Starting /dee2/code/volunteer_pipeline.sh SRR7168939 current disk space = 3058830761984 free memory = 1482548628 SRR7168939 SRAfilesize a52a6d9983c64f5c20eef2e5bf5e1854 SRR7168939.sra SRR7168939.sra file validated SRR7168939 is paired end SRR7168939 is conventional basespace SRR7168939 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168939_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2685 34.0 33.0 34.0 33.0 34.0 2 33.52325 34.0 34.0 34.0 33.0 34.0 3 33.50175 34.0 34.0 34.0 33.0 34.0 4 33.50075 34.0 34.0 34.0 33.0 34.0 5 33.486 34.0 34.0 34.0 33.0 34.0 6 37.16575 38.0 38.0 38.0 36.0 38.0 7 37.477 38.0 38.0 38.0 37.0 38.0 8 37.5155 38.0 38.0 38.0 37.0 38.0 9 37.52525 38.0 38.0 38.0 38.0 38.0 10-14 37.53075 38.0 38.0 38.0 37.8 38.0 15-19 37.52645 38.0 38.0 38.0 37.6 38.0 20-24 37.50925 38.0 38.0 38.0 38.0 38.0 25-29 37.46495 38.0 38.0 38.0 37.8 38.0 30-34 37.448600000000006 38.0 38.0 38.0 37.4 38.0 35-39 37.3617 38.0 38.0 38.0 37.0 38.0 40-44 37.277699999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.21995 38.0 38.0 38.0 36.6 38.0 50-54 37.17985 38.0 38.0 38.0 36.2 38.0 55-59 37.13164999999999 38.0 38.0 38.0 36.0 38.0 60-64 37.11625 38.0 38.0 38.0 36.0 38.0 65-69 37.01145 38.0 38.0 38.0 36.0 38.0 70-74 36.94025 38.0 38.0 38.0 36.0 38.0 75-79 36.9319 38.0 38.0 38.0 36.0 38.0 80-84 36.800200000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.7802 38.0 38.0 38.0 35.0 38.0 90-94 36.70895 38.0 38.0 38.0 34.8 38.0 95-99 36.63100000000001 38.0 38.0 38.0 34.6 38.0 100-104 36.4913 38.0 38.0 38.0 34.0 38.0 105-109 36.392649999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.128550000000004 38.0 37.6 38.0 33.4 38.0 115-119 36.04815 38.0 37.0 38.0 33.2 38.0 120-124 36.02015 38.0 37.0 38.0 33.4 38.0 125-129 35.7061 38.0 36.8 38.0 31.6 38.0 130-134 35.49135 38.0 36.0 38.0 31.0 38.0 135-139 35.350849999999994 38.0 36.0 38.0 31.0 38.0 140-144 34.9061 38.0 35.6 38.0 28.2 38.0 145-149 34.552 38.0 35.4 38.0 27.8 38.0 150-151 32.057249999999996 37.0 33.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 4.0 13 2.0 14 0.0 15 2.0 16 3.0 17 0.0 18 2.0 19 4.0 20 6.0 21 4.0 22 2.0 23 10.0 24 8.0 25 10.0 26 15.0 27 12.0 28 22.0 29 22.0 30 38.0 31 53.0 32 67.0 33 92.0 34 125.0 35 238.0 36 574.0 37 2683.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.36317780580076 11.853720050441362 9.407313997477932 34.37578814627995 2 22.125 15.525 35.475 26.875 3 19.675 21.975 27.05 31.3 4 22.45 29.575000000000003 22.7 25.275 5 21.75 34.1 24.825 19.325 6 19.5 36.05 25.1 19.35 7 15.325 25.275 41.825 17.575 8 18.5 25.25 31.45 24.8 9 18.175 25.025 32.800000000000004 24.0 10-14 20.015 29.330000000000002 27.435 23.22 15-19 19.955000000000002 28.7 27.810000000000002 23.535 20-24 20.09 28.87 27.83 23.21 25-29 20.24 28.83 27.18 23.75 30-34 20.187018701870187 28.97789778977898 27.247724772477248 23.587358735873586 35-39 20.175 29.160000000000004 27.005000000000003 23.66 40-44 20.669999999999998 28.415000000000003 27.445000000000004 23.47 45-49 20.01 29.04 27.310000000000002 23.64 50-54 19.814999999999998 28.754999999999995 27.655 23.775 55-59 20.44 28.08 27.779999999999998 23.7 60-64 20.015 28.965000000000003 27.505000000000003 23.515 65-69 20.119999999999997 28.465 27.625 23.79 70-74 19.78 28.345 28.044999999999998 23.830000000000002 75-79 20.64 28.235 27.045 24.08 80-84 20.935000000000002 28.82 27.215 23.03 85-89 20.064999999999998 28.360000000000003 27.67 23.905 90-94 20.315 28.04 27.250000000000004 24.395 95-99 20.165 29.24 27.175 23.419999999999998 100-104 20.385 28.895 27.41 23.31 105-109 21.195 28.1 27.439999999999998 23.265 110-114 21.105 28.15 27.345000000000002 23.400000000000002 115-119 20.345 28.444999999999997 27.76 23.45 120-124 20.995 28.15 27.315 23.54 125-129 20.745 27.61 28.18 23.465 130-134 20.880000000000003 28.02 26.91 24.19 135-139 20.49 28.685 27.450000000000003 23.375 140-144 21.38 28.175 26.950000000000003 23.494999999999997 145-149 21.385 28.660000000000004 26.735 23.22 150-151 20.625 27.987499999999997 27.150000000000002 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 3.0 22 3.0 23 1.0 24 3.0 25 4.5 26 3.0 27 8.5 28 11.0 29 12.0 30 16.5 31 20.0 32 33.5 33 47.5 34 47.0 35 59.5 36 86.0 37 105.5 38 129.0 39 140.5 40 178.0 41 221.5 42 259.0 43 276.0 44 279.0 45 284.0 46 266.5 47 239.5 48 226.5 49 222.0 50 180.0 51 138.5 52 119.0 53 89.0 54 69.5 55 64.5 56 40.5 57 28.0 58 20.0 59 14.5 60 14.0 61 8.5 62 5.5 63 3.5 64 3.0 65 3.5 66 2.5 67 2.0 68 1.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.925 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.2625000000000002 0.0125 0.0 0.0 0.0 128-129 1.475 0.025 0.0 0.0 0.0 130-131 1.5875 0.025 0.0 0.0 0.0 132-133 1.7000000000000002 0.025 0.0 0.0 0.0 134-135 1.85 0.025 0.0 0.0 0.0 136-137 2.075 0.025 0.0 0.0 0.0 138-139 2.3625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGAAA 10 0.0068343505 144.975 145 >>END_MODULE SRR7168939 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168939_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92625 33.0 33.0 34.0 32.0 34.0 2 33.01125 34.0 33.0 34.0 32.0 34.0 3 33.06225 34.0 33.0 34.0 33.0 34.0 4 32.97375 34.0 33.0 34.0 32.0 34.0 5 33.0125 34.0 33.0 34.0 33.0 34.0 6 37.23875 38.0 38.0 38.0 37.0 38.0 7 37.226 38.0 38.0 38.0 37.0 38.0 8 37.21275 38.0 38.0 38.0 37.0 38.0 9 37.16675 38.0 38.0 38.0 37.0 38.0 10-14 37.209900000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.18085000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.107749999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.13445 38.0 38.0 38.0 37.0 38.0 30-34 37.14385 38.0 38.0 38.0 37.0 38.0 35-39 37.101099999999995 38.0 38.0 38.0 36.8 38.0 40-44 37.0763 38.0 38.0 38.0 36.8 38.0 45-49 37.03705 38.0 38.0 38.0 36.6 38.0 50-54 36.985499999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.97975 38.0 38.0 38.0 36.0 38.0 60-64 36.8898 38.0 38.0 38.0 36.0 38.0 65-69 36.8597 38.0 38.0 38.0 36.0 38.0 70-74 36.7566 38.0 38.0 38.0 35.6 38.0 75-79 36.65935 38.0 38.0 38.0 35.2 38.0 80-84 36.57845 38.0 38.0 38.0 34.6 38.0 85-89 36.491 38.0 38.0 38.0 34.2 38.0 90-94 36.405649999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.287349999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.165049999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.0576 38.0 38.0 38.0 33.8 38.0 110-114 35.8127 38.0 37.2 38.0 33.0 38.0 115-119 35.62405 38.0 37.0 38.0 31.0 38.0 120-124 35.3867 38.0 36.8 38.0 30.0 38.0 125-129 35.112049999999996 38.0 36.0 38.0 28.6 38.0 130-134 34.7328 38.0 35.8 38.0 27.2 38.0 135-139 34.459050000000005 38.0 35.0 38.0 25.8 38.0 140-144 33.92035 38.0 35.0 38.0 23.0 38.0 145-149 33.45385 38.0 35.0 38.0 19.6 38.0 150-151 30.008875 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 2.0 6 0.0 7 1.0 8 0.0 9 2.0 10 2.0 11 2.0 12 2.0 13 1.0 14 2.0 15 5.0 16 9.0 17 5.0 18 11.0 19 1.0 20 7.0 21 9.0 22 17.0 23 8.0 24 12.0 25 11.0 26 20.0 27 23.0 28 24.0 29 23.0 30 54.0 31 69.0 32 57.0 33 99.0 34 136.0 35 243.0 36 565.0 37 2571.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.85 20.849999999999998 13.375 25.924999999999997 2 26.101101101101097 26.05105105105105 30.755755755755754 17.09209209209209 3 21.907861792689033 27.591387080620933 30.771156735102657 19.729594391587383 4 23.109664496745115 35.02754131196795 22.383575363044567 19.479218828242363 5 23.28492739108663 36.20430645968953 22.30846269404106 18.202303455182776 6 19.475 36.475 23.974999999999998 20.075000000000003 7 19.175 21.025 38.95 20.849999999999998 8 21.175 24.325 29.299999999999997 25.2 9 21.45 24.65 30.45 23.45 10-14 23.115 28.494999999999997 26.55 21.84 15-19 22.941058741118784 27.329130391273893 28.184729310517366 21.54508155708996 20-24 22.875718929732432 27.901975493873472 28.052013003250813 21.170292573143286 25-29 22.76182854856457 27.978393518055416 28.023407022106632 21.236370911273383 30-34 23.122312231223123 27.732773277327734 27.527752775277527 21.61716171617162 35-39 22.6 27.91 28.405 21.085 40-44 22.667266726672665 28.48284828482848 27.71277127712771 21.137113711371136 45-49 22.62 27.88 28.16 21.34 50-54 22.706135306765336 28.086404320216012 27.996399819990998 21.211060553027654 55-59 23.0 27.779999999999998 27.93 21.29 60-64 23.549999999999997 27.800000000000004 27.905 20.745 65-69 23.12615630781539 27.60138006900345 28.14140707035352 21.13105655282764 70-74 23.599999999999998 28.265 27.405 20.73 75-79 23.275000000000002 26.889999999999997 28.689999999999998 21.145 80-84 22.89114455722786 27.51137556877844 28.711435571778587 20.88604430221511 85-89 23.555 27.705000000000002 28.095 20.645 90-94 23.615 27.634999999999998 28.02 20.73 95-99 23.419999999999998 28.134999999999998 27.765 20.68 100-104 23.599999999999998 27.26 28.105000000000004 21.035 105-109 23.244999999999997 27.689999999999998 28.444999999999997 20.62 110-114 23.405 27.339999999999996 28.34 20.915 115-119 23.94 27.935 28.12 20.005 120-124 23.41351202680402 27.784167625143773 27.649147372105816 21.15317297594639 125-129 23.775 27.935 27.905 20.385 130-134 23.51 27.589999999999996 28.42 20.48 135-139 24.02 27.415 27.865000000000002 20.7 140-144 23.849999999999998 27.685 27.889999999999997 20.575 145-149 24.38 27.685 27.74 20.195 150-151 23.5125 27.3875 28.125 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.0 23 1.5 24 1.5 25 3.0 26 3.5 27 5.0 28 4.0 29 7.0 30 14.0 31 17.0 32 25.0 33 31.5 34 38.0 35 50.0 36 71.5 37 95.0 38 131.0 39 168.5 40 191.0 41 220.5 42 261.5 43 276.0 44 290.0 45 299.5 46 282.5 47 270.5 48 244.5 49 208.0 50 179.5 51 156.5 52 125.5 53 88.0 54 57.5 55 42.0 56 35.5 57 29.5 58 22.0 59 15.5 60 8.5 61 6.0 62 4.0 63 2.5 64 3.5 65 5.0 66 3.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.15 4 0.15 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.06999999999999999 20-24 0.025 25-29 0.03 30-34 0.01 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.9125 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.2625000000000002 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.8625 0.0 0.0 0.0 0.0 136-137 2.05 0.0 0.0 0.0 0.0 138-139 2.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805949 spots for SRR7168939.sra Written 805949 spots for SRR7168939.sra Read 805960 spots for SRR7168939.sra Written 805960 spots for SRR7168939.sra SRR ids: ['SRR7168939.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_izlx8h0e SRR7168939.sra spots: 16118991 blocks: [[1, 805949], [805950, 1611898], [1611899, 2417847], [2417848, 3223796], [3223797, 4029745], [4029746, 4835694], [4835695, 5641643], [5641644, 6447592], [6447593, 7253541], [7253542, 8059490], [8059491, 8865439], [8865440, 9671388], [9671389, 10477337], [10477338, 11283286], [11283287, 12089235], [12089236, 12895184], [12895185, 13701133], [13701134, 14507082], [14507083, 15313031], [15313032, 16118991]] SRR7168939 file size 5440496 SRR7168939 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168939 SRR7168939_1.fastq SRR7168939_2.fastq Input file: SRR7168939_1.fastq Paired file: SRR7168939_2.fastq trimmed: SRR7168939-trimmed-pair1.fastq, SRR7168939-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:09:10 2025 >> started Mon Feb 10 11:09:37 2025 >> done (27.192s) 16118991 read pairs processed; of these: 19325 ( 0.12%) short read pairs filtered out after trimming by size control 15450 ( 0.10%) empty read pairs filtered out after trimming by size control 16084216 (99.78%) read pairs available; of these: 6397810 (39.78%) trimmed read pairs available after processing 9686406 (60.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 7 0.00% 21 7 0.00% 22 4 0.00% 23 10 0.00% 24 5 0.00% 25 6 0.00% 26 4 0.00% 27 9 0.00% 28 7 0.00% 29 4 0.00% 30 11 0.00% 31 7 0.00% 32 5 0.00% 33 5 0.00% 34 6 0.00% 35 14 0.00% 36 16 0.00% 37 12 0.00% 38 8 0.00% 39 11 0.00% 40 12 0.00% 41 16 0.00% 42 9 0.00% 43 11 0.00% 44 8 0.00% 45 16 0.00% 46 20 0.00% 47 20 0.00% 48 22 0.00% 49 23 0.00% 50 28 0.00% 51 37 0.00% 52 24 0.00% 53 44 0.00% 54 34 0.00% 55 44 0.00% 56 52 0.00% 57 62 0.00% 58 62 0.00% 59 79 0.00% 60 91 0.00% 61 91 0.00% 62 107 0.00% 63 103 0.00% 64 123 0.00% 65 131 0.00% 66 158 0.00% 67 161 0.00% 68 192 0.00% 69 254 0.00% 70 275 0.00% 71 266 0.00% 72 331 0.00% 73 359 0.00% 74 435 0.00% 75 428 0.00% 76 475 0.00% 77 540 0.00% 78 587 0.00% 79 689 0.00% 80 813 0.01% 81 904 0.01% 82 1033 0.01% 83 1187 0.01% 84 2017 0.01% 85 2418 0.02% 86 2617 0.02% 87 2650 0.02% 88 2898 0.02% 89 3061 0.02% 90 3125 0.02% 91 3338 0.02% 92 3565 0.02% 93 3809 0.02% 94 4093 0.03% 95 4242 0.03% 96 4441 0.03% 97 4672 0.03% 98 5027 0.03% 99 5410 0.03% 100 5545 0.03% 101 6001 0.04% 102 6552 0.04% 103 6846 0.04% 104 7251 0.05% 105 7874 0.05% 106 8548 0.05% 107 8627 0.05% 108 9046 0.06% 109 9756 0.06% 110 9991 0.06% 111 10822 0.07% 112 11612 0.07% 113 12078 0.08% 114 13206 0.08% 115 14080 0.09% 116 14674 0.09% 117 15818 0.10% 118 16662 0.10% 119 17139 0.11% 120 18204 0.11% 121 19237 0.12% 122 20634 0.13% 123 21810 0.14% 124 23222 0.14% 125 24716 0.15% 126 25872 0.16% 127 27752 0.17% 128 29253 0.18% 129 30623 0.19% 130 32737 0.20% 131 35029 0.22% 132 38207 0.24% 133 40544 0.25% 134 43747 0.27% 135 46832 0.29% 136 50717 0.32% 137 54879 0.34% 138 60098 0.37% 139 65059 0.40% 140 71748 0.45% 141 79541 0.49% 142 87699 0.55% 143 100415 0.62% 144 116152 0.72% 145 140157 0.87% 146 172294 1.07% 147 233190 1.45% 148 350533 2.18% 149 681186 4.24% 150 3375689 20.99% 151 9686406 60.22% 16084216 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=309.27 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=26 prefix-density=0.26 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.15 sequence-density-rank=13 fanout-score=44.13 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=12.5 sequence=TGTTGGTGGTGGTACTGGA SRR7168939 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:10:20 Started mapping on | Feb 10 11:10:20 Finished on | Feb 10 11:12:02 Mapping speed, Million of reads per hour | 567.68 Number of input reads | 16084216 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15313820 Uniquely mapped reads % | 95.21% Average mapped length | 296.55 Number of splices: Total | 14632783 Number of splices: Annotated (sjdb) | 14407206 Number of splices: GT/AG | 14430855 Number of splices: GC/AG | 159553 Number of splices: AT/AC | 11138 Number of splices: Non-canonical | 31237 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285311 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 24064 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 502116 502116 502116 N_multimapping 285311 285311 285311 N_noFeature 349501 15155352 422227 N_ambiguous 151564 744 65316 UnstrandedReadsAssigned:14812755 PositiveStrandReadsAssigned:157724 NegativeStrandReadsAssigned:14826277 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168939 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168939-trimmed-pair1.fastq SRR7168939-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,084,216 reads, 14,700,912 reads pseudoaligned [quant] estimated average fragment length: 265.781 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR7168939.ke.tsv 34699 SRR7168939.se.tsv 87100 total ==> SRR7168939.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.22 286 11.1211 Potri.005G024800.1.v4.1 1035 770.219 29 2.56687 Potri.004G059700.1.v4.1 961 696.307 1 0.0979082 Potri.007G009000.2.v4.1 1416 1151.22 0 0 Potri.003G141000.2.v4.1 2943 2678.22 255 6.49103 Potri.016G087400.1.v4.1 270 66.9232 981 999.338 Potri.015G069301.1.v4.1 564 306.104 0 0 Potri.010G195200.1.v4.1 1773 1508.22 7 0.316412 Potri.012G127500.1.v4.1 977 712.249 3500 335.009 ==> SRR7168939.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1124 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 150 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168939 completed mapping pipeline successfully