Starting /dee2/code/volunteer_pipeline.sh SRR7168898 current disk space = 3058901831680 free memory = 1460838048 SRR7168898 SRAfilesize 266baaafae810bb9f8223393360d94de SRR7168898.sra SRR7168898.sra file validated SRR7168898 is paired end SRR7168898 is conventional basespace SRR7168898 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168898_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62075 34.0 33.0 34.0 33.0 34.0 2 33.22375 34.0 33.0 34.0 32.0 34.0 3 33.387 34.0 33.0 34.0 33.0 34.0 4 33.38975 34.0 34.0 34.0 33.0 34.0 5 33.5125 34.0 34.0 34.0 33.0 34.0 6 37.1935 38.0 38.0 38.0 36.0 38.0 7 37.47 38.0 38.0 38.0 37.0 38.0 8 37.49525 38.0 38.0 38.0 37.0 38.0 9 37.4905 38.0 38.0 38.0 37.0 38.0 10-14 37.5613 38.0 38.0 38.0 37.8 38.0 15-19 37.5728 38.0 38.0 38.0 38.0 38.0 20-24 37.5612 38.0 38.0 38.0 38.0 38.0 25-29 37.54165 38.0 38.0 38.0 38.0 38.0 30-34 37.521350000000005 38.0 38.0 38.0 37.8 38.0 35-39 37.482150000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.4316 38.0 38.0 38.0 37.2 38.0 45-49 37.43845 38.0 38.0 38.0 37.0 38.0 50-54 37.41605 38.0 38.0 38.0 37.0 38.0 55-59 37.35675 38.0 38.0 38.0 37.0 38.0 60-64 37.32875 38.0 38.0 38.0 37.0 38.0 65-69 37.2924 38.0 38.0 38.0 37.0 38.0 70-74 37.21825 38.0 38.0 38.0 36.6 38.0 75-79 37.12215 38.0 38.0 38.0 36.0 38.0 80-84 37.098200000000006 38.0 38.0 38.0 36.0 38.0 85-89 37.017700000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.92315 38.0 38.0 38.0 35.6 38.0 95-99 36.86195 38.0 38.0 38.0 35.4 38.0 100-104 36.79605 38.0 38.0 38.0 35.0 38.0 105-109 36.6659 38.0 38.0 38.0 34.8 38.0 110-114 36.543099999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.46055 38.0 38.0 38.0 34.0 38.0 120-124 36.10600000000001 38.0 37.6 38.0 33.6 38.0 125-129 35.881 38.0 37.0 38.0 33.0 38.0 130-134 35.5228 38.0 36.0 38.0 31.0 38.0 135-139 35.3036 38.0 36.0 38.0 31.0 38.0 140-144 34.8031 38.0 35.0 38.0 28.0 38.0 145-149 34.25195 38.0 33.8 38.0 26.4 38.0 150-151 29.96675 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 3.0 18 3.0 19 4.0 20 0.0 21 4.0 22 2.0 23 1.0 24 6.0 25 7.0 26 15.0 27 15.0 28 18.0 29 24.0 30 33.0 31 38.0 32 66.0 33 96.0 34 124.0 35 223.0 36 593.0 37 2721.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.50102459016394 12.269467213114755 14.011270491803279 37.21823770491803 2 21.85 17.875 33.575 26.700000000000003 3 21.3 22.475 26.025 30.2 4 23.95 31.125000000000004 21.125 23.799999999999997 5 22.0 35.025 23.325000000000003 19.650000000000002 6 18.5 35.35 26.325 19.825 7 14.124999999999998 24.875 43.725 17.275 8 18.65 24.349999999999998 29.625 27.375 9 17.925 23.35 34.175 24.55 10-14 20.43 29.09 26.3 24.18 15-19 20.115 28.189999999999998 28.095 23.599999999999998 20-24 20.13 28.189999999999998 28.12 23.56 25-29 20.11 28.134999999999998 28.1 23.655 30-34 19.925 27.865000000000002 28.110000000000003 24.099999999999998 35-39 20.45 28.465 27.565 23.52 40-44 20.195 28.175 28.155 23.474999999999998 45-49 20.39 28.725 27.575 23.31 50-54 20.47 27.74 27.450000000000003 24.34 55-59 20.06 28.705000000000002 27.67 23.565 60-64 20.29 28.13 27.54 24.04 65-69 19.625 27.99 28.310000000000002 24.075 70-74 20.04 27.91 28.24 23.810000000000002 75-79 20.294999999999998 28.215 27.565 23.925 80-84 20.625 28.505000000000003 27.445000000000004 23.425 85-89 20.695 29.160000000000004 26.915 23.23 90-94 20.735 28.685 27.005000000000003 23.575 95-99 20.27 28.17 27.744999999999997 23.815 100-104 20.74 27.939999999999998 27.389999999999997 23.93 105-109 20.925 28.095 27.279999999999998 23.7 110-114 21.42 28.1 26.924999999999997 23.555 115-119 21.240000000000002 28.225 26.729999999999997 23.805 120-124 20.91 27.985 27.389999999999997 23.715 125-129 21.02 27.73 27.279999999999998 23.97 130-134 21.154999999999998 28.285 26.419999999999998 24.14 135-139 21.48 28.360000000000003 26.619999999999997 23.54 140-144 21.445 28.735 25.835 23.985 145-149 21.02 28.044999999999998 26.229999999999997 24.705 150-151 20.849999999999998 28.1875 26.5375 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 1.5 25 1.0 26 3.5 27 5.0 28 5.5 29 7.5 30 14.5 31 21.5 32 29.0 33 38.5 34 42.0 35 66.0 36 95.0 37 114.5 38 144.0 39 169.0 40 195.5 41 221.0 42 252.0 43 270.0 44 251.0 45 256.5 46 261.5 47 248.0 48 230.5 49 199.0 50 167.5 51 144.0 52 125.0 53 96.5 54 75.0 55 57.5 56 48.0 57 42.5 58 28.0 59 17.5 60 13.5 61 10.0 62 6.5 63 5.0 64 3.0 65 1.5 66 2.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6294058408862034 1.25 3 0.0 0.0 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 2.2 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.0999999999999996 0.0 0.0 0.0 0.0 112-113 3.5875000000000004 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.4375 0.0 0.0 0.0 0.0 118-119 4.975 0.0 0.0 0.0 0.0 120-121 5.4 0.0 0.0 0.0 0.0 122-123 5.8375 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.9 0.0 0.0 0.0 0.0 128-129 7.4375 0.0 0.0 0.0 0.0 130-131 8.05 0.0 0.0 0.0 0.0 132-133 8.6125 0.0 0.0 0.0 0.0 134-135 9.087499999999999 0.0 0.0 0.0 0.0 136-137 9.6125 0.0 0.0 0.0 0.0 138-139 10.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168898 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168898_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.872 33.0 33.0 34.0 32.0 34.0 2 33.0205 34.0 33.0 34.0 32.0 34.0 3 33.01775 34.0 33.0 34.0 32.0 34.0 4 33.01425 34.0 33.0 34.0 32.0 34.0 5 32.96275 34.0 33.0 34.0 32.0 34.0 6 37.22 38.0 38.0 38.0 37.0 38.0 7 37.24525 38.0 38.0 38.0 37.0 38.0 8 37.26475 38.0 38.0 38.0 37.0 38.0 9 37.2325 38.0 38.0 38.0 37.0 38.0 10-14 37.19680000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.182249999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.16785 38.0 38.0 38.0 37.0 38.0 25-29 37.13315 38.0 38.0 38.0 37.0 38.0 30-34 37.13145 38.0 38.0 38.0 37.0 38.0 35-39 37.1758 38.0 38.0 38.0 37.0 38.0 40-44 37.1667 38.0 38.0 38.0 37.0 38.0 45-49 37.15175 38.0 38.0 38.0 37.0 38.0 50-54 37.11705 38.0 38.0 38.0 37.0 38.0 55-59 37.05975 38.0 38.0 38.0 37.0 38.0 60-64 37.038050000000005 38.0 38.0 38.0 36.8 38.0 65-69 36.93925 38.0 38.0 38.0 36.6 38.0 70-74 36.93685 38.0 38.0 38.0 36.6 38.0 75-79 36.835899999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.729 38.0 38.0 38.0 36.0 38.0 85-89 36.684 38.0 38.0 38.0 35.6 38.0 90-94 36.57395 38.0 38.0 38.0 35.0 38.0 95-99 36.596000000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.448049999999995 38.0 38.0 38.0 34.4 38.0 105-109 36.35695 38.0 38.0 38.0 34.0 38.0 110-114 36.19005 38.0 38.0 38.0 34.0 38.0 115-119 35.9921 38.0 38.0 38.0 33.6 38.0 120-124 35.731950000000005 38.0 37.6 38.0 32.4 38.0 125-129 35.517849999999996 38.0 37.0 38.0 31.0 38.0 130-134 35.25715 38.0 36.2 38.0 30.8 38.0 135-139 34.86805 38.0 36.0 38.0 29.2 38.0 140-144 34.45885 38.0 36.0 38.0 28.0 38.0 145-149 33.379 38.0 33.2 38.0 20.4 38.0 150-151 28.744875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 3.0 11 1.0 12 1.0 13 2.0 14 4.0 15 2.0 16 9.0 17 4.0 18 5.0 19 6.0 20 4.0 21 10.0 22 9.0 23 13.0 24 15.0 25 13.0 26 22.0 27 20.0 28 29.0 29 21.0 30 39.0 31 41.0 32 52.0 33 82.0 34 96.0 35 197.0 36 585.0 37 2703.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.5 18.35 15.7 29.45 2 26.424999999999997 26.6 30.725 16.25 3 21.5 29.849999999999998 29.75 18.9 4 25.3 33.15 23.3 18.25 5 25.3 35.975 21.75 16.975 6 20.325 37.075 24.05 18.55 7 19.575 19.400000000000002 41.575 19.45 8 21.125 24.474999999999998 28.549999999999997 25.85 9 22.8 24.325 29.549999999999997 23.325000000000003 10-14 23.745 28.075 26.6 21.58 15-19 23.34 28.27 27.505000000000003 20.885 20-24 23.305 28.27 27.529999999999998 20.895 25-29 23.755000000000003 28.110000000000003 26.865 21.27 30-34 22.919999999999998 28.360000000000003 28.09 20.630000000000003 35-39 22.98 27.615000000000002 28.125 21.279999999999998 40-44 22.755 28.33 27.97 20.945 45-49 22.985 28.17 27.61 21.235 50-54 23.24 28.03 27.71 21.02 55-59 23.35 27.375 28.144999999999996 21.13 60-64 23.195 27.32 27.985 21.5 65-69 23.315 27.625 28.105000000000004 20.955 70-74 23.735 27.505000000000003 27.575 21.185000000000002 75-79 23.34 27.685 27.845 21.13 80-84 23.695 26.784999999999997 28.005000000000003 21.515 85-89 23.775 27.065 28.015 21.145 90-94 23.625 27.685 28.125 20.565 95-99 23.641182059102956 27.77638881944097 27.50637531876594 21.076053802690133 100-104 24.06120306015301 28.0314015700785 27.181359067953398 20.72603630181509 105-109 24.257425742574256 28.05780578057806 27.29272927292729 20.392039203920394 110-114 24.6 28.035 27.49 19.875 115-119 24.921246062303116 27.43637181859093 27.701385069253465 19.940997049852495 120-124 24.295 28.155 27.075 20.474999999999998 125-129 24.975 28.365000000000002 26.3 20.36 130-134 25.101255062753136 28.07640382019101 26.73133656682834 20.091004550227513 135-139 25.345000000000002 28.115000000000002 26.784999999999997 19.755 140-144 25.19 27.834999999999997 26.91 20.064999999999998 145-149 25.485000000000003 28.134999999999998 26.815 19.564999999999998 150-151 25.587500000000002 28.65 26.200000000000003 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 0.5 24 1.5 25 2.0 26 2.0 27 2.0 28 6.0 29 9.5 30 9.0 31 12.0 32 21.5 33 36.0 34 45.5 35 60.5 36 75.0 37 92.0 38 131.5 39 169.0 40 197.0 41 224.0 42 260.0 43 278.0 44 271.5 45 269.5 46 270.5 47 264.0 48 239.0 49 198.5 50 158.5 51 134.0 52 111.0 53 99.5 54 92.5 55 66.5 56 46.5 57 35.5 58 27.0 59 18.0 60 10.5 61 11.0 62 7.0 63 6.0 64 6.5 65 2.5 66 1.5 67 2.5 68 2.5 69 2.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.005 105-109 0.01 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37027707808565 98.625 2 0.5541561712846348 1.0999999999999999 3 0.025188916876574305 0.075 4 0.05037783375314861 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.7875 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.262499999999999 0.0 0.0 0.0 0.0 118-119 4.7875 0.0 0.0 0.0 0.0 120-121 5.2125 0.0 0.0 0.0 0.0 122-123 5.6625 0.0 0.0 0.0 0.0 124-125 6.2 0.0 0.0 0.0 0.0 126-127 6.7125 0.0 0.0 0.0 0.0 128-129 7.2375 0.0 0.0 0.0 0.0 130-131 7.85 0.0 0.0 0.0 0.0 132-133 8.375 0.0 0.0 0.0 0.0 134-135 8.825 0.0 0.0 0.0 0.0 136-137 9.325 0.0 0.0 0.0 0.0 138-139 10.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846784 spots for SRR7168898.sra Written 846784 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra Read 846769 spots for SRR7168898.sra Written 846769 spots for SRR7168898.sra SRR ids: ['SRR7168898.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wzbd10x7 SRR7168898.sra spots: 16935395 blocks: [[1, 846769], [846770, 1693538], [1693539, 2540307], [2540308, 3387076], [3387077, 4233845], [4233846, 5080614], [5080615, 5927383], [5927384, 6774152], [6774153, 7620921], [7620922, 8467690], [8467691, 9314459], [9314460, 10161228], [10161229, 11007997], [11007998, 11854766], [11854767, 12701535], [12701536, 13548304], [13548305, 14395073], [14395074, 15241842], [15241843, 16088611], [16088612, 16935395]] SRR7168898 file size 5717149 SRR7168898 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168898 SRR7168898_1.fastq SRR7168898_2.fastq Input file: SRR7168898_1.fastq Paired file: SRR7168898_2.fastq trimmed: SRR7168898-trimmed-pair1.fastq, SRR7168898-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:55:22 2025 >> started Mon Feb 10 10:55:41 2025 >> done (18.970s) 16935395 read pairs processed; of these: 21548 ( 0.13%) short read pairs filtered out after trimming by size control 26130 ( 0.15%) empty read pairs filtered out after trimming by size control 16887717 (99.72%) read pairs available; of these: 9116586 (53.98%) trimmed read pairs available after processing 7771131 (46.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 1 0.00% 23 3 0.00% 24 4 0.00% 25 4 0.00% 26 5 0.00% 27 15 0.00% 28 7 0.00% 29 11 0.00% 30 12 0.00% 31 7 0.00% 32 13 0.00% 33 14 0.00% 34 4 0.00% 35 13 0.00% 36 25 0.00% 37 23 0.00% 38 15 0.00% 39 26 0.00% 40 36 0.00% 41 31 0.00% 42 44 0.00% 43 39 0.00% 44 51 0.00% 45 55 0.00% 46 64 0.00% 47 76 0.00% 48 64 0.00% 49 83 0.00% 50 96 0.00% 51 132 0.00% 52 140 0.00% 53 146 0.00% 54 176 0.00% 55 205 0.00% 56 217 0.00% 57 302 0.00% 58 309 0.00% 59 305 0.00% 60 397 0.00% 61 436 0.00% 62 510 0.00% 63 620 0.00% 64 683 0.00% 65 741 0.00% 66 841 0.00% 67 892 0.01% 68 1253 0.01% 69 1951 0.01% 70 1958 0.01% 71 1746 0.01% 72 1942 0.01% 73 2176 0.01% 74 2391 0.01% 75 2684 0.02% 76 3108 0.02% 77 3332 0.02% 78 3855 0.02% 79 4345 0.03% 80 4628 0.03% 81 5417 0.03% 82 6038 0.04% 83 6860 0.04% 84 8286 0.05% 85 9202 0.05% 86 9843 0.06% 87 10928 0.06% 88 11692 0.07% 89 12687 0.08% 90 13878 0.08% 91 14155 0.08% 92 15517 0.09% 93 16819 0.10% 94 18221 0.11% 95 19608 0.12% 96 20928 0.12% 97 21734 0.13% 98 22331 0.13% 99 23501 0.14% 100 24803 0.15% 101 25830 0.15% 102 27551 0.16% 103 29005 0.17% 104 30919 0.18% 105 32751 0.19% 106 33883 0.20% 107 34898 0.21% 108 35750 0.21% 109 37037 0.22% 110 38167 0.23% 111 39604 0.23% 112 41309 0.24% 113 42918 0.25% 114 44881 0.27% 115 47043 0.28% 116 48344 0.29% 117 49610 0.29% 118 50691 0.30% 119 51870 0.31% 120 52934 0.31% 121 54319 0.32% 122 56228 0.33% 123 58077 0.34% 124 60307 0.36% 125 62163 0.37% 126 64586 0.38% 127 66311 0.39% 128 67486 0.40% 129 69514 0.41% 130 70656 0.42% 131 73045 0.43% 132 75352 0.45% 133 79090 0.47% 134 81483 0.48% 135 85572 0.51% 136 89348 0.53% 137 92833 0.55% 138 97522 0.58% 139 102445 0.61% 140 107576 0.64% 141 115691 0.69% 142 124725 0.74% 143 137622 0.81% 144 156423 0.93% 145 183015 1.08% 146 224192 1.33% 147 293478 1.74% 148 432762 2.56% 149 838468 4.96% 150 3965574 23.48% 151 7771131 46.02% 16887717 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.47 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=11.84 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=2.7 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=9 prefix-density=0.59 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=64.70 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.1 sequence=ACACAGAGAACACATTCATAC SRR7168898 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:56:52 Started mapping on | Feb 10 10:56:52 Finished on | Feb 10 10:58:58 Mapping speed, Million of reads per hour | 482.51 Number of input reads | 16887717 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 13560505 Uniquely mapped reads % | 80.30% Average mapped length | 283.69 Number of splices: Total | 13077674 Number of splices: Annotated (sjdb) | 12766183 Number of splices: GT/AG | 12817139 Number of splices: GC/AG | 205690 Number of splices: AT/AC | 7471 Number of splices: Non-canonical | 47374 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 480930 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 205854 % of reads mapped to too many loci | 1.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.41% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2868320 2868320 2868320 N_multimapping 480930 480930 480930 N_noFeature 447350 13311976 573415 N_ambiguous 366097 3894 240394 UnstrandedReadsAssigned:12747058 PositiveStrandReadsAssigned:244635 NegativeStrandReadsAssigned:12746696 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168898 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168898-trimmed-pair1.fastq SRR7168898-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,887,717 reads, 14,739,433 reads pseudoaligned [quant] estimated average fragment length: 215.705 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7168898.ke.tsv 34699 SRR7168898.se.tsv 87100 total ==> SRR7168898.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.29 1691 64.079 Potri.005G024800.1.v4.1 1035 820.295 339 28.2402 Potri.004G059700.1.v4.1 961 746.32 7 0.640931 Potri.007G009000.2.v4.1 1416 1201.29 0 0 Potri.003G141000.2.v4.1 2943 2728.29 584.573 14.6415 Potri.016G087400.1.v4.1 270 96.7916 963 679.872 Potri.015G069301.1.v4.1 564 352.885 0 0 Potri.010G195200.1.v4.1 1773 1558.29 832.979 36.5278 Potri.012G127500.1.v4.1 977 762.305 90 8.06775 ==> SRR7168898.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 450 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 122 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168898 completed mapping pipeline successfully