Starting /dee2/code/volunteer_pipeline.sh SRR7168943 current disk space = 3058914422784 free memory = 1484269820 SRR7168943 SRAfilesize f1bfcfb26f6be4dc26355b6f3947387c SRR7168943.sra SRR7168943.sra file validated SRR7168943 is paired end SRR7168943 is conventional basespace SRR7168943 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168943_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99025 34.0 33.0 34.0 33.0 34.0 2 33.44375 34.0 34.0 34.0 33.0 34.0 3 33.5125 34.0 34.0 34.0 33.0 34.0 4 33.50175 34.0 34.0 34.0 33.0 34.0 5 33.4795 34.0 34.0 34.0 33.0 34.0 6 37.1595 38.0 38.0 38.0 36.0 38.0 7 37.41625 38.0 38.0 38.0 37.0 38.0 8 37.45 38.0 38.0 38.0 37.0 38.0 9 37.5025 38.0 38.0 38.0 38.0 38.0 10-14 37.5405 38.0 38.0 38.0 37.6 38.0 15-19 37.5428 38.0 38.0 38.0 38.0 38.0 20-24 37.54115 38.0 38.0 38.0 38.0 38.0 25-29 37.5302 38.0 38.0 38.0 37.6 38.0 30-34 37.5022 38.0 38.0 38.0 37.8 38.0 35-39 37.352199999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.2863 38.0 38.0 38.0 36.8 38.0 45-49 37.263349999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.246 38.0 38.0 38.0 36.4 38.0 55-59 37.1774 38.0 38.0 38.0 36.0 38.0 60-64 37.14919999999999 38.0 38.0 38.0 36.2 38.0 65-69 37.0978 38.0 38.0 38.0 36.0 38.0 70-74 37.0801 38.0 38.0 38.0 36.0 38.0 75-79 36.9864 38.0 38.0 38.0 36.0 38.0 80-84 36.89615 38.0 38.0 38.0 35.4 38.0 85-89 36.85575 38.0 38.0 38.0 35.2 38.0 90-94 36.786350000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.68065 38.0 38.0 38.0 34.8 38.0 100-104 36.56805 38.0 38.0 38.0 34.0 38.0 105-109 36.387649999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.3098 38.0 38.0 38.0 34.0 38.0 115-119 36.1336 38.0 37.2 38.0 33.4 38.0 120-124 35.90815 38.0 37.0 38.0 32.8 38.0 125-129 35.8011 38.0 37.0 38.0 32.0 38.0 130-134 35.507549999999995 38.0 36.0 38.0 30.6 38.0 135-139 35.32085 38.0 36.0 38.0 30.2 38.0 140-144 34.77595 38.0 35.4 38.0 27.8 38.0 145-149 34.2545 38.0 35.0 38.0 26.4 38.0 150-151 31.283875 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 4.0 17 0.0 18 0.0 19 4.0 20 2.0 21 5.0 22 6.0 23 7.0 24 15.0 25 7.0 26 15.0 27 21.0 28 26.0 29 27.0 30 30.0 31 48.0 32 74.0 33 81.0 34 119.0 35 243.0 36 581.0 37 2682.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.50799695354151 13.861386138613863 10.840314800710841 33.79030210713379 2 24.349999999999998 16.35 31.275 28.025 3 19.7 21.025 26.1 33.175 4 20.724999999999998 29.775000000000002 24.725 24.775 5 22.786393196598297 31.715857928964482 24.512256128064035 20.985492746373186 6 20.7 34.599999999999994 25.025 19.675 7 15.325 26.375 39.4 18.9 8 17.424999999999997 26.724999999999998 30.175 25.674999999999997 9 17.125 25.074999999999996 32.925 24.875 10-14 20.085 29.18 26.945000000000004 23.79 15-19 20.19 28.34 27.405 24.065 20-24 20.135 28.884999999999998 27.295 23.685000000000002 25-29 20.135 29.425 26.595000000000002 23.845 30-34 20.169999999999998 29.005 27.089999999999996 23.735 35-39 20.294999999999998 28.439999999999998 27.37 23.895 40-44 20.43 29.315 26.43 23.825 45-49 20.48 28.904999999999998 27.029999999999998 23.585 50-54 20.335 28.28 27.71 23.674999999999997 55-59 20.794999999999998 28.48 26.88 23.845 60-64 20.474999999999998 28.194999999999997 26.825 24.505 65-69 20.865000000000002 27.72 27.495000000000005 23.919999999999998 70-74 20.555 28.53 27.57 23.345 75-79 20.28 28.675 27.189999999999998 23.855 80-84 20.794999999999998 28.29 27.12 23.794999999999998 85-89 20.59 28.34 27.089999999999996 23.98 90-94 21.105 27.72 27.26 23.915 95-99 20.705000000000002 28.299999999999997 27.095000000000002 23.9 100-104 20.335 28.084999999999997 27.560000000000002 24.02 105-109 20.965 27.705000000000002 28.025 23.305 110-114 20.44 27.91 27.125 24.525 115-119 20.990000000000002 27.639999999999997 27.605 23.765 120-124 20.244999999999997 27.925 27.51 24.32 125-129 20.585 27.925 27.42 24.07 130-134 20.474999999999998 28.09 27.775 23.66 135-139 20.78 27.889999999999997 27.07 24.26 140-144 21.195 27.935 27.034999999999997 23.835 145-149 21.19 28.4 26.705000000000002 23.705000000000002 150-151 20.837500000000002 27.762500000000003 27.1125 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.5 23 2.5 24 2.0 25 2.5 26 4.5 27 7.5 28 10.5 29 17.0 30 20.0 31 22.0 32 29.0 33 41.5 34 47.5 35 58.0 36 77.5 37 96.0 38 113.0 39 133.5 40 162.0 41 200.0 42 245.0 43 263.5 44 262.0 45 264.5 46 270.0 47 252.5 48 222.0 49 211.5 50 192.5 51 155.5 52 137.5 53 119.5 54 90.0 55 72.5 56 57.5 57 38.5 58 24.0 59 14.0 60 15.0 61 13.0 62 5.5 63 4.0 64 3.0 65 4.5 66 4.5 67 2.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.5875 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.8374999999999999 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.4125 0.0 0.0 0.0 0.0 134-135 1.5875 0.0 0.0 0.0 0.0 136-137 1.7125 0.0 0.0 0.0 0.0 138-139 1.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATTT 10 0.006830828 145.0 8 TGATCCC 10 0.006830828 145.0 6 >>END_MODULE SRR7168943 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168943_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0285 33.0 33.0 34.0 32.0 34.0 2 33.13025 34.0 33.0 34.0 33.0 34.0 3 33.17875 34.0 33.0 34.0 33.0 34.0 4 33.11975 34.0 33.0 34.0 33.0 34.0 5 33.155 34.0 33.0 34.0 33.0 34.0 6 37.39775 38.0 38.0 38.0 37.0 38.0 7 37.3845 38.0 38.0 38.0 38.0 38.0 8 37.38925 38.0 38.0 38.0 38.0 38.0 9 37.4195 38.0 38.0 38.0 37.0 38.0 10-14 37.34755 38.0 38.0 38.0 37.0 38.0 15-19 37.30015 38.0 38.0 38.0 37.0 38.0 20-24 37.272000000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.23145 38.0 38.0 38.0 37.0 38.0 30-34 37.2168 38.0 38.0 38.0 37.0 38.0 35-39 37.22315 38.0 38.0 38.0 37.0 38.0 40-44 37.1928 38.0 38.0 38.0 37.0 38.0 45-49 37.147749999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.0654 38.0 38.0 38.0 36.6 38.0 55-59 37.08885 38.0 38.0 38.0 37.0 38.0 60-64 36.97685 38.0 38.0 38.0 36.2 38.0 65-69 36.92315000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.83475 38.0 38.0 38.0 36.0 38.0 75-79 36.83385 38.0 38.0 38.0 35.8 38.0 80-84 36.80284999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.693 38.0 38.0 38.0 35.2 38.0 90-94 36.58525 38.0 38.0 38.0 34.8 38.0 95-99 36.481100000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.36245 38.0 38.0 38.0 34.0 38.0 105-109 36.23725 38.0 38.0 38.0 34.0 38.0 110-114 36.060199999999995 38.0 37.8 38.0 33.4 38.0 115-119 35.89945 38.0 37.6 38.0 32.8 38.0 120-124 35.64665 38.0 37.0 38.0 31.0 38.0 125-129 35.41995 38.0 36.6 38.0 30.6 38.0 130-134 35.12035 38.0 36.0 38.0 29.2 38.0 135-139 34.655 38.0 35.2 38.0 26.4 38.0 140-144 34.445100000000004 38.0 35.0 38.0 26.4 38.0 145-149 33.66295 38.0 34.2 38.0 20.4 38.0 150-151 29.3215 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 2.0 5 3.0 6 1.0 7 0.0 8 2.0 9 2.0 10 0.0 11 1.0 12 1.0 13 2.0 14 0.0 15 4.0 16 2.0 17 2.0 18 2.0 19 4.0 20 6.0 21 3.0 22 9.0 23 2.0 24 12.0 25 19.0 26 17.0 27 21.0 28 34.0 29 35.0 30 38.0 31 46.0 32 74.0 33 86.0 34 132.0 35 210.0 36 535.0 37 2684.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.9 21.875 14.325 25.900000000000002 2 25.95095095095095 27.102102102102105 30.130130130130127 16.816816816816818 3 20.9366391184573 28.174305033809166 31.02930127723516 19.85975457049837 4 23.816679188580014 34.15977961432507 23.791635361883294 18.23190583521162 5 25.41948409717005 35.161532682193844 21.387427998998245 18.031555221637866 6 20.66033016508254 36.69334667333667 23.761880940470235 18.884442221110557 7 21.25 21.9 36.95 19.900000000000002 8 22.886443221610804 25.337668834417208 26.488244122061033 25.287643821910955 9 21.875 25.900000000000002 28.975 23.25 10-14 24.058420447156507 28.51498024308508 26.049117191016858 21.377482118741558 15-19 23.93132445690259 27.975773350685756 27.475222745019522 20.61767944739213 20-24 23.413730984787833 27.817253803042437 27.471977582065655 21.297037630104082 25-29 23.70277708281211 27.76582436827621 27.090317738303725 21.441080810607957 30-34 23.687765824368277 28.091068301225917 27.305479109331998 20.915686765073804 35-39 23.194715508181954 27.96376920382325 27.468348095881503 21.373167192113296 40-44 23.502626970227674 27.9459594696022 27.225419064298222 21.325994495871903 45-49 23.955362057749085 28.39913926837812 27.09803332832908 20.54746534554371 50-54 23.273964378627177 28.10686411847108 27.54652791675005 21.072643586151692 55-59 23.506454518162716 28.019613729610725 27.224056839787853 21.249874912438706 60-64 23.755191913126158 27.528399139268377 27.90371816043637 20.812690787169092 65-69 23.794035228182548 27.171737389911932 27.977381905524418 21.056845476381106 70-74 24.29307842450328 27.49612131524949 27.330964416195386 20.87983584405185 75-79 23.651286157541787 27.62986688019217 27.389650685617056 21.329196276648986 80-84 23.55884707766213 27.32686148919135 27.61208967173739 21.502201761409125 85-89 23.930554860659427 27.547906138990342 27.793065492570168 20.728473507780055 90-94 23.488791032826263 27.677141713370695 27.206765412329865 21.62730184147318 95-99 24.201941358951267 27.239067347143 27.85950165115581 20.699489642749924 100-104 23.900535347976184 27.53289638264872 26.892480112072846 21.674088157302247 105-109 23.585896474118528 26.971742935733932 27.976994248562143 21.465366341585394 110-114 23.821910955477737 27.32866433216608 28.044022011005502 20.805402701350676 115-119 24.24060451383676 27.398288545263473 27.533403392883955 20.827703548015812 120-124 24.310387984981226 27.51439299123905 27.564455569461828 20.610763454317897 125-129 23.72083708821468 28.15159707619906 27.450685891659155 20.676879943927105 130-134 24.851123454936697 27.758594805584746 26.932892959015163 20.457388780463397 135-139 24.043032274205654 27.555666750062546 27.960970728046036 20.440330247685765 140-144 24.045438622829405 28.279037181604366 27.31321623379873 20.362307961767502 145-149 24.53953953953954 27.47247247247247 27.572572572572575 20.415415415415417 150-151 25.3003003003003 27.402402402402405 27.13963963963964 20.15765765765766 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 2.5 28 4.5 29 5.0 30 7.0 31 10.0 32 10.0 33 19.0 34 37.0 35 49.5 36 57.5 37 84.0 38 107.0 39 143.0 40 196.0 41 214.0 42 255.0 43 287.0 44 283.0 45 290.0 46 297.5 47 285.0 48 252.5 49 226.5 50 196.5 51 164.0 52 131.0 53 102.0 54 77.5 55 53.0 56 35.5 57 28.5 58 24.0 59 19.5 60 16.0 61 8.5 62 3.5 63 2.0 64 1.5 65 2.0 66 1.5 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.05 7 0.0 8 0.05 9 0.0 10-14 0.034999999999999996 15-19 0.11 20-24 0.08 25-29 0.075 30-34 0.075 35-39 0.08499999999999999 40-44 0.075 45-49 0.08499999999999999 50-54 0.06 55-59 0.06999999999999999 60-64 0.08499999999999999 65-69 0.08 70-74 0.095 75-79 0.09 80-84 0.08 85-89 0.065 90-94 0.08 95-99 0.06999999999999999 100-104 0.065 105-109 0.025 110-114 0.05 115-119 0.08499999999999999 120-124 0.125 125-129 0.13 130-134 0.08499999999999999 135-139 0.075 140-144 0.08499999999999999 145-149 0.1 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.4874999999999998 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.8125 0.0 0.0 0.0 0.0 138-139 2.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 20.714287 60-64 >>END_MODULE Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813285 spots for SRR7168943.sra Written 813285 spots for SRR7168943.sra Read 813289 spots for SRR7168943.sra Written 813289 spots for SRR7168943.sra SRR ids: ['SRR7168943.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hfjqx01e SRR7168943.sra spots: 16265704 blocks: [[1, 813285], [813286, 1626570], [1626571, 2439855], [2439856, 3253140], [3253141, 4066425], [4066426, 4879710], [4879711, 5692995], [5692996, 6506280], [6506281, 7319565], [7319566, 8132850], [8132851, 8946135], [8946136, 9759420], [9759421, 10572705], [10572706, 11385990], [11385991, 12199275], [12199276, 13012560], [13012561, 13825845], [13825846, 14639130], [14639131, 15452415], [15452416, 16265704]] SRR7168943 file size 5490212 SRR7168943 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168943 SRR7168943_1.fastq SRR7168943_2.fastq Input file: SRR7168943_1.fastq Paired file: SRR7168943_2.fastq trimmed: SRR7168943-trimmed-pair1.fastq, SRR7168943-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:23:43 2025 >> started Mon Feb 10 11:24:03 2025 >> done (19.456s) 16265704 read pairs processed; of these: 22555 ( 0.14%) short read pairs filtered out after trimming by size control 13822 ( 0.08%) empty read pairs filtered out after trimming by size control 16229327 (99.78%) read pairs available; of these: 6536730 (40.28%) trimmed read pairs available after processing 9692597 (59.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 2 0.00% 21 5 0.00% 22 6 0.00% 23 8 0.00% 24 9 0.00% 25 5 0.00% 26 5 0.00% 27 7 0.00% 28 7 0.00% 29 7 0.00% 30 7 0.00% 31 7 0.00% 32 9 0.00% 33 4 0.00% 34 8 0.00% 35 9 0.00% 36 11 0.00% 37 6 0.00% 38 9 0.00% 39 8 0.00% 40 12 0.00% 41 6 0.00% 42 12 0.00% 43 14 0.00% 44 17 0.00% 45 21 0.00% 46 16 0.00% 47 10 0.00% 48 18 0.00% 49 25 0.00% 50 18 0.00% 51 21 0.00% 52 28 0.00% 53 30 0.00% 54 29 0.00% 55 29 0.00% 56 43 0.00% 57 34 0.00% 58 41 0.00% 59 47 0.00% 60 36 0.00% 61 59 0.00% 62 67 0.00% 63 86 0.00% 64 82 0.00% 65 98 0.00% 66 87 0.00% 67 103 0.00% 68 114 0.00% 69 154 0.00% 70 203 0.00% 71 184 0.00% 72 204 0.00% 73 231 0.00% 74 303 0.00% 75 276 0.00% 76 346 0.00% 77 377 0.00% 78 382 0.00% 79 457 0.00% 80 521 0.00% 81 624 0.00% 82 669 0.00% 83 781 0.00% 84 1757 0.01% 85 2315 0.01% 86 2420 0.01% 87 2445 0.02% 88 2611 0.02% 89 2613 0.02% 90 2704 0.02% 91 2734 0.02% 92 2980 0.02% 93 3185 0.02% 94 3411 0.02% 95 3691 0.02% 96 3832 0.02% 97 4193 0.03% 98 4242 0.03% 99 4584 0.03% 100 4975 0.03% 101 5161 0.03% 102 5598 0.03% 103 5877 0.04% 104 6378 0.04% 105 7034 0.04% 106 7227 0.04% 107 7877 0.05% 108 8228 0.05% 109 8712 0.05% 110 9281 0.06% 111 9897 0.06% 112 10569 0.07% 113 11410 0.07% 114 12319 0.08% 115 13069 0.08% 116 13738 0.08% 117 14767 0.09% 118 15634 0.10% 119 16084 0.10% 120 16954 0.10% 121 17466 0.11% 122 19068 0.12% 123 20225 0.12% 124 21875 0.13% 125 23592 0.15% 126 25173 0.16% 127 26621 0.16% 128 27571 0.17% 129 29675 0.18% 130 31440 0.19% 131 33582 0.21% 132 35970 0.22% 133 39339 0.24% 134 41817 0.26% 135 45380 0.28% 136 48753 0.30% 137 53337 0.33% 138 56875 0.35% 139 61962 0.38% 140 67626 0.42% 141 75916 0.47% 142 84616 0.52% 143 97085 0.60% 144 114371 0.70% 145 137533 0.85% 146 170310 1.05% 147 231877 1.43% 148 350191 2.16% 149 699427 4.31% 150 3580487 22.06% 151 9692597 59.72% 16229327 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=32 prefix-density=0.20 prefix-fanout=2.3 sequence=GGGCACCAGTCAAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=37 fanout-score=104.12 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=15.9 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=2.6 sequence=GTTGACTGGTGCCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=18 fanout-score=53.72 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=12.9 sequence=TGTTGGTGGTGG SRR7168943 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:24:50 Started mapping on | Feb 10 11:24:50 Finished on | Feb 10 11:26:23 Mapping speed, Million of reads per hour | 628.23 Number of input reads | 16229327 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15326549 Uniquely mapped reads % | 94.44% Average mapped length | 296.96 Number of splices: Total | 14520369 Number of splices: Annotated (sjdb) | 14281919 Number of splices: GT/AG | 14316466 Number of splices: GC/AG | 160587 Number of splices: AT/AC | 11704 Number of splices: Non-canonical | 31612 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304792 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 38124 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 616272 616272 616272 N_multimapping 304792 304792 304792 N_noFeature 305567 15152532 373751 N_ambiguous 166325 1076 59657 UnstrandedReadsAssigned:14854657 PositiveStrandReadsAssigned:172941 NegativeStrandReadsAssigned:14893141 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168943 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168943-trimmed-pair1.fastq SRR7168943-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,229,327 reads, 14,814,403 reads pseudoaligned [quant] estimated average fragment length: 258.315 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7168943.ke.tsv 34699 SRR7168943.se.tsv 87100 total ==> SRR7168943.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.68 259 8.41403 Potri.005G024800.1.v4.1 1035 777.685 22 1.6181 Potri.004G059700.1.v4.1 961 703.712 4 0.325125 Potri.007G009000.2.v4.1 1416 1158.68 0 0 Potri.003G141000.2.v4.1 2943 2685.68 193.048 4.11146 Potri.016G087400.1.v4.1 270 66.3094 1469.98 1268.01 Potri.015G069301.1.v4.1 564 311.337 0 0 Potri.010G195200.1.v4.1 1773 1515.68 30 1.13213 Potri.012G127500.1.v4.1 977 719.69 4674 371.474 ==> SRR7168943.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1726 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168943 completed mapping pipeline successfully