Starting /dee2/code/volunteer_pipeline.sh SRR7168942 current disk space = 3058895069184 free memory = 1331195424 SRR7168942 SRAfilesize c107e75d2b32de41abc00bb054651577 SRR7168942.sra SRR7168942.sra file validated SRR7168942 is paired end SRR7168942 is conventional basespace SRR7168942 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168942_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.55425 34.0 34.0 34.0 33.0 34.0 2 33.686 34.0 34.0 34.0 33.0 34.0 3 33.71175 34.0 34.0 34.0 33.0 34.0 4 33.6975 34.0 34.0 34.0 33.0 34.0 5 33.741 34.0 34.0 34.0 33.0 34.0 6 37.442 38.0 38.0 38.0 37.0 38.0 7 37.63975 38.0 38.0 38.0 38.0 38.0 8 37.72225 38.0 38.0 38.0 38.0 38.0 9 37.60575 38.0 38.0 38.0 38.0 38.0 10-14 37.705 38.0 38.0 38.0 38.0 38.0 15-19 37.73425 38.0 38.0 38.0 38.0 38.0 20-24 37.702299999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.6584 38.0 38.0 38.0 38.0 38.0 30-34 37.64845 38.0 38.0 38.0 38.0 38.0 35-39 37.551399999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.41585 38.0 38.0 38.0 37.6 38.0 45-49 37.40685 38.0 38.0 38.0 37.4 38.0 50-54 37.340149999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.3087 38.0 38.0 38.0 37.0 38.0 60-64 37.21655 38.0 38.0 38.0 37.0 38.0 65-69 37.114999999999995 38.0 38.0 38.0 36.8 38.0 70-74 37.03835 38.0 38.0 38.0 36.4 38.0 75-79 36.8113 38.0 38.0 38.0 36.0 38.0 80-84 36.7463 38.0 38.0 38.0 36.0 38.0 85-89 36.6893 38.0 38.0 38.0 36.0 38.0 90-94 36.59499999999999 38.0 38.0 38.0 35.4 38.0 95-99 36.5017 38.0 38.0 38.0 35.0 38.0 100-104 36.365899999999996 38.0 38.0 38.0 34.8 38.0 105-109 36.247299999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.0792 38.0 38.0 38.0 34.0 38.0 115-119 36.015299999999996 38.0 38.0 38.0 34.0 38.0 120-124 35.789550000000006 38.0 38.0 38.0 33.2 38.0 125-129 35.542899999999996 38.0 37.6 38.0 32.2 38.0 130-134 35.388850000000005 38.0 37.0 38.0 31.0 38.0 135-139 35.1748 38.0 36.4 38.0 31.0 38.0 140-144 34.816700000000004 38.0 36.0 38.0 29.4 38.0 145-149 34.30005 38.0 35.8 38.0 27.2 38.0 150-151 31.121624999999998 36.5 31.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 2.0 14 1.0 15 3.0 16 2.0 17 5.0 18 17.0 19 17.0 20 7.0 21 4.0 22 9.0 23 10.0 24 13.0 25 12.0 26 13.0 27 31.0 28 12.0 29 23.0 30 33.0 31 36.0 32 37.0 33 59.0 34 84.0 35 136.0 36 461.0 37 2969.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.316265060240966 14.633534136546183 13.930722891566266 36.119477911646584 2 21.546546546546548 15.015015015015015 31.23123123123123 32.207207207207205 3 19.625 16.900000000000002 27.0 36.475 4 21.625 22.85 23.65 31.874999999999996 5 23.674999999999997 27.325 24.675 24.325 6 21.775 32.550000000000004 25.174999999999997 20.5 7 14.575 29.099999999999998 37.225 19.1 8 17.150000000000002 29.2 31.15 22.5 9 17.575 28.1 33.025 21.3 10-14 18.965 31.564999999999998 26.88 22.59 15-19 18.990000000000002 29.715000000000003 27.950000000000003 23.345 20-24 19.375 29.875 27.465 23.285 25-29 18.875 29.654999999999998 27.389999999999997 24.08 30-34 18.634999999999998 29.735 27.615000000000002 24.015 35-39 19.425 30.055 27.27 23.25 40-44 19.78 29.015 27.994999999999997 23.21 45-49 19.405 29.275000000000002 27.389999999999997 23.93 50-54 19.755 28.994999999999997 27.345000000000002 23.905 55-59 19.0 29.630000000000003 27.66 23.71 60-64 19.335 29.845 26.810000000000002 24.01 65-69 18.94 29.99 27.189999999999998 23.880000000000003 70-74 19.655 30.020000000000003 26.96 23.365 75-79 19.785 29.29 26.52 24.404999999999998 80-84 19.98 29.04 26.795 24.185000000000002 85-89 19.62 29.060000000000002 26.974999999999998 24.345 90-94 20.244999999999997 28.139999999999997 27.815 23.799999999999997 95-99 19.78 29.035 26.93 24.255 100-104 20.385 29.215000000000003 26.57 23.830000000000002 105-109 19.855 28.49 27.250000000000004 24.404999999999998 110-114 20.885 29.115000000000002 26.634999999999998 23.365 115-119 20.385 29.215000000000003 26.840000000000003 23.56 120-124 20.655 28.725 26.705000000000002 23.915 125-129 20.244999999999997 29.044999999999998 26.58 24.13 130-134 20.330000000000002 28.845 27.125 23.7 135-139 21.099999999999998 28.685 26.590000000000003 23.625 140-144 20.669999999999998 29.080000000000002 26.575 23.674999999999997 145-149 20.565 28.875 26.215 24.345 150-151 20.2375 28.9875 26.875 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 1.0 19 1.0 20 0.0 21 1.0 22 3.0 23 4.0 24 4.0 25 7.5 26 11.5 27 10.5 28 11.5 29 21.5 30 31.0 31 39.0 32 54.0 33 62.5 34 71.5 35 91.0 36 98.0 37 117.0 38 142.5 39 154.0 40 191.5 41 219.5 42 219.0 43 234.0 44 244.0 45 242.0 46 238.0 47 222.5 48 214.5 49 196.0 50 164.0 51 130.0 52 110.5 53 97.0 54 78.0 55 62.0 56 49.0 57 39.5 58 27.0 59 20.0 60 14.5 61 12.0 62 10.0 63 8.5 64 5.0 65 2.5 66 2.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36289500509685 97.475 2 0.509683995922528 1.0 3 0.05096839959225281 0.15 4 0.0 0.0 5 0.025484199796126403 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05096839959225281 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAGAAATCTCGTATGC 38 0.95 TruSeq Adapter, Index 2 (97% over 36bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAGAAATCTCGTATGCC 12 0.3 TruSeq Adapter, Index 2 (97% over 35bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAGAAATCTCGTATG 5 0.125 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.1375 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.16249999999999998 0.0 0.0 0.0 0.0 54-55 0.1875 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.8375 0.0 0.0 0.0 0.0 122-123 2.025 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 3.0125 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 3.9625 0.0 0.0 0.0 0.0 138-139 4.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGAT 10 0.006830828 145.0 3 GAGCACA 35 0.0033124194 62.14286 9 CCTCCTT 35 0.0033124194 62.14286 1 AGAGCAC 35 0.0033124194 62.14286 8 AAGAGCA 40 0.005621335 54.375 7 GAAGAGC 40 0.005621335 54.375 6 GGAAGAG 45 0.008957279 48.333332 5 >>END_MODULE SRR7168942 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168942_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.25625 33.0 32.0 33.0 27.0 34.0 2 31.3715 33.0 32.0 33.0 27.0 34.0 3 31.31575 33.0 31.0 33.0 27.0 34.0 4 31.41775 33.0 32.0 33.0 28.0 34.0 5 31.17525 33.0 31.0 33.0 28.0 34.0 6 35.383 38.0 36.0 38.0 29.0 38.0 7 35.3555 38.0 36.0 38.0 29.0 38.0 8 35.29075 38.0 36.0 38.0 29.0 38.0 9 35.32225 38.0 36.0 38.0 29.0 38.0 10-14 35.19595 38.0 36.0 38.0 28.8 38.0 15-19 34.78315 38.0 35.8 38.0 27.8 38.0 20-24 34.8866 38.0 36.0 38.0 28.0 38.0 25-29 34.535250000000005 38.0 35.6 38.0 26.4 38.0 30-34 33.95775 38.0 34.4 38.0 17.8 38.0 35-39 33.66185 38.0 34.0 38.0 16.0 38.0 40-44 33.855450000000005 38.0 34.2 38.0 17.6 38.0 45-49 33.83675 38.0 34.2 38.0 16.0 38.0 50-54 33.66285 38.0 34.0 38.0 16.0 38.0 55-59 33.40455 38.0 34.0 38.0 16.0 38.0 60-64 33.084050000000005 37.6 33.2 38.0 16.0 38.0 65-69 32.869099999999996 37.8 33.0 38.0 16.0 38.0 70-74 32.584399999999995 37.6 32.6 38.0 16.0 38.0 75-79 32.25555 37.0 31.6 38.0 16.0 38.0 80-84 31.842950000000002 37.0 30.2 38.0 15.0 38.0 85-89 31.3842 37.0 29.0 38.0 15.0 38.0 90-94 31.057349999999996 36.6 29.0 38.0 15.0 38.0 95-99 30.501299999999997 36.0 27.6 38.0 15.0 38.0 100-104 30.01095 35.6 26.4 38.0 14.4 38.0 105-109 29.39165 35.0 23.8 38.0 13.6 38.0 110-114 28.936899999999998 34.6 23.2 38.0 13.0 38.0 115-119 28.291949999999996 34.0 21.0 38.0 2.0 38.0 120-124 27.0195 33.4 15.0 37.6 2.0 38.0 125-129 26.1099 33.0 15.0 37.0 2.0 38.0 130-134 25.17295 31.4 14.2 36.8 2.0 38.0 135-139 23.581200000000003 30.4 13.2 36.0 2.0 38.0 140-144 21.39895 25.2 2.0 34.4 2.0 38.0 145-149 18.60035 18.6 2.0 33.0 2.0 38.0 150-151 14.064875 2.0 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 23.0 4 16.0 5 10.0 6 10.0 7 11.0 8 8.0 9 16.0 10 13.0 11 26.0 12 26.0 13 22.0 14 18.0 15 27.0 16 23.0 17 21.0 18 34.0 19 30.0 20 48.0 21 46.0 22 40.0 23 58.0 24 62.0 25 80.0 26 79.0 27 110.0 28 121.0 29 189.0 30 207.0 31 256.0 32 336.0 33 395.0 34 430.0 35 524.0 36 495.0 37 152.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.10827706926732 20.43010752688172 19.42985746436609 27.031757939484873 2 23.9 27.0 29.65 19.45 3 22.375 26.375 30.8 20.45 4 23.35 31.15 22.95 22.55 5 24.4 33.25 24.325 18.025 6 21.75 36.025 23.599999999999998 18.625 7 20.0 23.075000000000003 36.225 20.7 8 22.2 26.6 27.675 23.525 9 24.175 25.75 27.675 22.400000000000002 10-14 23.86 28.505000000000003 26.05 21.584999999999997 15-19 23.330000000000002 27.229999999999997 27.725 21.715 20-24 24.07 27.145000000000003 27.625 21.16 25-29 23.76 27.689999999999998 27.77 20.78 30-34 23.54 28.294999999999998 27.105 21.060000000000002 35-39 23.265 28.294999999999998 27.275 21.165 40-44 24.22 27.794999999999998 26.745 21.240000000000002 45-49 23.515 27.98 27.584999999999997 20.919999999999998 50-54 23.799999999999997 28.095 26.99 21.115000000000002 55-59 23.64 27.855 27.089999999999996 21.415 60-64 23.445 29.265 26.745 20.544999999999998 65-69 23.549999999999997 28.999999999999996 27.155 20.294999999999998 70-74 23.895 28.58 26.85 20.674999999999997 75-79 23.64 28.08 27.49 20.79 80-84 23.445 28.999999999999996 27.125 20.43 85-89 23.885 28.26 26.97 20.885 90-94 23.724999999999998 28.42 27.145000000000003 20.71 95-99 23.724999999999998 28.78 26.93 20.565 100-104 23.805 28.999999999999996 26.945000000000004 20.25 105-109 23.895 28.58 26.924999999999997 20.599999999999998 110-114 24.4 28.96 27.22 19.42 115-119 24.104999999999997 28.74 27.595 19.56 120-124 23.810000000000002 28.98 27.67 19.54 125-129 23.395 29.304999999999996 27.46 19.84 130-134 23.549999999999997 30.509999999999998 26.19 19.75 135-139 23.705000000000002 29.38 26.815 20.1 140-144 23.885 30.314999999999998 25.929999999999996 19.869999999999997 145-149 24.14 30.995 25.71 19.155 150-151 24.587500000000002 30.575000000000003 25.7 19.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 1.0 20 1.5 21 2.0 22 3.5 23 3.5 24 4.0 25 5.5 26 6.5 27 6.0 28 7.5 29 10.5 30 17.0 31 22.5 32 28.0 33 37.5 34 37.5 35 52.0 36 75.5 37 101.5 38 129.0 39 159.0 40 188.0 41 207.0 42 242.0 43 269.0 44 273.5 45 253.0 46 252.0 47 254.0 48 232.5 49 198.5 50 171.5 51 144.0 52 120.5 53 112.5 54 79.0 55 64.5 56 51.5 57 30.5 58 23.5 59 19.5 60 18.0 61 15.0 62 10.5 63 8.0 64 6.0 65 3.0 66 1.5 67 2.5 68 3.0 69 2.0 70 1.5 71 2.5 72 2.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 2.5 97 1.5 98 0.5 99 3.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52165156092649 98.825 2 0.4028197381671702 0.8 3 0.0 0.0 4 0.050352467270896276 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025176233635448138 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.0875 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.125 0.0 0.0 0.025 0.0 86-87 0.1375 0.0 0.0 0.025 0.0 88-89 0.15 0.0 0.0 0.025 0.0 90-91 0.2125 0.0 0.0 0.025 0.0 92-93 0.2875 0.0 0.0 0.025 0.0 94-95 0.3 0.0 0.0 0.025 0.0 96-97 0.3 0.0 0.0 0.025 0.0 98-99 0.325 0.0 0.0 0.025 0.0 100-101 0.4125 0.0 0.0 0.025 0.0 102-103 0.4625 0.0 0.0 0.025 0.0 104-105 0.6 0.0 0.0 0.025 0.0 106-107 0.7250000000000001 0.0 0.0 0.025 0.0 108-109 0.875 0.0 0.0 0.025 0.0 110-111 1.0 0.0 0.0 0.025 0.0 112-113 1.1124999999999998 0.0 0.0 0.025 0.0 114-115 1.2000000000000002 0.0 0.0 0.025 0.0 116-117 1.275 0.0 0.0 0.025 0.0 118-119 1.3375 0.0 0.0 0.025 0.0 120-121 1.4874999999999998 0.0 0.0 0.025 0.0 122-123 1.6375 0.0 0.0 0.025 0.0 124-125 1.8375 0.0 0.0 0.025 0.0 126-127 2.0 0.0 0.0 0.025 0.0 128-129 2.075 0.0 0.0 0.025 0.0 130-131 2.3125 0.0 0.0 0.025 0.0 132-133 2.5374999999999996 0.0 0.0 0.025 0.0 134-135 2.7625 0.0 0.0 0.025 0.0 136-137 2.9875 0.0 0.0 0.025 0.0 138-139 3.2625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAAGA 10 0.006830828 145.0 1 ATGTGGC 10 0.006830828 145.0 145 AAGAGCG 30 0.0017973486 72.5 7 GGGAAAG 20 0.00593511 29.0 20-24 AAAAAAA 365 1.549356E-4 5.958904 60-64 >>END_MODULE Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574522 spots for SRR7168942.sra Written 574522 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra Read 574505 spots for SRR7168942.sra Written 574505 spots for SRR7168942.sra SRR ids: ['SRR7168942.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zeoudbbp SRR7168942.sra spots: 11490117 blocks: [[1, 574505], [574506, 1149010], [1149011, 1723515], [1723516, 2298020], [2298021, 2872525], [2872526, 3447030], [3447031, 4021535], [4021536, 4596040], [4596041, 5170545], [5170546, 5745050], [5745051, 6319555], [6319556, 6894060], [6894061, 7468565], [7468566, 8043070], [8043071, 8617575], [8617576, 9192080], [9192081, 9766585], [9766586, 10341090], [10341091, 10915595], [10915596, 11490117]] SRR7168942 file size 3871923 SRR7168942 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168942 SRR7168942_1.fastq SRR7168942_2.fastq Input file: SRR7168942_1.fastq Paired file: SRR7168942_2.fastq trimmed: SRR7168942-trimmed-pair1.fastq, SRR7168942-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:13:41 2025 >> started Mon Feb 10 11:13:54 2025 >> done (13.101s) 11490117 read pairs processed; of these: 53107 ( 0.46%) short read pairs filtered out after trimming by size control 205469 ( 1.79%) empty read pairs filtered out after trimming by size control 11231541 (97.75%) read pairs available; of these: 7730178 (68.83%) trimmed read pairs available after processing 3501363 (31.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 28 0.00% 20 28 0.00% 21 37 0.00% 22 27 0.00% 23 20 0.00% 24 55 0.00% 25 25 0.00% 26 36 0.00% 27 20 0.00% 28 30 0.00% 29 18 0.00% 30 37 0.00% 31 28 0.00% 32 37 0.00% 33 47 0.00% 34 52 0.00% 35 37 0.00% 36 48 0.00% 37 48 0.00% 38 84 0.00% 39 70 0.00% 40 96 0.00% 41 125 0.00% 42 109 0.00% 43 111 0.00% 44 131 0.00% 45 186 0.00% 46 224 0.00% 47 230 0.00% 48 304 0.00% 49 304 0.00% 50 385 0.00% 51 397 0.00% 52 484 0.00% 53 393 0.00% 54 405 0.00% 55 520 0.00% 56 507 0.00% 57 630 0.01% 58 832 0.01% 59 1332 0.01% 60 975 0.01% 61 1228 0.01% 62 489 0.00% 63 381 0.00% 64 423 0.00% 65 570 0.01% 66 805 0.01% 67 807 0.01% 68 1076 0.01% 69 1853 0.02% 70 2914 0.03% 71 2564 0.02% 72 1885 0.02% 73 1530 0.01% 74 1346 0.01% 75 1457 0.01% 76 1631 0.01% 77 1580 0.01% 78 1651 0.01% 79 2120 0.02% 80 1896 0.02% 81 2409 0.02% 82 2367 0.02% 83 3133 0.03% 84 4769 0.04% 85 6347 0.06% 86 6652 0.06% 87 6360 0.06% 88 6602 0.06% 89 7035 0.06% 90 7118 0.06% 91 7307 0.07% 92 7584 0.07% 93 7782 0.07% 94 8271 0.07% 95 8908 0.08% 96 9008 0.08% 97 9676 0.09% 98 10054 0.09% 99 12311 0.11% 100 10658 0.09% 101 11575 0.10% 102 11882 0.11% 103 12299 0.11% 104 13322 0.12% 105 14728 0.13% 106 14942 0.13% 107 15415 0.14% 108 16283 0.14% 109 17349 0.15% 110 18220 0.16% 111 19275 0.17% 112 20127 0.18% 113 21619 0.19% 114 22649 0.20% 115 24568 0.22% 116 25838 0.23% 117 27377 0.24% 118 28648 0.26% 119 30825 0.27% 120 32170 0.29% 121 34506 0.31% 122 36707 0.33% 123 39336 0.35% 124 42398 0.38% 125 45156 0.40% 126 48299 0.43% 127 52443 0.47% 128 56192 0.50% 129 61019 0.54% 130 66771 0.59% 131 71697 0.64% 132 77359 0.69% 133 84876 0.76% 134 93453 0.83% 135 103209 0.92% 136 112586 1.00% 137 122973 1.09% 138 131362 1.17% 139 140245 1.25% 140 152423 1.36% 141 163299 1.45% 142 178919 1.59% 143 201797 1.80% 144 228454 2.03% 145 269921 2.40% 146 321464 2.86% 147 405072 3.61% 148 565393 5.03% 149 890787 7.93% 150 2350885 20.93% 151 3501363 31.17% 11231541 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=236.11 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=21.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=31 prefix-density=0.23 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=261.57 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=26.4 sequence=GAAGAAGAAGAAA SRR7168942 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:14:41 Started mapping on | Feb 10 11:14:41 Finished on | Feb 10 11:16:06 Mapping speed, Million of reads per hour | 475.69 Number of input reads | 11231541 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 10492541 Uniquely mapped reads % | 93.42% Average mapped length | 288.98 Number of splices: Total | 8905641 Number of splices: Annotated (sjdb) | 8747345 Number of splices: GT/AG | 8767918 Number of splices: GC/AG | 103084 Number of splices: AT/AC | 8117 Number of splices: Non-canonical | 26522 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231403 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 39703 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 551183 551183 551183 N_multimapping 231403 231403 231403 N_noFeature 262237 10353757 324347 N_ambiguous 119924 844 42639 UnstrandedReadsAssigned:10110380 PositiveStrandReadsAssigned:137940 NegativeStrandReadsAssigned:10125555 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168942 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168942-trimmed-pair1.fastq SRR7168942-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,231,541 reads, 10,173,083 reads pseudoaligned [quant] estimated average fragment length: 227.554 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,235 rounds 52401 SRR7168942.ke.tsv 34699 SRR7168942.se.tsv 87100 total ==> SRR7168942.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.45 162 7.72567 Potri.005G024800.1.v4.1 1035 808.446 49 5.1781 Potri.004G059700.1.v4.1 961 734.446 3 0.348969 Potri.007G009000.2.v4.1 1416 1189.45 0 0 Potri.003G141000.2.v4.1 2943 2716.45 172.031 5.41042 Potri.016G087400.1.v4.1 270 75.7832 1102.64 1243.04 Potri.015G069301.1.v4.1 564 338.724 0 0 Potri.010G195200.1.v4.1 1773 1546.45 25 1.38112 Potri.012G127500.1.v4.1 977 750.446 3877 441.369 ==> SRR7168942.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 765 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 156 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168942 completed mapping pipeline successfully