Starting /dee2/code/volunteer_pipeline.sh SRR7168940 current disk space = 3058901463040 free memory = 1447635896 SRR7168940 SRAfilesize 61a9bfc6f020c6ab0a8a57b7f9c6c3e3 SRR7168940.sra SRR7168940.sra file validated SRR7168940 is paired end SRR7168940 is conventional basespace SRR7168940 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168940_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.216 34.0 34.0 34.0 33.0 34.0 2 33.453 34.0 34.0 34.0 33.0 34.0 3 33.442 34.0 34.0 34.0 33.0 34.0 4 33.49 34.0 34.0 34.0 33.0 34.0 5 33.46325 34.0 34.0 34.0 33.0 34.0 6 37.0955 38.0 37.0 38.0 36.0 38.0 7 37.3825 38.0 38.0 38.0 37.0 38.0 8 37.439 38.0 38.0 38.0 37.0 38.0 9 37.53625 38.0 38.0 38.0 37.0 38.0 10-14 37.513549999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.490700000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.48965 38.0 38.0 38.0 37.6 38.0 25-29 37.4765 38.0 38.0 38.0 37.8 38.0 30-34 37.41054999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.3377 38.0 38.0 38.0 37.0 38.0 40-44 37.21705 38.0 38.0 38.0 36.4 38.0 45-49 37.1629 38.0 38.0 38.0 36.0 38.0 50-54 37.13955 38.0 38.0 38.0 36.0 38.0 55-59 37.09439999999999 38.0 38.0 38.0 36.0 38.0 60-64 37.029450000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.0221 38.0 38.0 38.0 36.0 38.0 70-74 37.0118 38.0 38.0 38.0 36.0 38.0 75-79 36.9265 38.0 38.0 38.0 35.8 38.0 80-84 36.8414 38.0 38.0 38.0 35.0 38.0 85-89 36.755700000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.739 38.0 38.0 38.0 35.0 38.0 95-99 36.587199999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.5142 38.0 38.0 38.0 34.0 38.0 105-109 36.417350000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.20285 38.0 37.6 38.0 33.4 38.0 115-119 36.141149999999996 38.0 37.2 38.0 33.4 38.0 120-124 35.989599999999996 38.0 37.0 38.0 32.6 38.0 125-129 35.745050000000006 38.0 36.8 38.0 31.6 38.0 130-134 35.549549999999996 38.0 36.0 38.0 31.0 38.0 135-139 35.31825 38.0 36.0 38.0 30.6 38.0 140-144 34.8503 38.0 35.6 38.0 28.2 38.0 145-149 34.44235 38.0 35.0 38.0 27.8 38.0 150-151 31.451125 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 1.0 15 2.0 16 0.0 17 2.0 18 6.0 19 3.0 20 5.0 21 4.0 22 7.0 23 7.0 24 7.0 25 16.0 26 12.0 27 20.0 28 25.0 29 29.0 30 39.0 31 42.0 32 65.0 33 74.0 34 132.0 35 215.0 36 625.0 37 2659.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.35795311318376 12.956894378623646 11.217544744139147 35.46760776405344 2 22.725 16.1 32.475 28.7 3 19.875 22.6 25.874999999999996 31.65 4 22.75 28.4 22.575 26.275 5 22.075 34.050000000000004 23.625 20.25 6 21.075 35.449999999999996 23.875 19.6 7 15.575 25.924999999999997 41.525 16.975 8 18.75 25.85 29.925 25.474999999999998 9 17.575 25.424999999999997 33.2 23.799999999999997 10-14 20.32 29.615000000000002 26.965 23.1 15-19 19.895 29.32 26.75 24.035 20-24 20.28 28.89 27.365000000000002 23.465 25-29 19.61 29.299999999999997 27.045 24.044999999999998 30-34 19.82599129956498 29.141457072853644 27.061353067653382 23.971198559928 35-39 20.06 29.07 27.315 23.555 40-44 20.255000000000003 29.375 26.83 23.54 45-49 19.96 29.020000000000003 27.045 23.974999999999998 50-54 20.27 28.910000000000004 27.6 23.22 55-59 20.165 28.785 26.97 24.08 60-64 20.53 28.34 27.025 24.104999999999997 65-69 20.26 28.994999999999997 26.905 23.84 70-74 20.78 28.435 27.095000000000002 23.69 75-79 20.45 28.439999999999998 27.1 24.01 80-84 20.380000000000003 28.189999999999998 27.529999999999998 23.9 85-89 20.8 28.025 27.525 23.65 90-94 20.87 28.365000000000002 27.334999999999997 23.43 95-99 20.560000000000002 28.17 26.979999999999997 24.29 100-104 20.555 28.175 27.389999999999997 23.880000000000003 105-109 20.3 27.82 27.35 24.529999999999998 110-114 20.755000000000003 28.225 27.47 23.549999999999997 115-119 20.915 28.43 26.955000000000002 23.7 120-124 21.029999999999998 28.215 27.07 23.685000000000002 125-129 21.085 27.625 27.310000000000002 23.98 130-134 21.385 27.505000000000003 27.32 23.79 135-139 21.055 28.02 26.924999999999997 24.0 140-144 21.075 28.685 26.810000000000002 23.43 145-149 21.295 28.24 26.619999999999997 23.845 150-151 21.125 28.449999999999996 26.200000000000003 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 2.0 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 1.5 25 2.5 26 5.5 27 10.0 28 13.0 29 16.0 30 21.5 31 29.0 32 34.5 33 42.5 34 56.0 35 69.5 36 75.5 37 96.5 38 117.5 39 136.0 40 159.5 41 198.0 42 245.0 43 252.0 44 266.0 45 269.5 46 272.0 47 266.5 48 231.0 49 213.0 50 184.5 51 152.5 52 125.0 53 98.5 54 84.0 55 65.0 56 43.5 57 33.5 58 29.5 59 19.5 60 13.0 61 14.0 62 8.0 63 5.5 64 5.5 65 3.5 66 2.0 67 1.0 68 1.0 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.7125 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.9749999999999999 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 3.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACCAAA 10 0.006577216 146.82278 1 CAGAGGG 10 0.006832588 144.9875 4 TCAAAAC 10 0.006832588 144.9875 2 >>END_MODULE SRR7168940 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168940_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99175 33.0 33.0 34.0 32.0 34.0 2 33.0605 34.0 33.0 34.0 32.0 34.0 3 33.12025 34.0 33.0 34.0 33.0 34.0 4 33.07075 34.0 33.0 34.0 33.0 34.0 5 32.96825 34.0 33.0 34.0 32.0 34.0 6 37.239 38.0 38.0 38.0 37.0 38.0 7 37.3395 38.0 38.0 38.0 37.0 38.0 8 37.329 38.0 38.0 38.0 37.0 38.0 9 37.3295 38.0 38.0 38.0 37.0 38.0 10-14 37.294 38.0 38.0 38.0 37.0 38.0 15-19 37.22965000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.1365 38.0 38.0 38.0 37.0 38.0 25-29 37.179899999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.26045 38.0 38.0 38.0 37.0 38.0 35-39 37.137950000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.117900000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.03515 38.0 38.0 38.0 36.4 38.0 50-54 37.03065 38.0 38.0 38.0 36.4 38.0 55-59 36.9956 38.0 38.0 38.0 36.2 38.0 60-64 36.95645 38.0 38.0 38.0 36.0 38.0 65-69 36.89405 38.0 38.0 38.0 36.0 38.0 70-74 36.77355 38.0 38.0 38.0 36.0 38.0 75-79 36.766149999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.66825 38.0 38.0 38.0 35.0 38.0 85-89 36.59705 38.0 38.0 38.0 35.0 38.0 90-94 36.51845 38.0 38.0 38.0 34.2 38.0 95-99 36.38755 38.0 38.0 38.0 34.0 38.0 100-104 36.288399999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.1101 38.0 38.0 38.0 33.8 38.0 110-114 35.97245 38.0 37.6 38.0 33.2 38.0 115-119 35.7558 38.0 37.2 38.0 32.6 38.0 120-124 35.61155 38.0 37.0 38.0 31.6 38.0 125-129 35.27080000000001 38.0 36.0 38.0 30.2 38.0 130-134 35.0307 38.0 36.0 38.0 28.4 38.0 135-139 34.64695 38.0 35.2 38.0 27.8 38.0 140-144 34.159749999999995 38.0 35.0 38.0 23.6 38.0 145-149 33.72875 38.0 35.0 38.0 23.0 38.0 150-151 30.295 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 2.0 11 2.0 12 0.0 13 2.0 14 4.0 15 2.0 16 5.0 17 6.0 18 4.0 19 5.0 20 4.0 21 7.0 22 5.0 23 5.0 24 11.0 25 16.0 26 30.0 27 18.0 28 24.0 29 28.0 30 45.0 31 54.0 32 64.0 33 77.0 34 143.0 35 243.0 36 581.0 37 2599.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9 21.05 13.575000000000001 26.474999999999998 2 25.900900900900904 26.676676676676674 29.82982982982983 17.59259259259259 3 21.26220886551465 28.299524167292763 30.503380916604055 19.93488605058853 4 25.41948409717005 33.183070373153015 22.63961933383421 18.757826195842725 5 23.541197094916104 36.814425244177315 22.539444027047335 17.104933633859254 6 21.349999999999998 37.15 23.225 18.275 7 21.75 21.425 36.075 20.75 8 22.85 25.275 26.55 25.324999999999996 9 22.025 25.05 29.525000000000002 23.400000000000002 10-14 23.326166308315415 28.30641532076604 26.10130506525326 22.266113305665282 15-19 23.22125487841489 28.319823876713702 26.93385369758831 21.525067547283097 20-24 23.83476695339068 28.135627125425085 27.265453090618124 20.76415283056611 25-29 22.529505901180237 28.410682136427283 27.030406081216242 22.029405881176235 30-34 23.407340734073408 27.887788778877887 27.18771877187719 21.51715171517152 35-39 22.955000000000002 27.815 27.345000000000002 21.884999999999998 40-44 23.61618080904045 27.946397319865994 27.416370818540926 21.02105105255263 45-49 23.555 27.235 27.765 21.445 50-54 23.60118005900295 27.956397819890995 27.28636431821591 21.156057802890142 55-59 23.64 27.925 27.644999999999996 20.79 60-64 23.799999999999997 28.08 27.139999999999997 20.979999999999997 65-69 23.576178808940448 27.38136906845342 28.061403070153506 20.981049052452622 70-74 23.990000000000002 27.634999999999998 27.215 21.16 75-79 23.941197059852993 27.371368568428423 27.92139606980349 20.766038301915096 80-84 23.59617980899045 27.27636381819091 28.186409320466023 20.94104705235262 85-89 23.990000000000002 27.325 27.87 20.815 90-94 23.66 27.195000000000004 27.935 21.21 95-99 23.494999999999997 27.05 28.07 21.385 100-104 23.625 27.52 28.185 20.669999999999998 105-109 23.990000000000002 27.334999999999997 27.71 20.965 110-114 23.830000000000002 27.584999999999997 27.77 20.815 115-119 24.215 27.435 27.72 20.630000000000003 120-124 23.561178058902946 27.69638481924096 27.681384069203457 21.061053052652632 125-129 24.875 27.089999999999996 27.400000000000002 20.635 130-134 23.87 27.72 27.315 21.095 135-139 24.195 27.685 26.915 21.205 140-144 24.12 29.215000000000003 26.640000000000004 20.025000000000002 145-149 24.709999999999997 27.72 27.189999999999998 20.380000000000003 150-151 24.45 27.400000000000002 27.575 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.0 26 2.0 27 4.5 28 3.0 29 2.5 30 5.5 31 8.0 32 12.5 33 26.0 34 40.0 35 41.0 36 63.0 37 90.5 38 106.5 39 158.5 40 191.5 41 200.5 42 245.5 43 275.5 44 299.0 45 309.5 46 290.0 47 274.0 48 250.5 49 218.5 50 184.5 51 160.0 52 135.0 53 100.0 54 77.5 55 58.0 56 35.5 57 29.0 58 28.0 59 17.5 60 10.0 61 10.5 62 5.5 63 3.0 64 5.0 65 5.5 66 4.5 67 2.5 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.06999999999999999 20-24 0.02 25-29 0.02 30-34 0.01 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.7125 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 1.9875 0.0 0.0 0.0 0.0 132-133 2.25 0.0 0.0 0.0 0.0 134-135 2.45 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTCA 10 0.006830828 145.0 9 >>END_MODULE Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896124 spots for SRR7168940.sra Written 896124 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra Read 896114 spots for SRR7168940.sra Written 896114 spots for SRR7168940.sra SRR ids: ['SRR7168940.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yferog2y SRR7168940.sra spots: 17922290 blocks: [[1, 896114], [896115, 1792228], [1792229, 2688342], [2688343, 3584456], [3584457, 4480570], [4480571, 5376684], [5376685, 6272798], [6272799, 7168912], [7168913, 8065026], [8065027, 8961140], [8961141, 9857254], [9857255, 10753368], [10753369, 11649482], [11649483, 12545596], [12545597, 13441710], [13441711, 14337824], [14337825, 15233938], [15233939, 16130052], [16130053, 17026166], [17026167, 17922290]] SRR7168940 file size 6051575 SRR7168940 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168940 SRR7168940_1.fastq SRR7168940_2.fastq Input file: SRR7168940_1.fastq Paired file: SRR7168940_2.fastq trimmed: SRR7168940-trimmed-pair1.fastq, SRR7168940-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:24:28 2025 >> started Mon Feb 10 11:24:50 2025 >> done (21.656s) 17922290 read pairs processed; of these: 28030 ( 0.16%) short read pairs filtered out after trimming by size control 18024 ( 0.10%) empty read pairs filtered out after trimming by size control 17876236 (99.74%) read pairs available; of these: 7221451 (40.40%) trimmed read pairs available after processing 10654785 (59.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 2 0.00% 21 3 0.00% 22 5 0.00% 23 2 0.00% 24 2 0.00% 25 5 0.00% 26 3 0.00% 27 6 0.00% 28 3 0.00% 29 11 0.00% 30 8 0.00% 31 7 0.00% 32 9 0.00% 33 10 0.00% 34 13 0.00% 35 9 0.00% 36 11 0.00% 37 11 0.00% 38 9 0.00% 39 6 0.00% 40 15 0.00% 41 10 0.00% 42 11 0.00% 43 11 0.00% 44 17 0.00% 45 27 0.00% 46 22 0.00% 47 23 0.00% 48 24 0.00% 49 25 0.00% 50 26 0.00% 51 42 0.00% 52 28 0.00% 53 45 0.00% 54 53 0.00% 55 57 0.00% 56 55 0.00% 57 70 0.00% 58 62 0.00% 59 62 0.00% 60 85 0.00% 61 105 0.00% 62 104 0.00% 63 118 0.00% 64 144 0.00% 65 174 0.00% 66 180 0.00% 67 219 0.00% 68 286 0.00% 69 383 0.00% 70 413 0.00% 71 317 0.00% 72 314 0.00% 73 370 0.00% 74 408 0.00% 75 498 0.00% 76 484 0.00% 77 582 0.00% 78 653 0.00% 79 748 0.00% 80 864 0.00% 81 913 0.01% 82 1057 0.01% 83 1309 0.01% 84 2371 0.01% 85 3120 0.02% 86 3119 0.02% 87 3334 0.02% 88 3514 0.02% 89 3633 0.02% 90 3714 0.02% 91 4029 0.02% 92 4128 0.02% 93 4401 0.02% 94 4783 0.03% 95 5049 0.03% 96 5509 0.03% 97 5633 0.03% 98 5971 0.03% 99 6389 0.04% 100 6657 0.04% 101 7041 0.04% 102 7507 0.04% 103 8099 0.05% 104 8556 0.05% 105 9249 0.05% 106 9792 0.05% 107 10164 0.06% 108 10712 0.06% 109 11386 0.06% 110 11949 0.07% 111 12785 0.07% 112 13867 0.08% 113 14787 0.08% 114 15163 0.08% 115 16617 0.09% 116 17414 0.10% 117 18769 0.10% 118 19767 0.11% 119 20212 0.11% 120 21553 0.12% 121 22673 0.13% 122 24041 0.13% 123 25736 0.14% 124 27285 0.15% 125 29522 0.17% 126 31270 0.17% 127 33459 0.19% 128 34585 0.19% 129 36670 0.21% 130 39061 0.22% 131 41490 0.23% 132 44238 0.25% 133 47280 0.26% 134 50641 0.28% 135 54859 0.31% 136 59414 0.33% 137 64474 0.36% 138 70414 0.39% 139 75922 0.42% 140 82324 0.46% 141 91172 0.51% 142 100898 0.56% 143 114581 0.64% 144 131947 0.74% 145 158355 0.89% 146 194079 1.09% 147 263100 1.47% 148 392822 2.20% 149 765690 4.28% 150 3761148 21.04% 151 10654785 59.60% 17876236 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=44 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=97.29 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=15.7 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.03 fanout-score-rank=25 prefix-density=0.35 prefix-fanout=4.0 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=46 fanout-score=74.52 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=8.7 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGGCGGCCTCGCTTGGGCCACCACTGACCAAGTCCTCCAAGAGGCTTTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA SRR7168940 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:25:38 Started mapping on | Feb 10 11:25:39 Finished on | Feb 10 11:27:16 Mapping speed, Million of reads per hour | 663.45 Number of input reads | 17876236 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17053263 Uniquely mapped reads % | 95.40% Average mapped length | 296.44 Number of splices: Total | 16215413 Number of splices: Annotated (sjdb) | 15962323 Number of splices: GT/AG | 15983850 Number of splices: GC/AG | 185279 Number of splices: AT/AC | 12763 Number of splices: Non-canonical | 33521 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313383 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 33942 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 531034 531034 531034 N_multimapping 313383 313383 313383 N_noFeature 326448 16874972 390931 N_ambiguous 177968 927 63514 UnstrandedReadsAssigned:16548847 PositiveStrandReadsAssigned:177364 NegativeStrandReadsAssigned:16598818 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168940 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168940-trimmed-pair1.fastq SRR7168940-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,876,236 reads, 16,504,531 reads pseudoaligned [quant] estimated average fragment length: 251.752 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7168940.ke.tsv 34699 SRR7168940.se.tsv 87100 total ==> SRR7168940.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.25 305 8.88683 Potri.005G024800.1.v4.1 1035 784.248 40 2.62634 Potri.004G059700.1.v4.1 961 710.276 1 0.0724965 Potri.007G009000.2.v4.1 1416 1165.25 0 0 Potri.003G141000.2.v4.1 2943 2692.25 304.034 5.81503 Potri.016G087400.1.v4.1 270 69.0601 2133 1590.41 Potri.015G069301.1.v4.1 564 316.903 0 0 Potri.010G195200.1.v4.1 1773 1522.25 32 1.08245 Potri.012G127500.1.v4.1 977 726.276 7573 536.921 ==> SRR7168940.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1070 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168940 completed mapping pipeline successfully