 38.0 37.0 38.0 65-69 37.303999999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.2797 38.0 38.0 38.0 36.8 38.0 75-79 37.170249999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.1076 38.0 38.0 38.0 36.0 38.0 85-89 37.045550000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.957899999999995 38.0 38.0 38.0 35.8 38.0 95-99 36.81215 38.0 38.0 38.0 35.0 38.0 100-104 36.80475 38.0 38.0 38.0 35.0 38.0 105-109 36.5961 38.0 38.0 38.0 34.2 38.0 110-114 36.50375 38.0 38.0 38.0 34.0 38.0 115-119 36.3255 38.0 37.8 38.0 33.8 38.0 120-124 35.962999999999994 38.0 36.8 38.0 32.6 38.0 125-129 35.71294999999999 38.0 36.2 38.0 31.0 38.0 130-134 35.47175 38.0 36.0 38.0 31.0 38.0 135-139 35.2714 38.0 36.0 38.0 30.6 38.0 140-144 34.66005 38.0 34.2 38.0 28.0 38.0 145-149 33.9452 38.0 33.0 38.0 25.2 38.0 150-151 29.407125 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 3.0 20 2.0 21 3.0 22 5.0 23 3.0 24 8.0 25 7.0 26 8.0 27 18.0 28 23.0 29 23.0 30 34.0 31 51.0 32 71.0 33 90.0 34 140.0 35 242.0 36 577.0 37 2688.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.22919857069934 13.144461459928536 10.745278203164881 36.881061766207246 2 23.45 17.625 33.800000000000004 25.124999999999996 3 20.5 24.025 25.75 29.725 4 21.7 32.324999999999996 22.425 23.549999999999997 5 21.525 35.425000000000004 23.3 19.75 6 19.025 36.5 26.1 18.375 7 14.75 24.75 42.65 17.849999999999998 8 18.2 24.075 30.025000000000002 27.700000000000003 9 17.474999999999998 24.25 31.775 26.5 10-14 20.205000000000002 29.42 26.534999999999997 23.84 15-19 19.965 29.325000000000003 27.11 23.599999999999998 20-24 20.105 29.035 27.445000000000004 23.415 25-29 19.689999999999998 29.345 27.229999999999997 23.735 30-34 19.744999999999997 28.525 28.050000000000004 23.68 35-39 20.375 28.625 27.325 23.674999999999997 40-44 19.86 28.634999999999998 27.750000000000004 23.755000000000003 45-49 20.43 28.225 27.27 24.075 50-54 20.285 28.384999999999998 27.655 23.674999999999997 55-59 20.84 28.09 27.48 23.59 60-64 19.925 28.08 27.805000000000003 24.19 65-69 20.765 29.475 26.855 22.905 70-74 19.855 28.005000000000003 27.884999999999998 24.255 75-79 20.150000000000002 28.115000000000002 27.83 23.905 80-84 19.85 28.799999999999997 27.61 23.74 85-89 20.345 28.1 27.284999999999997 24.27 90-94 20.424999999999997 27.955000000000002 27.76 23.86 95-99 20.5 28.285 27.62 23.595 100-104 20.825 27.655 28.139999999999997 23.380000000000003 105-109 20.73 29.080000000000002 27.529999999999998 22.66 110-114 20.815 27.99 27.67 23.525 115-119 21.145 28.02 27.439999999999998 23.395 120-124 20.785 28.515 27.265 23.435 125-129 20.895 28.615000000000002 26.979999999999997 23.51 130-134 20.95 28.585 26.979999999999997 23.485 135-139 21.105 28.060000000000002 27.065 23.77 140-144 21.235 28.765 26.145000000000003 23.855 145-149 21.45 28.095 26.650000000000002 23.805 150-151 21.125 28.3125 26.75 23.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 1.5 22 3.0 23 4.5 24 4.0 25 3.0 26 6.0 27 7.5 28 7.5 29 8.0 30 13.5 31 19.0 32 30.5 33 43.0 34 53.5 35 76.5 36 89.5 37 106.5 38 133.0 39 163.5 40 195.0 41 212.5 42 225.5 43 255.0 44 279.5 45 271.0 46 260.5 47 238.0 48 223.5 49 219.0 50 188.5 51 146.5 52 104.5 53 85.0 54 74.0 55 60.5 56 47.5 57 39.0 58 33.0 59 22.5 60 13.5 61 6.5 62 3.5 63 3.0 64 2.5 65 1.5 66 1.0 67 1.5 68 1.5 69 1.0 70 1.5 71 0.5 72 1.0 73 2.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.225 0.0 0.0 0.0 0.0 110-111 2.4000000000000004 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.3125 0.0 0.0 0.0 0.0 118-119 3.8125 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.824999999999999 0.0 0.0 0.0 0.0 124-125 5.1875 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.7375 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 8.05 0.0 0.0 0.0 0.0 136-137 8.6375 0.0 0.0 0.0 0.0 138-139 9.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACGAAG 10 0.0068343505 144.975 2 ACGAAGA 10 0.0068343505 144.975 3 TCGATCT 30 0.0014452472 24.162498 135-139 TCGTATG 30 0.0014452472 24.162498 140-144 CTCGTAT 30 0.0014452472 24.162498 140-144 CGATCTC 30 0.0014452472 24.162498 135-139 CTAATCG 35 0.003540148 20.710714 130-134 ACTAATC 40 0.0076626483 18.121876 130-134 ACTCCAG 55 0.0025189708 15.8154545 120-124 >>END_MODULE SRR7168897 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168897_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94125 33.0 33.0 34.0 32.0 34.0 2 33.0715 34.0 33.0 34.0 32.0 34.0 3 33.1125 34.0 33.0 34.0 33.0 34.0 4 33.0565 34.0 33.0 34.0 33.0 34.0 5 33.03675 34.0 33.0 34.0 33.0 34.0 6 37.198 38.0 38.0 38.0 37.0 38.0 7 37.28075 38.0 38.0 38.0 37.0 38.0 8 37.26275 38.0 38.0 38.0 37.0 38.0 9 37.3085 38.0 38.0 38.0 37.0 38.0 10-14 37.255050000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.21515 38.0 38.0 38.0 37.0 38.0 20-24 37.2125 38.0 38.0 38.0 37.0 38.0 25-29 37.1961 38.0 38.0 38.0 37.0 38.0 30-34 37.179449999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.212 38.0 38.0 38.0 37.0 38.0 40-44 37.1497 38.0 38.0 38.0 37.0 38.0 45-49 37.153000000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.102500000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.0704 38.0 38.0 38.0 37.0 38.0 60-64 37.066900000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.05839999999999 38.0 38.0 38.0 36.8 38.0 70-74 36.97695 38.0 38.0 38.0 36.6 38.0 75-79 36.92585 38.0 38.0 38.0 36.0 38.0 80-84 36.80685 38.0 38.0 38.0 36.0 38.0 85-89 36.66735 38.0 38.0 38.0 35.2 38.0 90-94 36.5847 38.0 38.0 38.0 35.0 38.0 95-99 36.5936 38.0 38.0 38.0 35.0 38.0 100-104 36.4435 38.0 38.0 38.0 34.6 38.0 105-109 36.3021 38.0 38.0 38.0 34.0 38.0 110-114 36.2034 38.0 38.0 38.0 34.0 38.0 115-119 36.05925 38.0 38.0 38.0 33.8 38.0 120-124 35.84655 38.0 37.6 38.0 33.2 38.0 125-129 35.59695 38.0 37.2 38.0 31.4 38.0 130-134 35.33115 38.0 36.2 38.0 31.0 38.0 135-139 34.9452 38.0 36.0 38.0 29.0 38.0 140-144 34.50525 38.0 36.0 38.0 27.2 38.0 145-149 33.620400000000004 38.0 33.6 38.0 21.6 38.0 150-151 29.157875 35.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 2.0 5 2.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 2.0 12 5.0 13 1.0 14 3.0 15 2.0 16 3.0 17 4.0 18 2.0 19 7.0 20 4.0 21 12.0 22 6.0 23 11.0 24 9.0 25 19.0 26 12.0 27 20.0 28 17.0 29 26.0 30 36.0 31 38.0 32 62.0 33 83.0 34 129.0 35 201.0 36 464.0 37 2804.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.9 20.4 16.825000000000003 24.875 2 27.150000000000002 24.474999999999998 31.55 16.825000000000003 3 22.6 28.125 28.775000000000002 20.5 4 24.474999999999998 34.175 22.400000000000002 18.95 5 25.025 36.7 21.099999999999998 17.175 6 20.4 37.15 22.975 19.475 7 20.275000000000002 20.45 39.050000000000004 20.225 8 21.4 24.099999999999998 27.85 26.650000000000002 9 22.05 25.324999999999996 29.099999999999998 23.525 10-14 22.994999999999997 28.73 26.155 22.12 15-19 23.01 27.71 27.74 21.54 20-24 23.345 28.28 27.944999999999997 20.43 25-29 23.205000000000002 28.73 27.185 20.880000000000003 30-34 22.965 28.389999999999997 27.77 20.875 35-39 23.46 27.62 27.76 21.16 40-44 22.759999999999998 27.450000000000003 28.299999999999997 21.490000000000002 45-49 22.66 27.800000000000004 27.544999999999998 21.995 50-54 23.055 27.705000000000002 28.025 21.215 55-59 23.305 27.725 27.865000000000002 21.105 60-64 22.845 27.74 27.915 21.5 65-69 23.294999999999998 28.21 27.36 21.135 70-74 23.794999999999998 27.555000000000003 27.665 20.985 75-79 22.845 27.555000000000003 27.694999999999997 21.905 80-84 23.724999999999998 27.72 27.58 20.974999999999998 85-89 23.455000000000002 27.435 28.139999999999997 20.97 90-94 23.646182309115456 28.361418070903543 27.60638031901595 20.386019300965046 95-99 23.533530029504426 27.93919087863179 27.88418262739411 20.64309646446967 100-104 23.867160148044412 28.038411523457036 27.393217965389617 20.70121036310893 105-109 23.95979195839168 28.255651130226045 27.490498099619927 20.29405881176235 110-114 24.20484096819364 28.09561912382477 27.415483096619326 20.284056811362273 115-119 24.10361554233135 27.874181127169074 27.189078361754266 20.833124968745313 120-124 24.813722058308745 27.544131619742963 27.329099364904735 20.313046957043557 125-129 24.31621581079054 28.081404070203508 27.026351317565876 20.57602880144007 130-134 25.03000600120024 27.625525105021005 27.740548109621926 19.60392078415683 135-139 24.55368305245787 28.20423063459519 27.29409411411712 19.947992198829827 140-144 24.545 27.750000000000004 26.935 20.77 145-149 25.496274813740687 28.351417570878546 26.521326066303313 19.630981549077454 150-151 24.6 28.449999999999996 26.85 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 3.5 24 2.5 25 0.5 26 2.0 27 3.0 28 6.0 29 9.5 30 15.0 31 17.5 32 17.0 33 26.0 34 42.5 35 57.5 36 76.0 37 98.5 38 128.5 39 167.5 40 197.5 41 220.5 42 252.0 43 266.5 44 275.0 45 281.5 46 262.0 47 243.0 48 243.5 49 222.5 50 178.0 51 145.0 52 113.5 53 90.5 54 76.5 55 68.5 56 54.5 57 33.5 58 22.0 59 21.5 60 19.0 61 9.5 62 4.5 63 6.0 64 5.0 65 1.5 66 0.0 67 1.0 68 2.5 69 2.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.015 100-104 0.03 105-109 0.02 110-114 0.02 115-119 0.015 120-124 0.015 125-129 0.005 130-134 0.02 135-139 0.015 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5031446540880503 1.0 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1375000000000002 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.2125000000000004 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 2.9 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.199999999999999 0.0 0.0 0.0 0.0 122-123 4.762499999999999 0.0 0.0 0.0 0.0 124-125 5.1375 0.0 0.0 0.0 0.0 126-127 5.675 0.0 0.0 0.0 0.0 128-129 6.199999999999999 0.0 0.0 0.0 0.0 130-131 6.675 0.0 0.0 0.0 0.0 132-133 7.300000000000001 0.0 0.0 0.0 0.0 134-135 7.9875 0.0 0.0 0.0 0.0 136-137 8.6 0.0 0.0 0.0 0.0 138-139 9.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAAGG 10 0.006830828 145.0 7 TCAGCCA 10 0.006830828 145.0 9 TCGCCGG 10 0.006830828 145.0 145 AATGAAG 10 0.006830828 145.0 6 TGGTCGC 30 0.0014437955 24.166668 140-144 TCGGTGG 30 0.0014437955 24.166668 135-139 GGTCGCC 30 0.0014437955 24.166668 140-144 GAGTGTA 40 2.9585467E-4 21.75 125-129 AGTGTAG 35 0.0035366106 20.714287 125-129 GAAAGAG 55 0.0025160722 15.818182 120-124 >>END_MODULE Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860774 spots for SRR7168897.sra Written 860774 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra Read 860769 spots for SRR7168897.sra Written 860769 spots for SRR7168897.sra SRR ids: ['SRR7168897.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d7f5v_0d SRR7168897.sra spots: 17215385 blocks: [[1, 860769], [860770, 1721538], [1721539, 2582307], [2582308, 3443076], [3443077, 4303845], [4303846, 5164614], [5164615, 6025383], [6025384, 6886152], [6886153, 7746921], [7746922, 8607690], [8607691, 9468459], [9468460, 10329228], [10329229, 11189997], [11189998, 12050766], [12050767, 12911535], [12911536, 13772304], [13772305, 14633073], [14633074, 15493842], [15493843, 16354611], [16354612, 17215385]] SRR7168897 file size 5812028 SRR7168897 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168897 SRR7168897_1.fastq SRR7168897_2.fastq Input file: SRR7168897_1.fastq Paired file: SRR7168897_2.fastq trimmed: SRR7168897-trimmed-pair1.fastq, SRR7168897-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:51:46 2025 >> started Mon Feb 10 10:52:14 2025 >> done (27.977s) 17215385 read pairs processed; of these: 26230 ( 0.15%) short read pairs filtered out after trimming by size control 32540 ( 0.19%) empty read pairs filtered out after trimming by size control 17156615 (99.66%) read pairs available; of these: 9542191 (55.62%) trimmed read pairs available after processing 7614424 (44.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 3 0.00% 21 3 0.00% 22 5 0.00% 23 4 0.00% 24 4 0.00% 25 3 0.00% 26 8 0.00% 27 13 0.00% 28 7 0.00% 29 2 0.00% 30 14 0.00% 31 11 0.00% 32 10 0.00% 33 10 0.00% 34 16 0.00% 35 20 0.00% 36 20 0.00% 37 21 0.00% 38 23 0.00% 39 20 0.00% 40 22 0.00% 41 41 0.00% 42 32 0.00% 43 65 0.00% 44 47 0.00% 45 56 0.00% 46 61 0.00% 47 64 0.00% 48 76 0.00% 49 92 0.00% 50 130 0.00% 51 111 0.00% 52 133 0.00% 53 125 0.00% 54 203 0.00% 55 194 0.00% 56 201 0.00% 57 232 0.00% 58 265 0.00% 59 310 0.00% 60 393 0.00% 61 417 0.00% 62 437 0.00% 63 494 0.00% 64 580 0.00% 65 701 0.00% 66 727 0.00% 67 830 0.00% 68 979 0.01% 69 2034 0.01% 70 2001 0.01% 71 1563 0.01% 72 1586 0.01% 73 1849 0.01% 74 2037 0.01% 75 2196 0.01% 76 2542 0.01% 77 2732 0.02% 78 3067 0.02% 79 3528 0.02% 80 3966 0.02% 81 4386 0.03% 82 4959 0.03% 83 5789 0.03% 84 7186 0.04% 85 8121 0.05% 86 8568 0.05% 87 9143 0.05% 88 10095 0.06% 89 10702 0.06% 90 11604 0.07% 91 12110 0.07% 92 13061 0.08% 93 14607 0.09% 94 15489 0.09% 95 16581 0.10% 96 17533 0.10% 97 17978 0.10% 98 18762 0.11% 99 19410 0.11% 100 21150 0.12% 101 22039 0.13% 102 23734 0.14% 103 25069 0.15% 104 26546 0.15% 105 28394 0.17% 106 29130 0.17% 107 30019 0.17% 108 31039 0.18% 109 32228 0.19% 110 33449 0.19% 111 35059 0.20% 112 36803 0.21% 113 38384 0.22% 114 40032 0.23% 115 41959 0.24% 116 43381 0.25% 117 44521 0.26% 118 45476 0.27% 119 46193 0.27% 120 48010 0.28% 121 49318 0.29% 122 51008 0.30% 123 53453 0.31% 124 56252 0.33% 125 57871 0.34% 126 60812 0.35% 127 61848 0.36% 128 63086 0.37% 129 65183 0.38% 130 66880 0.39% 131 68653 0.40% 132 71524 0.42% 133 75468 0.44% 134 79836 0.47% 135 84078 0.49% 136 87971 0.51% 137 92140 0.54% 138 96849 0.56% 139 102910 0.60% 140 108789 0.63% 141 118070 0.69% 142 129409 0.75% 143 145778 0.85% 144 168340 0.98% 145 200157 1.17% 146 249372 1.45% 147 333747 1.95% 148 500514 2.92% 149 974769 5.68% 150 4282062 24.96% 151 7614424 44.38% 17156615 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=14 prefix-density=0.56 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=406.63 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=18.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=18 prefix-density=0.53 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=69.95 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.5 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7168897 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:53:00 Started mapping on | Feb 10 10:53:00 Finished on | Feb 10 10:55:13 Mapping speed, Million of reads per hour | 464.39 Number of input reads | 17156615 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15817665 Uniquely mapped reads % | 92.20% Average mapped length | 291.10 Number of splices: Total | 15050193 Number of splices: Annotated (sjdb) | 14716285 Number of splices: GT/AG | 14752308 Number of splices: GC/AG | 249480 Number of splices: AT/AC | 8706 Number of splices: Non-canonical | 39699 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423880 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 248274 % of reads mapped to too many loci | 1.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 937961 937961 937961 N_multimapping 423880 423880 423880 N_noFeature 572414 15507286 739456 N_ambiguous 251243 1420 106835 UnstrandedReadsAssigned:14994008 PositiveStrandReadsAssigned:308959 NegativeStrandReadsAssigned:14971374 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168897 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168897-trimmed-pair1.fastq SRR7168897-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,156,615 reads, 15,201,568 reads pseudoaligned [quant] estimated average fragment length: 229.349 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 966 rounds 52401 SRR7168897.ke.tsv 34699 SRR7168897.se.tsv 87100 total ==> SRR7168897.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.65 448 16.9069 Potri.005G024800.1.v4.1 1035 806.651 112 9.37749 Potri.004G059700.1.v4.1 961 732.666 10 0.921823 Potri.007G009000.2.v4.1 1416 1187.65 0 0 Potri.003G141000.2.v4.1 2943 2714.65 754.433 18.7699 Potri.016G087400.1.v4.1 270 88.0456 799 612.905 Potri.015G069301.1.v4.1 564 340.023 0 0 Potri.010G195200.1.v4.1 1773 1544.65 8 0.349795 Potri.012G127500.1.v4.1 977 748.656 128 11.5473 ==> SRR7168897.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1131 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR7168897 completed mapping pipeline successfully