Starting /dee2/code/volunteer_pipeline.sh SRR7168900 current disk space = 3058815115264 free memory = 1489398136 SRR7168900 SRAfilesize 72d3522ae5d1d744eb5b7ac6ea432918 SRR7168900.sra SRR7168900.sra file validated SRR7168900 is paired end SRR7168900 is conventional basespace SRR7168900 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168900_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42575 34.0 34.0 34.0 33.0 34.0 2 33.431 34.0 34.0 34.0 33.0 34.0 3 33.528 34.0 34.0 34.0 33.0 34.0 4 33.60975 34.0 34.0 34.0 33.0 34.0 5 33.58425 34.0 34.0 34.0 33.0 34.0 6 37.46025 38.0 38.0 38.0 37.0 38.0 7 37.536 38.0 38.0 38.0 37.0 38.0 8 37.61925 38.0 38.0 38.0 38.0 38.0 9 37.69275 38.0 38.0 38.0 38.0 38.0 10-14 37.6822 38.0 38.0 38.0 38.0 38.0 15-19 37.69375 38.0 38.0 38.0 38.0 38.0 20-24 37.63275 38.0 38.0 38.0 38.0 38.0 25-29 37.62815 38.0 38.0 38.0 38.0 38.0 30-34 37.5923 38.0 38.0 38.0 38.0 38.0 35-39 37.611900000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.57625 38.0 38.0 38.0 38.0 38.0 45-49 37.5194 38.0 38.0 38.0 38.0 38.0 50-54 37.5413 38.0 38.0 38.0 38.0 38.0 55-59 37.49155 38.0 38.0 38.0 38.0 38.0 60-64 37.4573 38.0 38.0 38.0 37.4 38.0 65-69 37.444 38.0 38.0 38.0 37.0 38.0 70-74 37.39645 38.0 38.0 38.0 37.0 38.0 75-79 37.27905 38.0 38.0 38.0 37.0 38.0 80-84 37.191250000000004 38.0 38.0 38.0 36.6 38.0 85-89 37.14834999999999 38.0 38.0 38.0 36.4 38.0 90-94 37.0299 38.0 38.0 38.0 36.0 38.0 95-99 36.95569999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.88805 38.0 38.0 38.0 35.6 38.0 105-109 36.7282 38.0 38.0 38.0 35.2 38.0 110-114 36.596849999999996 38.0 38.0 38.0 34.6 38.0 115-119 36.34740000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.25395 38.0 38.0 38.0 34.0 38.0 125-129 36.0412 38.0 37.0 38.0 33.2 38.0 130-134 35.86715 38.0 36.8 38.0 32.4 38.0 135-139 35.378249999999994 38.0 36.0 38.0 31.0 38.0 140-144 34.82475 38.0 35.4 38.0 29.4 38.0 145-149 34.20005 38.0 33.6 38.0 27.2 38.0 150-151 29.8645 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 2.0 19 5.0 20 4.0 21 5.0 22 3.0 23 7.0 24 5.0 25 10.0 26 10.0 27 11.0 28 15.0 29 26.0 30 28.0 31 37.0 32 47.0 33 56.0 34 98.0 35 207.0 36 547.0 37 2873.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.04185079282558 14.322848973225891 12.347283597608525 36.288016636340004 2 23.45 19.2 32.25 25.1 3 21.25 25.4 24.3 29.049999999999997 4 22.55 30.9 23.125 23.425 5 21.91095547773887 35.66783391695848 23.836918459229615 18.584292146073036 6 19.35 34.725 25.4 20.525 7 14.875 24.45 42.15 18.525 8 18.55 23.400000000000002 29.9 28.15 9 18.25 24.625 32.05 25.074999999999996 10-14 20.085 29.735 26.169999999999998 24.01 15-19 20.294999999999998 29.160000000000004 26.965 23.580000000000002 20-24 19.765 28.65 27.905 23.68 25-29 19.900000000000002 28.235 27.74 24.125 30-34 20.458183273309324 28.396358543417367 27.225890356142457 23.91956782713085 35-39 20.511025551277566 28.136406820341016 27.496374818740936 23.85619280964048 40-44 20.195 29.15 27.33 23.325000000000003 45-49 19.96 28.46 27.700000000000003 23.880000000000003 50-54 20.485 28.345 27.245 23.925 55-59 20.64 28.449999999999996 27.450000000000003 23.46 60-64 20.405 28.305000000000003 27.939999999999998 23.35 65-69 20.8 28.27 27.42 23.51 70-74 20.055 28.810000000000002 27.134999999999998 24.0 75-79 20.325 28.610000000000003 27.42 23.645 80-84 20.74 28.515 27.67 23.075000000000003 85-89 20.415 28.435 27.16 23.990000000000002 90-94 20.565 28.299999999999997 27.169999999999998 23.965 95-99 20.82 27.715 27.860000000000003 23.605 100-104 20.919999999999998 28.64 27.015 23.425 105-109 20.75 28.360000000000003 27.16 23.73 110-114 21.255 27.794999999999998 27.215 23.735 115-119 21.175 28.134999999999998 26.85 23.84 120-124 20.465 28.725 26.625 24.185000000000002 125-129 20.794999999999998 28.34 26.950000000000003 23.915 130-134 20.775 28.88 26.474999999999998 23.87 135-139 21.47 28.194999999999997 26.634999999999998 23.7 140-144 21.355 27.3 27.215 24.13 145-149 21.12 27.855 26.889999999999997 24.135 150-151 20.908634538152608 27.547690763052206 26.31777108433735 25.225903614457827 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 4.0 27 6.5 28 9.0 29 11.0 30 13.0 31 22.0 32 31.5 33 39.5 34 56.5 35 73.0 36 82.0 37 108.0 38 139.0 39 159.0 40 177.5 41 203.5 42 234.0 43 259.5 44 266.5 45 264.5 46 281.5 47 269.5 48 240.0 49 198.0 50 169.0 51 154.0 52 119.5 53 102.5 54 81.5 55 53.5 56 41.5 57 33.5 58 24.5 59 24.5 60 18.0 61 9.0 62 7.0 63 4.0 64 0.5 65 0.0 66 1.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8249999999999997 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.04 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36964195663137 98.52499999999999 2 0.529500756429652 1.05 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.02521432173474534 0.125 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTCTCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 13 (97% over 37bp) CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.300000000000001 0.0 0.0 0.0 0.0 124-125 4.95 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0 0.0 128-129 5.8375 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.7625 0.0 0.0 0.0 0.0 134-135 7.300000000000001 0.0 0.0 0.0 0.0 136-137 7.7875 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168900 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168900_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0765 33.0 33.0 34.0 32.0 34.0 2 33.21575 34.0 33.0 34.0 33.0 34.0 3 33.186 34.0 33.0 34.0 33.0 34.0 4 33.2415 34.0 33.0 34.0 33.0 34.0 5 33.23175 34.0 33.0 34.0 33.0 34.0 6 37.3505 38.0 38.0 38.0 37.0 38.0 7 37.416 38.0 38.0 38.0 38.0 38.0 8 37.3625 38.0 38.0 38.0 37.0 38.0 9 37.42125 38.0 38.0 38.0 38.0 38.0 10-14 37.36385 38.0 38.0 38.0 38.0 38.0 15-19 37.3838 38.0 38.0 38.0 38.0 38.0 20-24 37.3176 38.0 38.0 38.0 38.0 38.0 25-29 37.32615 38.0 38.0 38.0 38.0 38.0 30-34 37.2836 38.0 38.0 38.0 38.0 38.0 35-39 37.3269 38.0 38.0 38.0 38.0 38.0 40-44 37.3427 38.0 38.0 38.0 38.0 38.0 45-49 37.282500000000006 38.0 38.0 38.0 37.8 38.0 50-54 37.267399999999995 38.0 38.0 38.0 37.4 38.0 55-59 37.215700000000005 38.0 38.0 38.0 37.2 38.0 60-64 37.20635 38.0 38.0 38.0 37.0 38.0 65-69 37.121050000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.05845000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.00404999999999 38.0 38.0 38.0 37.0 38.0 80-84 36.968650000000004 38.0 38.0 38.0 36.6 38.0 85-89 36.80625 38.0 38.0 38.0 36.0 38.0 90-94 36.70120000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.68390000000001 38.0 38.0 38.0 35.8 38.0 100-104 36.585699999999996 38.0 38.0 38.0 35.2 38.0 105-109 36.47205 38.0 38.0 38.0 34.6 38.0 110-114 36.340050000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.21525 38.0 38.0 38.0 34.0 38.0 120-124 35.99025 38.0 38.0 38.0 33.6 38.0 125-129 35.73819999999999 38.0 37.6 38.0 33.0 38.0 130-134 35.458850000000005 38.0 36.8 38.0 31.0 38.0 135-139 35.00625 38.0 36.0 38.0 30.6 38.0 140-144 34.4717 38.0 35.4 38.0 27.4 38.0 145-149 33.48265 38.0 33.4 38.0 18.8 38.0 150-151 28.510624999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 2.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 0.0 14 4.0 15 3.0 16 4.0 17 8.0 18 3.0 19 5.0 20 4.0 21 6.0 22 9.0 23 6.0 24 10.0 25 16.0 26 10.0 27 13.0 28 23.0 29 23.0 30 33.0 31 33.0 32 54.0 33 62.0 34 109.0 35 190.0 36 484.0 37 2867.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.05 19.875 16.150000000000002 26.924999999999997 2 26.075 26.325 30.65 16.950000000000003 3 21.8 29.049999999999997 29.975 19.175 4 22.825 35.875 22.05 19.25 5 23.400000000000002 37.225 21.575 17.8 6 21.101376720901126 36.62077596996245 23.979974968710888 18.29787234042553 7 20.35043804755945 19.574468085106382 39.17396745932415 20.90112640801001 8 20.926157697121404 26.307884856070086 24.881101376720903 27.88485607008761 9 20.77596996245307 25.957446808510635 28.88610763454318 24.380475594493117 10-14 23.37538800440573 28.607189346149998 26.614598978672273 21.402823670772005 15-19 23.623072301221708 28.384738634087725 27.43340676947727 20.558782295213298 20-24 23.083854818523154 28.380475594493117 27.033792240300375 21.501877346683354 25-29 22.789183775663496 28.73309964947421 27.32098147220831 21.156735102653982 30-34 22.653980971457184 27.456184276414625 28.28242363545318 21.607411116675014 35-39 23.108906923153995 28.053301272417592 27.437130548041278 21.400661256387135 40-44 23.28794553464157 27.99359231077293 27.267721265518624 21.45074088906688 45-49 22.812812812812812 27.482482482482485 27.33233233233233 22.372372372372375 50-54 23.635999599559515 27.615376914606067 27.57533286615277 21.17329061968165 55-59 23.1639549436796 27.334167709637047 28.000000000000004 21.501877346683354 60-64 23.068836045056322 27.8648310387985 27.394242803504383 21.672090112640802 65-69 23.250225292880742 27.36557524782217 27.605887653950134 21.778311805346952 70-74 23.07846377247008 28.140804166040763 27.760252365930597 21.02047969555856 75-79 22.956399859838815 27.56670170696301 28.17740401461681 21.299494418581368 80-84 23.61514574777121 27.136131423419812 27.692076530101172 21.556646298707804 85-89 23.37857464816948 27.555466519757598 28.02624330144739 21.039715530625532 90-94 23.399249061326657 27.60450563204005 27.629536921151438 21.366708385481854 95-99 23.84549957472357 27.437834592485117 27.607945164356835 21.108720668434483 100-104 23.20776427034869 27.515133323327827 27.70523788083446 21.57186452548902 105-109 23.319821848571284 27.693539508582294 27.733573537506878 21.253065105339537 110-114 24.061843290303212 28.34484138897228 27.399179425597918 20.19413589512659 115-119 23.86101932512266 28.01642134775208 27.846200060078104 20.276359267047162 120-124 23.922079222795332 28.168661425209073 27.31233411788272 20.596925234112877 125-129 24.7196074504306 27.333266573202486 27.543560985379536 20.403564990987384 130-134 24.50553302288318 28.32106554504031 26.698713134044365 20.474688298032145 135-139 25.14769199959948 27.941323720837087 26.89996996094923 20.011014318614198 140-144 24.82986389111289 28.137510008006405 26.886509207365894 20.14611689351481 145-149 25.544376032437306 28.047254342493865 26.495469790258795 19.912899834810034 150-151 25.4875 27.950000000000003 26.5125 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 1.5 24 0.5 25 1.0 26 2.5 27 2.0 28 2.0 29 7.5 30 11.0 31 20.0 32 25.5 33 26.5 34 44.0 35 58.5 36 80.5 37 106.5 38 132.5 39 172.0 40 194.0 41 209.0 42 218.5 43 237.5 44 262.5 45 253.0 46 270.5 47 280.5 48 244.5 49 217.0 50 181.0 51 150.5 52 129.5 53 110.0 54 93.5 55 71.5 56 48.5 57 34.0 58 29.0 59 18.5 60 10.5 61 8.5 62 7.0 63 4.5 64 4.0 65 3.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.125 8 0.125 9 0.125 10-14 0.13 15-19 0.13999999999999999 20-24 0.125 25-29 0.15 30-34 0.15 35-39 0.19 40-44 0.12 45-49 0.1 50-54 0.11 55-59 0.125 60-64 0.125 65-69 0.13 70-74 0.145 75-79 0.11499999999999999 80-84 0.16999999999999998 85-89 0.165 90-94 0.125 95-99 0.065 100-104 0.055 105-109 0.08499999999999999 110-114 0.06999999999999999 115-119 0.13 120-124 0.155 125-129 0.13999999999999999 130-134 0.145 135-139 0.13 140-144 0.08 145-149 0.11499999999999999 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03943377148636 97.95 2 0.8594539939332658 1.7000000000000002 3 0.07583417593528817 0.22499999999999998 4 0.0 0.0 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.85 0.0 0.0 0.0 0.0 116-117 3.2125 0.0 0.0 0.0 0.0 118-119 3.5875 0.0 0.0 0.0 0.0 120-121 3.9250000000000003 0.0 0.0 0.0 0.0 122-123 4.275 0.0 0.0 0.0 0.0 124-125 4.95 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0 0.0 128-129 5.8 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.7875 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.0 0.0 136-137 7.887499999999999 0.0 0.0 0.0 0.0 138-139 8.524999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAGCT 10 0.006830828 145.0 8 CAAGCTA 10 0.006830828 145.0 9 >>END_MODULE Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559987 spots for SRR7168900.sra Written 559987 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra Read 559977 spots for SRR7168900.sra Written 559977 spots for SRR7168900.sra SRR ids: ['SRR7168900.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__zaxytu2 SRR7168900.sra spots: 11199550 blocks: [[1, 559977], [559978, 1119954], [1119955, 1679931], [1679932, 2239908], [2239909, 2799885], [2799886, 3359862], [3359863, 3919839], [3919840, 4479816], [4479817, 5039793], [5039794, 5599770], [5599771, 6159747], [6159748, 6719724], [6719725, 7279701], [7279702, 7839678], [7839679, 8399655], [8399656, 8959632], [8959633, 9519609], [9519610, 10079586], [10079587, 10639563], [10639564, 11199550]] SRR7168900 file size 3773459 SRR7168900 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168900 SRR7168900_1.fastq SRR7168900_2.fastq Input file: SRR7168900_1.fastq Paired file: SRR7168900_2.fastq trimmed: SRR7168900-trimmed-pair1.fastq, SRR7168900-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:04:25 2025 >> started Mon Feb 10 11:04:37 2025 >> done (11.847s) 11199550 read pairs processed; of these: 14358 ( 0.13%) short read pairs filtered out after trimming by size control 29357 ( 0.26%) empty read pairs filtered out after trimming by size control 11155835 (99.61%) read pairs available; of these: 5662974 (50.76%) trimmed read pairs available after processing 5492861 (49.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 4 0.00% 23 5 0.00% 24 2 0.00% 25 4 0.00% 26 9 0.00% 27 4 0.00% 28 4 0.00% 29 3 0.00% 30 11 0.00% 31 11 0.00% 32 11 0.00% 33 11 0.00% 34 16 0.00% 35 16 0.00% 36 11 0.00% 37 19 0.00% 38 19 0.00% 39 18 0.00% 40 24 0.00% 41 17 0.00% 42 31 0.00% 43 26 0.00% 44 35 0.00% 45 36 0.00% 46 48 0.00% 47 51 0.00% 48 46 0.00% 49 57 0.00% 50 66 0.00% 51 85 0.00% 52 85 0.00% 53 98 0.00% 54 85 0.00% 55 107 0.00% 56 106 0.00% 57 137 0.00% 58 175 0.00% 59 160 0.00% 60 199 0.00% 61 263 0.00% 62 259 0.00% 63 348 0.00% 64 318 0.00% 65 413 0.00% 66 423 0.00% 67 489 0.00% 68 556 0.00% 69 1282 0.01% 70 1413 0.01% 71 998 0.01% 72 964 0.01% 73 1093 0.01% 74 1237 0.01% 75 1401 0.01% 76 1488 0.01% 77 1647 0.01% 78 1721 0.02% 79 1876 0.02% 80 2156 0.02% 81 2432 0.02% 82 2789 0.03% 83 3178 0.03% 84 3782 0.03% 85 4300 0.04% 86 4735 0.04% 87 5145 0.05% 88 5358 0.05% 89 5749 0.05% 90 6236 0.06% 91 6852 0.06% 92 7570 0.07% 93 8191 0.07% 94 9068 0.08% 95 9541 0.09% 96 9902 0.09% 97 10187 0.09% 98 10699 0.10% 99 11056 0.10% 100 11857 0.11% 101 12847 0.12% 102 13484 0.12% 103 14569 0.13% 104 15470 0.14% 105 15983 0.14% 106 16807 0.15% 107 17520 0.16% 108 17607 0.16% 109 18464 0.17% 110 18909 0.17% 111 19633 0.18% 112 20856 0.19% 113 21731 0.19% 114 23041 0.21% 115 24117 0.22% 116 24975 0.22% 117 25707 0.23% 118 26164 0.23% 119 26177 0.23% 120 27037 0.24% 121 28049 0.25% 122 29412 0.26% 123 30883 0.28% 124 32401 0.29% 125 33846 0.30% 126 35210 0.32% 127 36227 0.32% 128 36648 0.33% 129 37815 0.34% 130 38826 0.35% 131 40164 0.36% 132 41594 0.37% 133 44040 0.39% 134 45835 0.41% 135 47538 0.43% 136 50031 0.45% 137 52608 0.47% 138 54616 0.49% 139 56713 0.51% 140 60684 0.54% 141 64635 0.58% 142 70139 0.63% 143 77868 0.70% 144 88997 0.80% 145 102915 0.92% 146 128792 1.15% 147 168342 1.51% 148 259578 2.33% 149 526850 4.72% 150 2779784 24.92% 151 5492861 49.24% 11155835 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=35 prefix-density=0.68 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=43.70 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.3 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=31 prefix-density=0.87 prefix-fanout=1.9 sequence=AACCGCACCCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=59.03 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=10.4 sequence=AAAGAGATGAGGCCTAACGTAAGTATTGAATTCCTCTGGTGGCTCTCTTTAACTATCCTGCTGGTTTCTGTGATCACATCTACTTCTACAGCTGCCTTTCTTGAAAGCAACTCGAGCCCCATTTTCAATGCCACAATCGGTGAAGGTAATGAAGAGGAGTTCTCTATGGAATCTGAAGTGCATCAGAGACTGCTGGCCTATCCGGGTAATCATATTAACTATAAGACTTTAGAACGACAACAAGTTTGCAATGCACAAATGTATGGCAGCTGT SRR7168900 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:05:21 Started mapping on | Feb 10 11:05:21 Finished on | Feb 10 11:06:27 Mapping speed, Million of reads per hour | 608.50 Number of input reads | 11155835 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 10426743 Uniquely mapped reads % | 93.46% Average mapped length | 292.45 Number of splices: Total | 9781688 Number of splices: Annotated (sjdb) | 9579015 Number of splices: GT/AG | 9591592 Number of splices: GC/AG | 162305 Number of splices: AT/AC | 5326 Number of splices: Non-canonical | 22465 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306843 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 72808 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 431196 431196 431196 N_multimapping 306843 306843 306843 N_noFeature 356699 10239959 457540 N_ambiguous 150582 812 64085 UnstrandedReadsAssigned:9919462 PositiveStrandReadsAssigned:185972 NegativeStrandReadsAssigned:9905118 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168900 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168900-trimmed-pair1.fastq SRR7168900-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,155,835 reads, 9,958,175 reads pseudoaligned [quant] estimated average fragment length: 230.191 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 995 rounds 52401 SRR7168900.ke.tsv 34699 SRR7168900.se.tsv 87100 total ==> SRR7168900.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.81 267 15.0317 Potri.005G024800.1.v4.1 1035 805.809 105 13.1226 Potri.004G059700.1.v4.1 961 731.859 4 0.550421 Potri.007G009000.2.v4.1 1416 1186.81 0 0 Potri.003G141000.2.v4.1 2943 2713.81 382 14.1758 Potri.016G087400.1.v4.1 270 85.4801 403 474.791 Potri.015G069301.1.v4.1 564 338.622 0 0 Potri.010G195200.1.v4.1 1773 1543.81 3 0.1957 Potri.012G127500.1.v4.1 977 747.834 309 41.6117 ==> SRR7168900.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 167 Potri.001G212900.v4.1 226 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 178 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7168900 completed mapping pipeline successfully