Starting /dee2/code/volunteer_pipeline.sh SRR7168941 current disk space = 3058886365184 free memory = 1485093200 SRR7168941 SRAfilesize f704858738330d68ff8954591726da46 SRR7168941.sra SRR7168941.sra file validated SRR7168941 is paired end SRR7168941 is conventional basespace SRR7168941 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168941_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.602 34.0 34.0 34.0 33.0 34.0 2 33.69275 34.0 34.0 34.0 33.0 34.0 3 33.74125 34.0 34.0 34.0 33.0 34.0 4 33.7775 34.0 34.0 34.0 33.0 34.0 5 33.7185 34.0 34.0 34.0 33.0 34.0 6 37.448 38.0 38.0 38.0 37.0 38.0 7 37.68775 38.0 38.0 38.0 38.0 38.0 8 37.71525 38.0 38.0 38.0 38.0 38.0 9 37.59575 38.0 38.0 38.0 38.0 38.0 10-14 37.705200000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.711800000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.700849999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.62865 38.0 38.0 38.0 38.0 38.0 30-34 37.62675 38.0 38.0 38.0 38.0 38.0 35-39 37.543099999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.3848 38.0 38.0 38.0 37.6 38.0 45-49 37.365050000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.37025 38.0 38.0 38.0 37.0 38.0 55-59 37.2846 38.0 38.0 38.0 37.0 38.0 60-64 37.2953 38.0 38.0 38.0 37.0 38.0 65-69 37.207899999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.17135 38.0 38.0 38.0 36.6 38.0 75-79 37.0892 38.0 38.0 38.0 36.4 38.0 80-84 37.0068 38.0 38.0 38.0 36.0 38.0 85-89 36.978449999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.8695 38.0 38.0 38.0 35.8 38.0 95-99 36.79795 38.0 38.0 38.0 35.6 38.0 100-104 36.68195000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.55575 38.0 38.0 38.0 34.6 38.0 110-114 36.3805 38.0 38.0 38.0 34.2 38.0 115-119 36.2858 38.0 38.0 38.0 34.0 38.0 120-124 36.0729 38.0 37.8 38.0 33.8 38.0 125-129 35.88835 38.0 37.4 38.0 33.2 38.0 130-134 35.609 38.0 37.0 38.0 32.0 38.0 135-139 35.4094 38.0 36.0 38.0 31.0 38.0 140-144 35.13385 38.0 36.0 38.0 30.4 38.0 145-149 34.6449 38.0 35.8 38.0 28.0 38.0 150-151 31.782 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 1.0 11 1.0 12 1.0 13 0.0 14 2.0 15 0.0 16 4.0 17 2.0 18 3.0 19 1.0 20 1.0 21 7.0 22 10.0 23 7.0 24 6.0 25 13.0 26 12.0 27 21.0 28 24.0 29 15.0 30 31.0 31 34.0 32 41.0 33 61.0 34 104.0 35 152.0 36 517.0 37 2926.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.592072252885096 15.052684395383844 10.988459608630206 33.366783743100854 2 22.861430715357677 14.982491245622812 33.366683341670836 28.789394697348676 3 18.475 23.1 27.0 31.424999999999997 4 21.175 27.650000000000002 23.849999999999998 27.325 5 21.025 32.15 24.75 22.075 6 19.875 34.0 25.474999999999998 20.65 7 15.375 29.575000000000003 38.45 16.6 8 17.349999999999998 28.425 31.125000000000004 23.1 9 16.55 28.050000000000004 33.7 21.7 10-14 19.580000000000002 30.855 26.795 22.770000000000003 15-19 19.075 30.385 27.224999999999998 23.315 20-24 19.2 30.0 27.0 23.799999999999997 25-29 19.015 30.570000000000004 27.175 23.24 30-34 18.5 30.330000000000002 27.375 23.794999999999998 35-39 18.215 29.970000000000002 27.839999999999996 23.974999999999998 40-44 19.32 29.775000000000002 27.200000000000003 23.705000000000002 45-49 19.79 29.909999999999997 27.245 23.055 50-54 19.085 29.494999999999997 27.525 23.895 55-59 19.115 29.78 27.67 23.435 60-64 18.990000000000002 29.439999999999998 27.565 24.005000000000003 65-69 19.575 29.794999999999998 26.974999999999998 23.655 70-74 19.355 30.335 26.950000000000003 23.36 75-79 19.85 29.599999999999998 26.805 23.745 80-84 20.235 29.709999999999997 26.834999999999997 23.22 85-89 20.395 29.25 26.884999999999998 23.47 90-94 20.345 30.7 25.840000000000003 23.115 95-99 19.335 29.609999999999996 27.575 23.48 100-104 19.885 29.304999999999996 26.695 24.115000000000002 105-109 20.41 29.044999999999998 27.250000000000004 23.294999999999998 110-114 20.244999999999997 28.994999999999997 26.895000000000003 23.865 115-119 19.915 29.665000000000003 27.235 23.185 120-124 19.869999999999997 28.38 27.565 24.185000000000002 125-129 20.330000000000002 28.915000000000003 26.905 23.849999999999998 130-134 20.565 28.815 27.015 23.605 135-139 20.075000000000003 28.749999999999996 27.139999999999997 24.035 140-144 20.215 28.58 27.27 23.935000000000002 145-149 20.61 28.765 26.855 23.77 150-151 20.7625 28.3625 26.8125 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 3.0 20 2.5 21 3.0 22 4.5 23 5.0 24 5.5 25 10.0 26 13.5 27 12.5 28 21.5 29 30.5 30 38.0 31 44.0 32 46.5 33 60.5 34 77.5 35 96.0 36 117.5 37 135.5 38 151.0 39 164.0 40 183.0 41 217.5 42 226.5 43 228.5 44 240.0 45 241.5 46 241.0 47 226.0 48 189.0 49 156.5 50 147.5 51 132.5 52 106.0 53 89.5 54 77.5 55 60.0 56 45.0 57 37.5 58 32.5 59 20.0 60 10.0 61 8.0 62 8.5 63 5.5 64 4.5 65 4.5 66 2.5 67 2.5 68 2.0 69 2.0 70 1.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09021986353298 98.02499999999999 2 0.8086934546373514 1.6 3 0.0758150113722517 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025271670457417232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGATTTCTTTTCCTCGGGGTACTTAGATGTTTCAGTTCCCCCGGTTCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.2 0.0 0.0 0.0 0.0 126-127 1.3624999999999998 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0 0.0 138-139 2.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTAAAC 10 0.006830828 145.0 1 >>END_MODULE SRR7168941 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168941_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.194 34.0 33.0 34.0 33.0 34.0 2 33.25825 34.0 33.0 34.0 33.0 34.0 3 33.2225 34.0 33.0 34.0 33.0 34.0 4 33.21175 34.0 33.0 34.0 33.0 34.0 5 33.20525 34.0 33.0 34.0 33.0 34.0 6 37.3895 38.0 38.0 38.0 38.0 38.0 7 37.4055 38.0 38.0 38.0 38.0 38.0 8 37.36925 38.0 38.0 38.0 38.0 38.0 9 37.32875 38.0 38.0 38.0 38.0 38.0 10-14 37.318400000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.2085 38.0 38.0 38.0 37.8 38.0 20-24 37.223150000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.188649999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.18185 38.0 38.0 38.0 38.0 38.0 35-39 37.1595 38.0 38.0 38.0 38.0 38.0 40-44 37.138850000000005 38.0 38.0 38.0 37.8 38.0 45-49 37.06875 38.0 38.0 38.0 37.4 38.0 50-54 37.0264 38.0 38.0 38.0 37.0 38.0 55-59 36.99055 38.0 38.0 38.0 37.0 38.0 60-64 36.861149999999995 38.0 38.0 38.0 36.6 38.0 65-69 36.876850000000005 38.0 38.0 38.0 36.8 38.0 70-74 36.8037 38.0 38.0 38.0 36.6 38.0 75-79 36.73945 38.0 38.0 38.0 36.0 38.0 80-84 36.6805 38.0 38.0 38.0 36.0 38.0 85-89 36.58630000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.55895 38.0 38.0 38.0 35.8 38.0 95-99 36.36315 38.0 38.0 38.0 34.8 38.0 100-104 36.27135 38.0 38.0 38.0 34.4 38.0 105-109 36.1456 38.0 38.0 38.0 34.0 38.0 110-114 35.982600000000005 38.0 38.0 38.0 33.8 38.0 115-119 35.830400000000004 38.0 38.0 38.0 33.4 38.0 120-124 35.3217 38.0 37.2 38.0 29.8 38.0 125-129 35.2478 38.0 37.0 38.0 31.0 38.0 130-134 34.984449999999995 38.0 36.2 38.0 28.8 38.0 135-139 34.66075 38.0 36.0 38.0 27.8 38.0 140-144 34.128249999999994 38.0 34.8 38.0 24.2 38.0 145-149 33.342600000000004 38.0 33.2 38.0 19.0 38.0 150-151 29.28475 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 10.0 4 4.0 5 2.0 6 0.0 7 1.0 8 5.0 9 1.0 10 1.0 11 1.0 12 3.0 13 2.0 14 1.0 15 4.0 16 2.0 17 5.0 18 6.0 19 9.0 20 9.0 21 4.0 22 10.0 23 12.0 24 8.0 25 15.0 26 16.0 27 12.0 28 28.0 29 25.0 30 31.0 31 36.0 32 52.0 33 73.0 34 108.0 35 180.0 36 493.0 37 2816.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.41010252563141 21.580395098774694 13.87846961740435 24.131032758189548 2 26.825 26.650000000000002 28.575 17.95 3 21.349999999999998 29.099999999999998 30.9 18.65 4 24.175 34.1 24.325 17.4 5 25.0 36.199999999999996 22.925 15.875 6 22.1 36.0 23.225 18.675 7 21.099999999999998 22.400000000000002 36.25 20.25 8 23.150000000000002 26.224999999999998 26.55 24.075 9 23.25 26.05 27.3 23.400000000000002 10-14 24.085 29.110000000000003 25.64 21.165 15-19 23.65 28.365000000000002 26.645000000000003 21.34 20-24 23.36 28.310000000000002 27.250000000000004 21.08 25-29 23.400000000000002 28.24 27.175 21.185000000000002 30-34 23.385 28.005000000000003 27.439999999999998 21.17 35-39 23.419999999999998 28.349999999999998 27.339999999999996 20.89 40-44 23.97 28.060000000000002 26.86 21.11 45-49 23.79 28.389999999999997 27.215 20.605 50-54 23.465 28.645 27.065 20.825 55-59 24.215 27.245 27.54 21.0 60-64 23.84 27.584999999999997 27.785 20.79 65-69 24.065 27.224999999999998 28.33 20.380000000000003 70-74 23.825 26.995 28.59 20.59 75-79 23.84 27.310000000000002 28.18 20.669999999999998 80-84 23.849999999999998 26.695 28.32 21.135 85-89 24.125 27.245 27.58 21.05 90-94 23.330000000000002 27.63 28.255000000000003 20.785 95-99 23.95 27.474999999999998 28.435 20.14 100-104 24.185000000000002 27.834999999999997 27.255000000000003 20.724999999999998 105-109 23.11 27.255000000000003 28.32 21.315 110-114 23.845 27.155 28.549999999999997 20.45 115-119 23.98 27.384999999999998 28.53 20.105 120-124 23.794999999999998 27.755000000000003 28.27 20.18 125-129 24.495 27.845 27.92 19.74 130-134 24.375 27.36 28.42 19.845 135-139 24.099999999999998 27.584999999999997 28.175 20.14 140-144 23.73 27.810000000000002 28.415000000000003 20.044999999999998 145-149 24.34 27.339999999999996 28.315 20.005 150-151 24.1625 27.3125 28.5875 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 0.0 23 0.5 24 0.5 25 1.0 26 3.0 27 6.5 28 8.0 29 8.0 30 9.5 31 18.5 32 25.5 33 28.5 34 37.0 35 52.5 36 82.5 37 103.0 38 123.0 39 164.5 40 198.0 41 235.5 42 250.5 43 242.0 44 266.5 45 277.0 46 262.0 47 246.0 48 233.5 49 211.5 50 175.0 51 145.0 52 121.5 53 109.0 54 86.0 55 57.5 56 45.0 57 36.5 58 28.0 59 20.5 60 18.5 61 15.0 62 10.5 63 6.5 64 4.0 65 4.5 66 2.0 67 2.0 68 3.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.5 74 1.5 75 1.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5283018867924528 1.05 3 0.0 0.0 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.6375000000000002 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.8875000000000002 0.0 0.0 0.0 0.0 134-135 2.1625 0.0 0.0 0.0 0.0 136-137 2.4000000000000004 0.0 0.0 0.0 0.0 138-139 2.6624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra Read 586142 spots for SRR7168941.sra Written 586142 spots for SRR7168941.sra SRR ids: ['SRR7168941.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u6a82_3h SRR7168941.sra spots: 11722840 blocks: [[1, 586142], [586143, 1172284], [1172285, 1758426], [1758427, 2344568], [2344569, 2930710], [2930711, 3516852], [3516853, 4102994], [4102995, 4689136], [4689137, 5275278], [5275279, 5861420], [5861421, 6447562], [6447563, 7033704], [7033705, 7619846], [7619847, 8205988], [8205989, 8792130], [8792131, 9378272], [9378273, 9964414], [9964415, 10550556], [10550557, 11136698], [11136699, 11722840]] SRR7168941 file size 3950785 SRR7168941 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168941 SRR7168941_1.fastq SRR7168941_2.fastq Input file: SRR7168941_1.fastq Paired file: SRR7168941_2.fastq trimmed: SRR7168941-trimmed-pair1.fastq, SRR7168941-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:12:41 2025 >> started Mon Feb 10 11:12:53 2025 >> done (12.342s) 11722840 read pairs processed; of these: 24891 ( 0.21%) short read pairs filtered out after trimming by size control 22404 ( 0.19%) empty read pairs filtered out after trimming by size control 11675545 (99.60%) read pairs available; of these: 4653264 (39.85%) trimmed read pairs available after processing 7022281 (60.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 11 0.00% 20 13 0.00% 21 8 0.00% 22 18 0.00% 23 10 0.00% 24 15 0.00% 25 10 0.00% 26 18 0.00% 27 14 0.00% 28 14 0.00% 29 15 0.00% 30 20 0.00% 31 12 0.00% 32 10 0.00% 33 5 0.00% 34 7 0.00% 35 8 0.00% 36 9 0.00% 37 17 0.00% 38 15 0.00% 39 18 0.00% 40 19 0.00% 41 7 0.00% 42 16 0.00% 43 17 0.00% 44 19 0.00% 45 29 0.00% 46 23 0.00% 47 33 0.00% 48 25 0.00% 49 28 0.00% 50 30 0.00% 51 40 0.00% 52 31 0.00% 53 23 0.00% 54 31 0.00% 55 42 0.00% 56 49 0.00% 57 38 0.00% 58 51 0.00% 59 57 0.00% 60 67 0.00% 61 67 0.00% 62 63 0.00% 63 80 0.00% 64 91 0.00% 65 89 0.00% 66 101 0.00% 67 119 0.00% 68 136 0.00% 69 229 0.00% 70 349 0.00% 71 274 0.00% 72 231 0.00% 73 196 0.00% 74 266 0.00% 75 296 0.00% 76 271 0.00% 77 313 0.00% 78 351 0.00% 79 416 0.00% 80 446 0.00% 81 510 0.00% 82 667 0.01% 83 762 0.01% 84 1703 0.01% 85 2524 0.02% 86 2614 0.02% 87 2663 0.02% 88 2840 0.02% 89 2775 0.02% 90 2859 0.02% 91 3027 0.03% 92 3094 0.03% 93 3293 0.03% 94 3359 0.03% 95 3636 0.03% 96 3867 0.03% 97 4026 0.03% 98 4371 0.04% 99 4420 0.04% 100 4715 0.04% 101 5021 0.04% 102 5405 0.05% 103 5749 0.05% 104 6099 0.05% 105 6658 0.06% 106 6932 0.06% 107 7292 0.06% 108 7642 0.07% 109 8169 0.07% 110 8674 0.07% 111 9189 0.08% 112 9525 0.08% 113 10363 0.09% 114 10835 0.09% 115 11385 0.10% 116 12278 0.11% 117 12681 0.11% 118 13234 0.11% 119 13765 0.12% 120 14523 0.12% 121 14711 0.13% 122 15748 0.13% 123 17053 0.15% 124 18342 0.16% 125 19214 0.16% 126 20408 0.17% 127 21629 0.19% 128 22476 0.19% 129 23786 0.20% 130 25045 0.21% 131 26546 0.23% 132 28393 0.24% 133 30424 0.26% 134 32953 0.28% 135 35139 0.30% 136 38374 0.33% 137 41329 0.35% 138 44318 0.38% 139 47173 0.40% 140 50108 0.43% 141 54728 0.47% 142 59530 0.51% 143 67645 0.58% 144 77878 0.67% 145 92883 0.80% 146 113113 0.97% 147 150845 1.29% 148 230750 1.98% 149 452492 3.88% 150 2531754 21.68% 151 7022281 60.15% 11675545 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.5 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=325.46 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=22.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=26 prefix-density=0.62 prefix-fanout=2.8 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=270.72 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=28.7 sequence=AAGAAGAAGAAA SRR7168941 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:13:36 Started mapping on | Feb 10 11:13:37 Finished on | Feb 10 11:15:05 Mapping speed, Million of reads per hour | 477.64 Number of input reads | 11675545 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10842985 Uniquely mapped reads % | 92.87% Average mapped length | 296.35 Number of splices: Total | 9208298 Number of splices: Annotated (sjdb) | 9042044 Number of splices: GT/AG | 9067290 Number of splices: GC/AG | 108224 Number of splices: AT/AC | 7920 Number of splices: Non-canonical | 24864 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.80 Insertion rate per base | 0.03% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 203025 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 53738 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.83% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 651784 651784 651784 N_multimapping 203025 203025 203025 N_noFeature 280302 10698937 345051 N_ambiguous 125461 865 45552 UnstrandedReadsAssigned:10437222 PositiveStrandReadsAssigned:143183 NegativeStrandReadsAssigned:10452382 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168941 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168941-trimmed-pair1.fastq SRR7168941-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,675,545 reads, 10,458,021 reads pseudoaligned [quant] estimated average fragment length: 250.425 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 984 rounds 52401 SRR7168941.ke.tsv 34699 SRR7168941.se.tsv 87100 total ==> SRR7168941.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.57 212 9.35994 Potri.005G024800.1.v4.1 1035 785.575 28 2.78311 Potri.004G059700.1.v4.1 961 711.609 0 0 Potri.007G009000.2.v4.1 1416 1166.57 0 0 Potri.003G141000.2.v4.1 2943 2693.57 159 4.60923 Potri.016G087400.1.v4.1 270 69.2592 1591.54 1794.32 Potri.015G069301.1.v4.1 564 317.914 0 0 Potri.010G195200.1.v4.1 1773 1523.57 27 1.38376 Potri.012G127500.1.v4.1 977 727.59 4907 526.611 ==> SRR7168941.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1168 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168941 completed mapping pipeline successfully