Starting /dee2/code/volunteer_pipeline.sh SRR7168899 current disk space = 3058892992512 free memory = 1432220376 SRR7168899 SRAfilesize 6bbc7a8839ea5d581b412d04438f27ee SRR7168899.sra SRR7168899.sra file validated SRR7168899 is paired end SRR7168899 is conventional basespace SRR7168899 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.256 34.0 33.0 34.0 32.0 34.0 2 33.16575 34.0 33.0 34.0 32.0 34.0 3 33.1105 34.0 33.0 34.0 31.0 34.0 4 33.219 34.0 33.0 34.0 33.0 34.0 5 33.31225 34.0 33.0 34.0 33.0 34.0 6 36.934 38.0 37.0 38.0 36.0 38.0 7 37.20625 38.0 38.0 38.0 36.0 38.0 8 37.346 38.0 38.0 38.0 37.0 38.0 9 37.3965 38.0 38.0 38.0 37.0 38.0 10-14 37.4325 38.0 38.0 38.0 37.0 38.0 15-19 37.3894 38.0 38.0 38.0 37.0 38.0 20-24 37.3754 38.0 38.0 38.0 37.0 38.0 25-29 37.28585 38.0 38.0 38.0 37.0 38.0 30-34 37.3266 38.0 38.0 38.0 37.0 38.0 35-39 37.284800000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.2718 38.0 38.0 38.0 37.0 38.0 45-49 37.19885 38.0 38.0 38.0 36.6 38.0 50-54 37.16715 38.0 38.0 38.0 36.2 38.0 55-59 37.04715 38.0 38.0 38.0 36.0 38.0 60-64 37.035399999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.994 38.0 38.0 38.0 35.8 38.0 70-74 36.858799999999995 38.0 38.0 38.0 35.4 38.0 75-79 36.798950000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.635400000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.5937 38.0 38.0 38.0 34.2 38.0 90-94 36.4628 38.0 38.0 38.0 34.0 38.0 95-99 36.32845 38.0 37.8 38.0 34.0 38.0 100-104 36.2493 38.0 37.2 38.0 33.4 38.0 105-109 36.006150000000005 38.0 37.0 38.0 32.8 38.0 110-114 35.732099999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.5548 38.0 36.0 38.0 30.2 38.0 120-124 35.33845 38.0 36.0 38.0 29.0 38.0 125-129 35.01125 38.0 35.4 38.0 28.0 38.0 130-134 34.5622 38.0 34.8 38.0 25.8 38.0 135-139 34.16975000000001 38.0 34.4 38.0 23.8 38.0 140-144 33.44070000000001 38.0 33.4 38.0 20.2 38.0 145-149 32.4828 38.0 32.6 38.0 14.0 38.0 150-151 27.674 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 3.0 18 1.0 19 2.0 20 3.0 21 6.0 22 6.0 23 8.0 24 9.0 25 16.0 26 28.0 27 24.0 28 43.0 29 47.0 30 55.0 31 59.0 32 107.0 33 123.0 34 173.0 35 293.0 36 798.0 37 2193.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.19627136198861 13.412739513205594 11.18591403417918 34.20507509062662 2 20.75 19.375 33.525 26.35 3 19.5 25.650000000000002 24.8 30.049999999999997 4 22.650000000000002 31.85 22.15 23.35 5 21.180295073768445 35.108777194298575 25.006251562890725 18.704676169042262 6 19.075 35.25 25.95 19.725 7 14.975 24.15 42.65 18.224999999999998 8 17.875 24.575 30.9 26.650000000000002 9 17.549999999999997 24.45 32.475 25.525 10-14 20.57 29.145 26.61 23.674999999999997 15-19 20.265 27.779999999999998 28.439999999999998 23.515 20-24 20.415 28.939999999999998 27.07 23.575 25-29 20.13 28.095 28.110000000000003 23.665 30-34 20.115 28.415000000000003 27.755000000000003 23.715 35-39 20.335 28.235 27.725 23.705000000000002 40-44 20.325 28.144999999999996 27.705000000000002 23.825 45-49 20.73 27.99 28.000000000000004 23.28 50-54 20.39 27.655 28.249999999999996 23.705000000000002 55-59 20.345 28.68 27.474999999999998 23.5 60-64 20.415 28.58 27.839999999999996 23.165 65-69 20.47 27.395000000000003 28.395 23.74 70-74 21.08 27.955000000000002 27.665 23.3 75-79 20.455000000000002 28.845 27.200000000000003 23.5 80-84 20.71 28.185 27.625 23.48 85-89 20.455000000000002 28.095 28.015 23.435 90-94 20.72 28.12 27.405 23.755000000000003 95-99 20.705000000000002 27.325 28.560000000000002 23.41 100-104 19.985 28.449999999999996 27.744999999999997 23.82 105-109 21.245 28.1 27.200000000000003 23.455000000000002 110-114 20.62 28.68 27.38 23.32 115-119 20.974999999999998 28.360000000000003 27.455000000000002 23.21 120-124 21.095 28.285 27.22 23.400000000000002 125-129 21.645 27.400000000000002 27.650000000000002 23.305 130-134 21.23 27.950000000000003 26.66 24.16 135-139 21.545 28.27 26.63 23.555 140-144 21.135 28.4 27.065 23.400000000000002 145-149 21.12 28.975 26.395000000000003 23.51 150-151 21.176765775937774 28.47823359678836 26.797139631162963 23.547860996110902 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.0 24 2.5 25 4.0 26 6.0 27 10.5 28 13.0 29 13.5 30 17.0 31 23.5 32 29.5 33 43.0 34 54.5 35 66.5 36 93.0 37 121.0 38 143.5 39 153.0 40 188.5 41 209.5 42 217.0 43 233.0 44 254.5 45 288.5 46 277.0 47 244.5 48 226.0 49 205.0 50 168.5 51 129.5 52 119.5 53 108.5 54 72.5 55 54.5 56 52.0 57 45.5 58 33.0 59 25.0 60 18.0 61 9.5 62 5.0 63 3.5 64 3.5 65 2.0 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.36250000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.3265511178095956 0.65 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATAAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.85 0.0 0.0 0.0 0.0 120-121 4.3125 0.0 0.0 0.0 0.0 122-123 4.7 0.0 0.0 0.0 0.0 124-125 5.074999999999999 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.3625 0.0 0.0 0.0 0.0 132-133 6.95 0.0 0.0 0.0 0.0 134-135 7.5 0.0 0.0 0.0 0.0 136-137 8.15 0.0 0.0 0.0 0.0 138-139 8.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168899 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168899_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90025 33.0 33.0 34.0 32.0 34.0 2 33.0245 34.0 33.0 34.0 32.0 34.0 3 33.032 34.0 33.0 34.0 33.0 34.0 4 32.99125 34.0 33.0 34.0 32.0 34.0 5 32.98975 34.0 33.0 34.0 32.0 34.0 6 37.196 38.0 38.0 38.0 37.0 38.0 7 37.228 38.0 38.0 38.0 37.0 38.0 8 37.14525 38.0 38.0 38.0 37.0 38.0 9 37.19275 38.0 38.0 38.0 37.0 38.0 10-14 37.1164 38.0 38.0 38.0 37.0 38.0 15-19 37.15725 38.0 38.0 38.0 37.0 38.0 20-24 37.0497 38.0 38.0 38.0 37.0 38.0 25-29 37.07165 38.0 38.0 38.0 37.0 38.0 30-34 37.04545 38.0 38.0 38.0 37.0 38.0 35-39 37.0204 38.0 38.0 38.0 37.0 38.0 40-44 36.998599999999996 38.0 38.0 38.0 36.6 38.0 45-49 36.93795 38.0 38.0 38.0 36.4 38.0 50-54 36.86775 38.0 38.0 38.0 36.2 38.0 55-59 36.80205 38.0 38.0 38.0 36.0 38.0 60-64 36.76525 38.0 38.0 38.0 36.0 38.0 65-69 36.755100000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.67435 38.0 38.0 38.0 35.8 38.0 75-79 36.5267 38.0 38.0 38.0 34.8 38.0 80-84 36.3242 38.0 38.0 38.0 34.0 38.0 85-89 36.21135 38.0 38.0 38.0 33.8 38.0 90-94 36.13595 38.0 38.0 38.0 33.6 38.0 95-99 35.9949 38.0 38.0 38.0 33.4 38.0 100-104 35.94315 38.0 38.0 38.0 33.0 38.0 105-109 35.7568 38.0 37.4 38.0 32.4 38.0 110-114 35.46065 38.0 37.0 38.0 31.0 38.0 115-119 35.3023 38.0 36.8 38.0 29.8 38.0 120-124 34.91095 38.0 36.0 38.0 27.8 38.0 125-129 34.50605 38.0 35.2 38.0 25.2 38.0 130-134 34.1607 38.0 35.0 38.0 23.2 38.0 135-139 33.65575 38.0 34.2 38.0 21.4 38.0 140-144 32.819750000000006 38.0 32.8 38.0 15.4 38.0 145-149 31.785050000000002 38.0 32.6 38.0 8.4 38.0 150-151 26.933375 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 2.0 5 2.0 6 0.0 7 1.0 8 0.0 9 1.0 10 3.0 11 1.0 12 2.0 13 3.0 14 4.0 15 5.0 16 6.0 17 10.0 18 10.0 19 7.0 20 11.0 21 9.0 22 12.0 23 14.0 24 14.0 25 20.0 26 25.0 27 34.0 28 39.0 29 37.0 30 49.0 31 65.0 32 61.0 33 102.0 34 157.0 35 275.0 36 697.0 37 2312.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.13478369592398 20.030007501875467 14.753688422105526 26.081520380095025 2 26.78169542385596 26.431607901975497 31.23280820205051 15.55388847211803 3 21.07107107107107 29.72972972972973 30.255255255255253 18.943943943943946 4 23.67959949937422 34.593241551939926 23.329161451814766 18.39799749687109 5 23.30413016270338 37.246558197747184 21.752190237797247 17.69712140175219 6 19.42985746436609 36.159039759939986 24.681170292573142 19.72993248312078 7 19.989992494370778 20.115086314736054 39.57968476357268 20.31523642732049 8 21.92192192192192 24.2992992992993 26.976976976976978 26.8018018018018 9 21.330332583145786 24.88122030507627 30.00750187546887 23.78094523630908 10-14 23.197398048536403 28.391293470102575 26.454841130848134 21.956467350512884 15-19 22.989943463251112 27.763045979886925 28.013208585580628 21.233801971281334 20-24 23.31030339441274 28.226694703114045 28.08150595774507 20.381495944728147 25-29 22.813516896120152 28.05006257822278 27.88986232790989 21.246558197747184 30-34 22.693366708385483 27.44430538172716 28.435544430538172 21.426783479349186 35-39 22.53817271589487 28.180225281602 27.694618272841055 21.586983729662077 40-44 22.922507008410093 27.99359231077293 27.638165798958752 21.44573488185823 45-49 22.56756756756757 28.16816816816817 28.1981981981982 21.066066066066067 50-54 22.872872872872875 28.423423423423422 27.597597597597595 21.106106106106107 55-59 23.223223223223226 27.522522522522525 27.802802802802802 21.45145145145145 60-64 22.879871916745884 28.263371191274327 27.85310451793666 21.003652374043128 65-69 23.42310772927513 26.827192631157388 28.26391670004005 21.485782939527436 70-74 23.773528233880654 27.953544253103722 27.46796155386464 20.80496595915098 75-79 23.104259472446067 27.634015716502326 27.85925221482557 21.402472596226037 80-84 23.516747609272517 28.463425624593203 27.031492514895106 20.988334251239174 85-89 23.595674376689697 28.346850906178034 27.105236807850204 20.95223790928207 90-94 23.59213095059318 28.167392501376582 27.346448415678033 20.894028132352204 95-99 23.609165499299582 26.92615569341605 28.32199319591755 21.142685611366822 100-104 23.550905996596256 27.9957953749124 27.590349384322753 20.862949244168586 105-109 23.425226397158152 28.818732175914345 27.302746785410513 20.453294641516987 110-114 24.050632911392405 28.128283384199733 27.462850853054487 20.35823285135338 115-119 24.299158990788946 27.808370044052865 27.26271525830997 20.62975570684822 120-124 24.20525657071339 27.74468085106383 27.819774718397998 20.23028785982478 125-129 24.241665832415656 28.361197317048752 26.97967764540995 20.41745920512564 130-134 24.873579332098334 27.872628047864616 26.66099233965854 20.592800280378512 135-139 24.515644555694617 27.60450563204005 27.59949937421777 20.28035043804756 140-144 25.313985489116835 28.15611708781586 26.26970227670753 20.26019514635977 145-149 24.74221643808189 28.45630193212534 26.754429872860147 20.04705175693263 150-151 25.137500000000003 28.037499999999998 26.825 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.5 20 2.5 21 1.5 22 2.5 23 1.0 24 0.5 25 2.0 26 4.0 27 5.5 28 9.0 29 12.5 30 13.5 31 15.0 32 20.5 33 33.0 34 46.0 35 59.5 36 78.5 37 98.0 38 129.5 39 167.5 40 199.5 41 230.0 42 239.0 43 265.0 44 289.5 45 282.5 46 262.0 47 225.5 48 222.5 49 218.5 50 174.5 51 143.0 52 121.0 53 90.0 54 76.5 55 69.0 56 56.0 57 40.0 58 24.5 59 20.0 60 16.0 61 11.0 62 7.5 63 3.0 64 1.0 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.1 4 0.125 5 0.125 6 0.025 7 0.075 8 0.1 9 0.025 10-14 0.075 15-19 0.065 20-24 0.13 25-29 0.125 30-34 0.125 35-39 0.125 40-44 0.12 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.065 65-69 0.12 70-74 0.12 75-79 0.105 80-84 0.135 85-89 0.13 90-94 0.11499999999999999 95-99 0.06 100-104 0.11 105-109 0.065 110-114 0.065 115-119 0.12 120-124 0.125 125-129 0.11 130-134 0.135 135-139 0.125 140-144 0.075 145-149 0.11 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19130654536265 98.125 2 0.6317917614354309 1.25 3 0.10108668182966893 0.3 4 0.050543340914834464 0.2 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.0250000000000004 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.875 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.7 0.0 0.0 0.0 0.0 124-125 5.137499999999999 0.0 0.0 0.0 0.0 126-127 5.6625 0.0 0.0 0.0 0.0 128-129 5.9875 0.0 0.0 0.0 0.0 130-131 6.5375 0.0 0.0 0.0 0.0 132-133 7.125 0.0 0.0 0.0 0.0 134-135 7.675000000000001 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 8.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCCTC 10 0.006830828 145.0 9 >>END_MODULE Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792303 spots for SRR7168899.sra Written 792303 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra Read 792298 spots for SRR7168899.sra Written 792298 spots for SRR7168899.sra SRR ids: ['SRR7168899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__ytcocuv SRR7168899.sra spots: 15845965 blocks: [[1, 792298], [792299, 1584596], [1584597, 2376894], [2376895, 3169192], [3169193, 3961490], [3961491, 4753788], [4753789, 5546086], [5546087, 6338384], [6338385, 7130682], [7130683, 7922980], [7922981, 8715278], [8715279, 9507576], [9507577, 10299874], [10299875, 11092172], [11092173, 11884470], [11884471, 12676768], [12676769, 13469066], [13469067, 14261364], [14261365, 15053662], [15053663, 15845965]] SRR7168899 file size 5347977 SRR7168899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168899 SRR7168899_1.fastq SRR7168899_2.fastq Input file: SRR7168899_1.fastq Paired file: SRR7168899_2.fastq trimmed: SRR7168899-trimmed-pair1.fastq, SRR7168899-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:58:26 2025 >> started Mon Feb 10 10:58:43 2025 >> done (17.924s) 15845965 read pairs processed; of these: 22991 ( 0.15%) short read pairs filtered out after trimming by size control 50011 ( 0.32%) empty read pairs filtered out after trimming by size control 15772963 (99.54%) read pairs available; of these: 8613810 (54.61%) trimmed read pairs available after processing 7159153 (45.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 5 0.00% 22 6 0.00% 23 6 0.00% 24 6 0.00% 25 2 0.00% 26 10 0.00% 27 7 0.00% 28 15 0.00% 29 16 0.00% 30 12 0.00% 31 13 0.00% 32 22 0.00% 33 19 0.00% 34 23 0.00% 35 26 0.00% 36 17 0.00% 37 30 0.00% 38 25 0.00% 39 32 0.00% 40 30 0.00% 41 45 0.00% 42 59 0.00% 43 48 0.00% 44 57 0.00% 45 65 0.00% 46 77 0.00% 47 69 0.00% 48 59 0.00% 49 92 0.00% 50 112 0.00% 51 124 0.00% 52 154 0.00% 53 162 0.00% 54 156 0.00% 55 173 0.00% 56 218 0.00% 57 241 0.00% 58 248 0.00% 59 298 0.00% 60 311 0.00% 61 374 0.00% 62 426 0.00% 63 520 0.00% 64 562 0.00% 65 709 0.00% 66 716 0.00% 67 768 0.00% 68 971 0.01% 69 2531 0.02% 70 2174 0.01% 71 1426 0.01% 72 1506 0.01% 73 1691 0.01% 74 1868 0.01% 75 2032 0.01% 76 2165 0.01% 77 2408 0.02% 78 2756 0.02% 79 2877 0.02% 80 3317 0.02% 81 3874 0.02% 82 4454 0.03% 83 4868 0.03% 84 6045 0.04% 85 6988 0.04% 86 7310 0.05% 87 7920 0.05% 88 8381 0.05% 89 8832 0.06% 90 9583 0.06% 91 10651 0.07% 92 11337 0.07% 93 12488 0.08% 94 13288 0.08% 95 14155 0.09% 96 14976 0.09% 97 15550 0.10% 98 16007 0.10% 99 17027 0.11% 100 18251 0.12% 101 18967 0.12% 102 20645 0.13% 103 22126 0.14% 104 23310 0.15% 105 24578 0.16% 106 25431 0.16% 107 25992 0.16% 108 27088 0.17% 109 27806 0.18% 110 29254 0.19% 111 30680 0.19% 112 32364 0.21% 113 33596 0.21% 114 35753 0.23% 115 37139 0.24% 116 38295 0.24% 117 39753 0.25% 118 40663 0.26% 119 41053 0.26% 120 42637 0.27% 121 44190 0.28% 122 45859 0.29% 123 48571 0.31% 124 50929 0.32% 125 52824 0.33% 126 55410 0.35% 127 57135 0.36% 128 59097 0.37% 129 60125 0.38% 130 62083 0.39% 131 64056 0.41% 132 66856 0.42% 133 70098 0.44% 134 73948 0.47% 135 77867 0.49% 136 81973 0.52% 137 86608 0.55% 138 90573 0.57% 139 96402 0.61% 140 101926 0.65% 141 108930 0.69% 142 119407 0.76% 143 133359 0.85% 144 153066 0.97% 145 180052 1.14% 146 221764 1.41% 147 296502 1.88% 148 444776 2.82% 149 863566 5.47% 150 3881844 24.61% 151 7159153 45.39% 15772963 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=11 prefix-density=0.55 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=481.49 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=20 prefix-density=0.56 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=57.40 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7168899 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:59:38 Started mapping on | Feb 10 10:59:41 Finished on | Feb 10 11:01:41 Mapping speed, Million of reads per hour | 473.19 Number of input reads | 15772963 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14645875 Uniquely mapped reads % | 92.85% Average mapped length | 291.40 Number of splices: Total | 13997473 Number of splices: Annotated (sjdb) | 13709347 Number of splices: GT/AG | 13728789 Number of splices: GC/AG | 225319 Number of splices: AT/AC | 7170 Number of splices: Non-canonical | 36195 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384846 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 116662 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.79% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 760199 760199 760199 N_multimapping 384846 384846 384846 N_noFeature 547852 14333488 739777 N_ambiguous 211443 1619 89700 UnstrandedReadsAssigned:13886580 PositiveStrandReadsAssigned:310768 NegativeStrandReadsAssigned:13816398 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168899 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168899-trimmed-pair1.fastq SRR7168899-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,772,963 reads, 13,911,724 reads pseudoaligned [quant] estimated average fragment length: 228.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 986 rounds 52401 SRR7168899.ke.tsv 34699 SRR7168899.se.tsv 87100 total ==> SRR7168899.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.53 542 22.3674 Potri.005G024800.1.v4.1 1035 807.525 168 15.3727 Potri.004G059700.1.v4.1 961 733.561 16 1.61169 Potri.007G009000.2.v4.1 1416 1188.53 0 0 Potri.003G141000.2.v4.1 2943 2715.53 936.505 25.4832 Potri.016G087400.1.v4.1 270 86.238 523 448.126 Potri.015G069301.1.v4.1 564 340.639 0 0 Potri.010G195200.1.v4.1 1773 1545.53 10 0.478102 Potri.012G127500.1.v4.1 977 749.536 46 4.53484 ==> SRR7168899.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 509 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 9 SRR7168899 completed mapping pipeline successfully