Starting /dee2/code/volunteer_pipeline.sh SRR7168938 current disk space = 3058901159936 free memory = 1494018868 SRR7168938 SRAfilesize ee12e6b83a00c6fd2267e7c11ced1262 SRR7168938.sra SRR7168938.sra file validated SRR7168938 is paired end SRR7168938 is conventional basespace SRR7168938 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168938_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93075 34.0 33.0 34.0 33.0 34.0 2 33.4145 34.0 34.0 34.0 33.0 34.0 3 33.455 34.0 34.0 34.0 33.0 34.0 4 33.4835 34.0 34.0 34.0 33.0 34.0 5 33.478 34.0 34.0 34.0 33.0 34.0 6 37.178 38.0 38.0 38.0 36.0 38.0 7 37.47875 38.0 38.0 38.0 37.0 38.0 8 37.51425 38.0 38.0 38.0 38.0 38.0 9 37.5575 38.0 38.0 38.0 38.0 38.0 10-14 37.5355 38.0 38.0 38.0 38.0 38.0 15-19 37.589 38.0 38.0 38.0 38.0 38.0 20-24 37.56755 38.0 38.0 38.0 38.0 38.0 25-29 37.511199999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.4845 38.0 38.0 38.0 38.0 38.0 35-39 37.40835 38.0 38.0 38.0 37.0 38.0 40-44 37.31269999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.3249 38.0 38.0 38.0 37.0 38.0 50-54 37.30775 38.0 38.0 38.0 37.0 38.0 55-59 37.30485 38.0 38.0 38.0 37.0 38.0 60-64 37.1945 38.0 38.0 38.0 36.2 38.0 65-69 37.179950000000005 38.0 38.0 38.0 36.2 38.0 70-74 37.178 38.0 38.0 38.0 36.2 38.0 75-79 37.07620000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.998599999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.959500000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.85185 38.0 38.0 38.0 35.6 38.0 95-99 36.8236 38.0 38.0 38.0 35.2 38.0 100-104 36.62865000000001 38.0 38.0 38.0 34.4 38.0 105-109 36.61755000000001 38.0 38.0 38.0 34.6 38.0 110-114 36.422450000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.3212 38.0 38.0 38.0 34.0 38.0 120-124 36.07234999999999 38.0 37.8 38.0 33.0 38.0 125-129 35.9661 38.0 37.0 38.0 33.2 38.0 130-134 35.747049999999994 38.0 36.4 38.0 32.0 38.0 135-139 35.5225 38.0 36.2 38.0 31.6 38.0 140-144 35.09805 38.0 36.0 38.0 29.4 38.0 145-149 34.698449999999994 38.0 35.6 38.0 28.0 38.0 150-151 31.855874999999997 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 3.0 15 1.0 16 1.0 17 3.0 18 0.0 19 3.0 20 2.0 21 3.0 22 4.0 23 2.0 24 9.0 25 10.0 26 17.0 27 23.0 28 21.0 29 22.0 30 44.0 31 42.0 32 63.0 33 82.0 34 96.0 35 219.0 36 485.0 37 2844.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.146496815286625 12.178343949044585 8.433121019108281 42.24203821656051 2 21.475 16.175 36.85 25.5 3 19.0 21.025 25.7 34.275 4 22.075 29.549999999999997 22.875 25.5 5 22.45 33.675 23.95 19.925 6 18.15 36.35 25.224999999999998 20.275000000000002 7 14.625 25.724999999999998 41.9 17.75 8 17.424999999999997 26.075 31.35 25.15 9 16.225 24.05 34.625 25.1 10-14 19.485 30.335 27.42 22.759999999999998 15-19 20.064999999999998 28.845 27.189999999999998 23.9 20-24 19.525000000000002 28.825 27.72 23.93 25-29 19.285 29.425 27.73 23.56 30-34 20.095 29.020000000000003 27.465 23.419999999999998 35-39 19.735 28.42 28.044999999999998 23.799999999999997 40-44 19.485 29.125 27.735 23.655 45-49 19.900000000000002 28.975 26.665 24.46 50-54 19.665 29.28 27.255000000000003 23.799999999999997 55-59 19.91 29.12 27.200000000000003 23.77 60-64 20.11 28.544999999999998 27.22 24.125 65-69 19.765 28.51 27.860000000000003 23.865 70-74 20.06 29.085 27.43 23.425 75-79 19.985 28.050000000000004 27.634999999999998 24.33 80-84 20.285 28.525 27.339999999999996 23.849999999999998 85-89 19.695 28.505000000000003 27.79 24.01 90-94 19.64 28.705000000000002 27.334999999999997 24.32 95-99 19.875 28.945 27.79 23.39 100-104 20.215 28.449999999999996 27.805000000000003 23.53 105-109 20.075000000000003 29.065 27.405 23.455000000000002 110-114 20.005 28.560000000000002 27.405 24.03 115-119 20.02 29.265 27.0 23.715 120-124 20.03 28.005000000000003 27.735 24.23 125-129 19.950000000000003 28.765 27.894999999999996 23.39 130-134 20.355 28.68 27.675 23.29 135-139 20.419999999999998 28.965000000000003 27.42 23.195 140-144 20.119999999999997 27.975 27.705000000000002 24.2 145-149 19.919999999999998 28.694999999999997 27.529999999999998 23.855 150-151 20.962500000000002 27.875 27.287499999999998 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.5 26 4.5 27 4.5 28 8.5 29 17.5 30 22.5 31 28.0 32 27.5 33 33.5 34 55.0 35 70.0 36 89.0 37 114.0 38 133.0 39 166.0 40 191.0 41 213.5 42 241.5 43 272.5 44 291.5 45 280.5 46 281.0 47 270.5 48 230.0 49 193.5 50 163.0 51 141.5 52 126.5 53 93.5 54 64.0 55 45.0 56 29.5 57 22.5 58 23.5 59 17.5 60 10.0 61 7.0 62 3.0 63 1.0 64 0.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.6499999999999999 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.575 0.0 0.0 0.0 0.0 138-139 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTCT 10 0.006832588 144.9875 4 >>END_MODULE SRR7168938 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168938_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97825 33.0 33.0 34.0 32.0 34.0 2 33.127 34.0 33.0 34.0 33.0 34.0 3 33.12425 34.0 33.0 34.0 33.0 34.0 4 33.10075 34.0 33.0 34.0 33.0 34.0 5 33.079 34.0 33.0 34.0 33.0 34.0 6 37.33575 38.0 38.0 38.0 37.0 38.0 7 37.3075 38.0 38.0 38.0 37.0 38.0 8 37.32675 38.0 38.0 38.0 37.0 38.0 9 37.365 38.0 38.0 38.0 37.0 38.0 10-14 37.3223 38.0 38.0 38.0 37.0 38.0 15-19 37.265699999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.25045 38.0 38.0 38.0 37.0 38.0 25-29 37.2029 38.0 38.0 38.0 37.0 38.0 30-34 37.2246 38.0 38.0 38.0 37.0 38.0 35-39 37.154399999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.106100000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.0814 38.0 38.0 38.0 36.6 38.0 50-54 37.040350000000004 38.0 38.0 38.0 36.2 38.0 55-59 37.058049999999994 38.0 38.0 38.0 36.2 38.0 60-64 36.95375 38.0 38.0 38.0 36.0 38.0 65-69 36.9468 38.0 38.0 38.0 36.0 38.0 70-74 36.886300000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.783 38.0 38.0 38.0 35.6 38.0 80-84 36.70375 38.0 38.0 38.0 35.2 38.0 85-89 36.65815 38.0 38.0 38.0 35.0 38.0 90-94 36.4733 38.0 38.0 38.0 34.0 38.0 95-99 36.36735 38.0 38.0 38.0 34.0 38.0 100-104 36.19525 38.0 38.0 38.0 33.6 38.0 105-109 35.99575 38.0 37.4 38.0 33.0 38.0 110-114 35.8459 38.0 37.0 38.0 31.8 38.0 115-119 35.72795000000001 38.0 37.0 38.0 31.4 38.0 120-124 35.4381 38.0 36.6 38.0 30.6 38.0 125-129 35.23455 38.0 36.0 38.0 29.2 38.0 130-134 34.75655 38.0 35.6 38.0 27.2 38.0 135-139 34.3355 38.0 35.0 38.0 24.6 38.0 140-144 33.9378 38.0 35.0 38.0 22.6 38.0 145-149 33.250750000000004 38.0 34.2 38.0 18.0 38.0 150-151 29.014375 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 1.0 15 2.0 16 2.0 17 1.0 18 4.0 19 3.0 20 7.0 21 7.0 22 10.0 23 16.0 24 16.0 25 19.0 26 22.0 27 35.0 28 37.0 29 34.0 30 44.0 31 43.0 32 72.0 33 91.0 34 139.0 35 238.0 36 614.0 37 2528.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.4 19.8 13.925 30.875000000000004 2 26.18809404702351 25.137568784392194 33.04152076038019 15.632816408204103 3 20.175219023779725 26.883604505632043 32.841051314142675 20.100125156445557 4 22.992244183137352 33.149862396797594 24.11808856642482 19.73980485364023 5 24.5995995995996 36.16116116116116 22.67267267267267 16.566566566566568 6 21.099999999999998 36.925000000000004 23.625 18.35 7 20.599999999999998 20.825 38.925 19.650000000000002 8 20.3 24.45 28.775000000000002 26.474999999999998 9 20.375 26.0 30.975 22.650000000000002 10-14 23.162316231623162 27.96279627962796 27.312731273127312 21.56215621562156 15-19 23.582970633848614 27.655210365701137 28.560708389614287 20.20111061083596 20-24 23.40468093618724 27.450490098019603 28.015603120624128 21.129225845169035 25-29 22.842995048266893 27.934777172010207 27.90476666833392 21.317461111388987 30-34 22.939999999999998 27.68 28.33 21.05 35-39 23.073075576451757 27.744710648727057 28.41494523083079 20.767268543990397 40-44 23.233485022753413 28.029204380657095 27.92918937840676 20.808121218182727 45-49 23.22348352252838 28.059208881332196 28.00920138020703 20.70810621593239 50-54 23.18 28.310000000000002 27.92 20.59 55-59 23.52117605880294 28.311415570778536 27.461373068653433 20.706035301765088 60-64 23.655913978494624 27.786946736684172 28.192048012003003 20.365091272818205 65-69 23.42851427714157 27.544131619742963 27.989198379756964 21.038155723358503 70-74 23.608262892012206 27.349572350322614 28.544990746761368 20.497174010903816 75-79 23.42319811934177 27.824738658530485 28.229880458160356 20.52218276396739 80-84 23.607360736073606 28.192819281928195 27.992799279927993 20.207020702070206 85-89 24.127412741274128 27.432743274327432 28.06280628062806 20.377037703770377 90-94 23.6735510326549 27.099064859728962 28.609291393709057 20.618092713907085 95-99 23.78618930946547 27.50637531876594 28.07140357017851 20.63603180159008 100-104 24.08 28.29 27.534999999999997 20.095 105-109 23.73 27.91 28.09 20.27 110-114 23.49 27.82 28.59 20.1 115-119 24.383534236982943 27.429600360126045 27.854749162206772 20.33211624068424 120-124 24.139483690214128 27.961777066239748 27.831699019411648 20.06704022413448 125-129 24.26577275228899 27.758042727773052 27.84309801370891 20.13308650622905 130-134 23.718557783667553 28.159223883582534 28.049207381107166 20.073010951642747 135-139 23.927392739273927 27.992799279927993 27.767776777677767 20.312031203120313 140-144 24.438553493722804 27.879757915270343 27.62466863402191 20.057019956984945 145-149 23.669467787114844 27.77110844337735 27.936174469787918 20.623249299719888 150-151 24.221583093660122 26.93510066274853 28.060522696011002 20.78279354758034 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.0 23 1.0 24 2.5 25 2.5 26 3.0 27 5.0 28 5.0 29 6.5 30 9.0 31 13.5 32 19.0 33 29.0 34 44.5 35 60.0 36 84.0 37 111.5 38 136.5 39 162.0 40 196.0 41 233.0 42 268.5 43 286.0 44 280.0 45 294.0 46 288.5 47 252.0 48 232.5 49 199.5 50 164.5 51 142.5 52 125.0 53 106.0 54 68.5 55 43.5 56 32.0 57 23.5 58 18.0 59 12.5 60 10.0 61 7.0 62 6.0 63 4.0 64 2.5 65 2.5 66 1.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.125 4 0.075 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.055 20-24 0.02 25-29 0.034999999999999996 30-34 0.0 35-39 0.034999999999999996 40-44 0.015 45-49 0.015 50-54 0.0 55-59 0.005 60-64 0.025 65-69 0.015 70-74 0.034999999999999996 75-79 0.034999999999999996 80-84 0.01 85-89 0.01 90-94 0.015 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.034999999999999996 120-124 0.06 125-129 0.065 130-134 0.015 135-139 0.01 140-144 0.034999999999999996 145-149 0.04 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.4249999999999998 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 20 0.0058679483 29.065823 15-19 >>END_MODULE Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955503 spots for SRR7168938.sra Written 955503 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra Read 955499 spots for SRR7168938.sra Written 955499 spots for SRR7168938.sra SRR ids: ['SRR7168938.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__tukxmef SRR7168938.sra spots: 19109984 blocks: [[1, 955499], [955500, 1910998], [1910999, 2866497], [2866498, 3821996], [3821997, 4777495], [4777496, 5732994], [5732995, 6688493], [6688494, 7643992], [7643993, 8599491], [8599492, 9554990], [9554991, 10510489], [10510490, 11465988], [11465989, 12421487], [12421488, 13376986], [13376987, 14332485], [14332486, 15287984], [15287985, 16243483], [16243484, 17198982], [17198983, 18154481], [18154482, 19109984]] SRR7168938 file size 6454046 SRR7168938 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168938 SRR7168938_1.fastq SRR7168938_2.fastq Input file: SRR7168938_1.fastq Paired file: SRR7168938_2.fastq trimmed: SRR7168938-trimmed-pair1.fastq, SRR7168938-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:16:13 2025 >> started Mon Feb 10 11:16:34 2025 >> done (21.359s) 19109984 read pairs processed; of these: 11435 ( 0.06%) short read pairs filtered out after trimming by size control 7172 ( 0.04%) empty read pairs filtered out after trimming by size control 19091377 (99.90%) read pairs available; of these: 7587917 (39.75%) trimmed read pairs available after processing 11503460 (60.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 5 0.00% 21 6 0.00% 22 6 0.00% 23 6 0.00% 24 5 0.00% 25 1 0.00% 26 4 0.00% 27 10 0.00% 28 4 0.00% 29 8 0.00% 30 7 0.00% 31 9 0.00% 32 4 0.00% 33 6 0.00% 34 5 0.00% 35 11 0.00% 36 8 0.00% 37 6 0.00% 38 11 0.00% 39 4 0.00% 40 8 0.00% 41 12 0.00% 42 7 0.00% 43 12 0.00% 44 11 0.00% 45 10 0.00% 46 11 0.00% 47 19 0.00% 48 18 0.00% 49 14 0.00% 50 23 0.00% 51 20 0.00% 52 27 0.00% 53 32 0.00% 54 30 0.00% 55 30 0.00% 56 39 0.00% 57 45 0.00% 58 33 0.00% 59 41 0.00% 60 47 0.00% 61 62 0.00% 62 74 0.00% 63 65 0.00% 64 75 0.00% 65 97 0.00% 66 112 0.00% 67 109 0.00% 68 124 0.00% 69 162 0.00% 70 188 0.00% 71 207 0.00% 72 226 0.00% 73 245 0.00% 74 276 0.00% 75 298 0.00% 76 367 0.00% 77 408 0.00% 78 410 0.00% 79 472 0.00% 80 593 0.00% 81 657 0.00% 82 767 0.00% 83 852 0.00% 84 1341 0.01% 85 1827 0.01% 86 2000 0.01% 87 2207 0.01% 88 2267 0.01% 89 2344 0.01% 90 2461 0.01% 91 2588 0.01% 92 2748 0.01% 93 3132 0.02% 94 3302 0.02% 95 3567 0.02% 96 3929 0.02% 97 4193 0.02% 98 4366 0.02% 99 4726 0.02% 100 4908 0.03% 101 5373 0.03% 102 5660 0.03% 103 5964 0.03% 104 6455 0.03% 105 6984 0.04% 106 7640 0.04% 107 8104 0.04% 108 8436 0.04% 109 8975 0.05% 110 9648 0.05% 111 10174 0.05% 112 11033 0.06% 113 11672 0.06% 114 12421 0.07% 115 13584 0.07% 116 14327 0.08% 117 15247 0.08% 118 16489 0.09% 119 16681 0.09% 120 17919 0.09% 121 19324 0.10% 122 20587 0.11% 123 21493 0.11% 124 23223 0.12% 125 24911 0.13% 126 26778 0.14% 127 28732 0.15% 128 30288 0.16% 129 32014 0.17% 130 34717 0.18% 131 37236 0.20% 132 40246 0.21% 133 43654 0.23% 134 46228 0.24% 135 50343 0.26% 136 54995 0.29% 137 59461 0.31% 138 65384 0.34% 139 71130 0.37% 140 78324 0.41% 141 87198 0.46% 142 97715 0.51% 143 114174 0.60% 144 133440 0.70% 145 161280 0.84% 146 202632 1.06% 147 274176 1.44% 148 415310 2.18% 149 825087 4.32% 150 4195672 21.98% 151 11503460 60.25% 19091377 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=44 prefix-density=0.14 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=253.91 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=28.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=42 prefix-density=0.33 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=255.29 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=28.7 sequence=AAGAAGAAGAAA SRR7168938 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:17:16 Started mapping on | Feb 10 11:17:17 Finished on | Feb 10 11:19:15 Mapping speed, Million of reads per hour | 582.45 Number of input reads | 19091377 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18360181 Uniquely mapped reads % | 96.17% Average mapped length | 297.26 Number of splices: Total | 18369892 Number of splices: Annotated (sjdb) | 18073557 Number of splices: GT/AG | 18094503 Number of splices: GC/AG | 221458 Number of splices: AT/AC | 14840 Number of splices: Non-canonical | 39091 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339180 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 30122 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.87% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 402820 402820 402820 N_multimapping 339180 339180 339180 N_noFeature 461563 18180775 556810 N_ambiguous 159763 1314 74549 UnstrandedReadsAssigned:17738855 PositiveStrandReadsAssigned:178092 NegativeStrandReadsAssigned:17728822 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168938 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168938-trimmed-pair1.fastq SRR7168938-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,091,377 reads, 17,582,933 reads pseudoaligned [quant] estimated average fragment length: 272.301 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7168938.ke.tsv 34699 SRR7168938.se.tsv 87100 total ==> SRR7168938.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.7 372 11.4951 Potri.005G024800.1.v4.1 1035 763.699 48 3.39239 Potri.004G059700.1.v4.1 961 689.791 5 0.391236 Potri.007G009000.2.v4.1 1416 1144.7 0 0 Potri.003G141000.2.v4.1 2943 2671.7 318.028 6.42489 Potri.016G087400.1.v4.1 270 63.6414 1473.53 1249.7 Potri.015G069301.1.v4.1 564 300.292 0 0 Potri.010G195200.1.v4.1 1773 1501.7 21 0.754785 Potri.012G127500.1.v4.1 977 705.739 8726 667.357 ==> SRR7168938.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 922 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168938 completed mapping pipeline successfully