Starting /dee2/code/volunteer_pipeline.sh SRR7168944 current disk space = 3059082694656 free memory = 1464571952 SRR7168944 SRAfilesize 648d44461275d165532fbae68f631aef SRR7168944.sra SRR7168944.sra file validated SRR7168944 is paired end SRR7168944 is conventional basespace SRR7168944 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168944_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.71575 34.0 33.0 34.0 25.0 34.0 2 32.70525 34.0 33.0 34.0 28.0 34.0 3 32.88575 34.0 33.0 34.0 32.0 34.0 4 33.11525 34.0 33.0 34.0 32.0 34.0 5 33.11425 34.0 33.0 34.0 32.0 34.0 6 36.8005 38.0 37.0 38.0 35.0 38.0 7 37.167 38.0 38.0 38.0 36.0 38.0 8 37.23775 38.0 38.0 38.0 36.0 38.0 9 37.32025 38.0 38.0 38.0 37.0 38.0 10-14 37.2593 38.0 38.0 38.0 36.8 38.0 15-19 37.3091 38.0 38.0 38.0 37.0 38.0 20-24 37.26955 38.0 38.0 38.0 37.0 38.0 25-29 37.20885 38.0 38.0 38.0 36.4 38.0 30-34 37.199200000000005 38.0 38.0 38.0 36.6 38.0 35-39 37.145599999999995 38.0 38.0 38.0 36.2 38.0 40-44 36.9634 38.0 38.0 38.0 35.6 38.0 45-49 36.82395 38.0 38.0 38.0 35.0 38.0 50-54 36.71275 38.0 38.0 38.0 34.4 38.0 55-59 36.6684 38.0 38.0 38.0 34.4 38.0 60-64 36.5687 38.0 38.0 38.0 34.0 38.0 65-69 36.399449999999995 38.0 38.0 38.0 33.8 38.0 70-74 36.377750000000006 38.0 37.6 38.0 33.8 38.0 75-79 36.2558 38.0 37.2 38.0 33.4 38.0 80-84 36.13295 38.0 37.0 38.0 33.2 38.0 85-89 36.0074 38.0 37.0 38.0 32.8 38.0 90-94 35.881550000000004 38.0 37.0 38.0 31.8 38.0 95-99 35.52545 38.0 36.4 38.0 29.8 38.0 100-104 35.17985 38.0 36.0 38.0 28.6 38.0 105-109 35.20345 38.0 36.0 38.0 28.8 38.0 110-114 34.89605 38.0 35.8 38.0 27.2 38.0 115-119 34.62645 38.0 35.0 38.0 26.6 38.0 120-124 33.8519 38.0 34.0 38.0 22.6 38.0 125-129 33.5618 38.0 34.0 38.0 19.0 38.0 130-134 33.6012 38.0 34.0 38.0 21.0 38.0 135-139 33.077099999999994 38.0 33.4 38.0 15.0 38.0 140-144 32.2625 37.4 32.6 38.0 14.2 38.0 145-149 30.613049999999998 36.0 30.0 38.0 8.6 38.0 150-151 26.939625 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 5.0 14 4.0 15 2.0 16 2.0 17 2.0 18 6.0 19 3.0 20 5.0 21 5.0 22 15.0 23 19.0 24 19.0 25 24.0 26 30.0 27 36.0 28 44.0 29 57.0 30 67.0 31 111.0 32 125.0 33 171.0 34 235.0 35 441.0 36 920.0 37 1647.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.33243096913914 15.240931239848402 8.825121819166215 37.60151597184624 2 21.6 17.375 34.849999999999994 26.174999999999997 3 17.5 24.3 27.950000000000003 30.25 4 21.725 32.0 23.474999999999998 22.8 5 22.755688922230558 35.33383345836459 23.40585146286572 18.504626156539132 6 19.650000000000002 34.375 25.174999999999997 20.8 7 13.850000000000001 25.2 41.475 19.475 8 18.15 26.525 29.5 25.825 9 18.125 24.275 32.550000000000004 25.05 10-14 20.22 29.835 26.13 23.815 15-19 20.035 29.035 27.425 23.505000000000003 20-24 19.875 29.425 27.150000000000002 23.549999999999997 25-29 20.57 29.325000000000003 26.979999999999997 23.125 30-34 20.165 28.725 27.18 23.93 35-39 19.935 28.88 27.185 24.0 40-44 20.380000000000003 28.975 27.3 23.345 45-49 20.47 29.015 26.41 24.104999999999997 50-54 20.77 28.645 26.950000000000003 23.635 55-59 20.150000000000002 28.32 27.345000000000002 24.185000000000002 60-64 20.055 28.299999999999997 27.195000000000004 24.45 65-69 20.41 28.305000000000003 27.395000000000003 23.89 70-74 20.455000000000002 28.67 26.915 23.96 75-79 20.715 28.299999999999997 26.99 23.995 80-84 20.630000000000003 28.389999999999997 27.169999999999998 23.810000000000002 85-89 20.345 28.544999999999998 27.01 24.099999999999998 90-94 20.655 28.560000000000002 27.355 23.43 95-99 20.765 28.165000000000003 27.46 23.61 100-104 20.705000000000002 28.804999999999996 27.084999999999997 23.405 105-109 20.46 28.395 27.139999999999997 24.005000000000003 110-114 20.39 28.455000000000002 27.034999999999997 24.12 115-119 20.695 27.944999999999997 27.889999999999997 23.47 120-124 20.57 28.04 27.46 23.93 125-129 20.810000000000002 28.305000000000003 27.315 23.57 130-134 20.815 28.26 27.505000000000003 23.419999999999998 135-139 21.275 27.74 27.435 23.549999999999997 140-144 21.095 28.060000000000002 27.375 23.47 145-149 20.979999999999997 28.549999999999997 26.63 23.84 150-151 21.3 28.1375 26.674999999999997 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 3.0 26 4.5 27 4.0 28 5.5 29 9.0 30 13.0 31 21.0 32 31.0 33 38.5 34 45.5 35 56.5 36 84.0 37 114.5 38 128.0 39 152.5 40 184.0 41 228.0 42 266.5 43 261.5 44 272.0 45 273.0 46 267.0 47 263.5 48 229.5 49 204.5 50 181.5 51 146.0 52 116.5 53 95.5 54 84.5 55 62.0 56 31.5 57 26.0 58 20.0 59 14.5 60 15.5 61 11.0 62 8.0 63 7.5 64 4.5 65 3.0 66 1.5 67 0.5 68 0.5 69 2.5 70 2.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.6499999999999995 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.7875 0.0 0.0 0.0 0.0 128-129 0.8875 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.475 0.0 0.0 0.0 0.0 138-139 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGAA 10 0.0068396386 144.9375 7 CCACCTC 10 0.0068396386 144.9375 3 >>END_MODULE SRR7168944 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168944_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55425 33.0 33.0 34.0 32.0 34.0 2 32.69975 33.0 33.0 34.0 32.0 34.0 3 32.72125 34.0 33.0 34.0 32.0 34.0 4 32.65875 34.0 33.0 34.0 32.0 34.0 5 32.5805 34.0 33.0 34.0 32.0 34.0 6 36.7865 38.0 38.0 38.0 35.0 38.0 7 36.8695 38.0 38.0 38.0 36.0 38.0 8 36.91025 38.0 38.0 38.0 36.0 38.0 9 36.91175 38.0 38.0 38.0 36.0 38.0 10-14 36.81685 38.0 38.0 38.0 35.8 38.0 15-19 36.82235000000001 38.0 38.0 38.0 35.8 38.0 20-24 36.78529999999999 38.0 38.0 38.0 36.0 38.0 25-29 36.67914999999999 38.0 38.0 38.0 35.4 38.0 30-34 36.6216 38.0 38.0 38.0 35.0 38.0 35-39 36.72935 38.0 38.0 38.0 35.2 38.0 40-44 36.6973 38.0 38.0 38.0 35.4 38.0 45-49 36.6515 38.0 38.0 38.0 35.4 38.0 50-54 36.5884 38.0 38.0 38.0 34.8 38.0 55-59 36.4473 38.0 38.0 38.0 34.2 38.0 60-64 36.42505 38.0 38.0 38.0 34.2 38.0 65-69 36.275999999999996 38.0 38.0 38.0 33.8 38.0 70-74 36.2731 38.0 38.0 38.0 34.0 38.0 75-79 36.1345 38.0 38.0 38.0 33.2 38.0 80-84 35.97 38.0 38.0 38.0 32.6 38.0 85-89 35.833549999999995 38.0 37.6 38.0 31.8 38.0 90-94 35.8024 38.0 37.2 38.0 31.4 38.0 95-99 35.620400000000004 38.0 37.2 38.0 30.8 38.0 100-104 35.40325 38.0 37.0 38.0 30.0 38.0 105-109 35.3187 38.0 37.0 38.0 29.8 38.0 110-114 35.11495 38.0 36.8 38.0 28.4 38.0 115-119 34.92725 38.0 36.0 38.0 27.6 38.0 120-124 34.77935000000001 38.0 36.0 38.0 26.6 38.0 125-129 34.347 38.0 35.4 38.0 24.0 38.0 130-134 33.97105 38.0 35.0 38.0 22.6 38.0 135-139 33.6868 38.0 34.8 38.0 21.4 38.0 140-144 33.20295 38.0 34.4 38.0 14.6 38.0 145-149 32.50645 38.0 33.4 38.0 11.4 38.0 150-151 28.106749999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 5.0 4 1.0 5 2.0 6 2.0 7 2.0 8 0.0 9 2.0 10 2.0 11 2.0 12 3.0 13 2.0 14 3.0 15 4.0 16 9.0 17 8.0 18 10.0 19 6.0 20 12.0 21 14.0 22 19.0 23 15.0 24 15.0 25 31.0 26 31.0 27 34.0 28 59.0 29 45.0 30 56.0 31 72.0 32 88.0 33 123.0 34 146.0 35 286.0 36 555.0 37 2325.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.484453360080245 22.91875626880642 14.292878635907725 26.303911735205617 2 27.632898696088265 26.479438314944836 30.892678034102307 14.994984954864593 3 20.13540621865597 29.38816449348044 30.015045135406222 20.46138415245737 4 21.790371113340022 35.95787362086259 23.319959879638915 18.931795386158477 5 24.699097291875628 36.88565697091274 20.561685055165498 17.853560682046137 6 21.65206508135169 37.04630788485607 21.952440550688358 19.349186483103882 7 20.575719649561954 21.752190237797247 37.4468085106383 20.225281602002504 8 21.67709637046308 25.707133917396746 26.458072590738425 26.157697121401753 9 21.6270337922403 25.056320400500624 29.061326658322905 24.25531914893617 10-14 23.16780136163396 29.250100120144175 25.93612334801762 21.645975170204245 15-19 23.359198998748436 27.904881101376724 27.043804755944933 21.692115143929914 20-24 22.90863579474343 28.47058823529412 27.193992490613265 21.426783479349186 25-29 22.963704630788488 28.02503128911139 27.544430538172715 21.46683354192741 30-34 23.13892365456821 27.819774718397998 27.62453066332916 21.416770963704632 35-39 23.04881101376721 28.315394242803503 27.47434292866083 21.161451814768462 40-44 22.57822277847309 28.220275344180223 27.849812265331664 21.35168961201502 45-49 23.469336670838548 28.245306633291616 27.32415519399249 20.961201501877348 50-54 23.239048811013767 27.904881101376724 27.899874843554446 20.956195244055067 55-59 23.148936170212767 27.389236545682106 28.35043804755945 21.111389236545683 60-64 23.219023779724658 27.63454317897372 28.055068836045056 21.09136420525657 65-69 23.454317897371716 27.294117647058826 27.83979974968711 21.41176470588235 70-74 23.53942428035044 28.035043804755944 27.519399249061326 20.906132665832292 75-79 22.623279098873592 28.075093867334168 28.46057571964956 20.84105131414268 80-84 23.214017521902377 27.50438047559449 27.894868585732162 21.386733416770966 85-89 23.52941176470588 28.195244055068834 27.88485607008761 20.39048811013767 90-94 23.589486858573217 27.584480600750936 28.11013767209011 20.715894868585732 95-99 24.25531914893617 26.958698372966204 28.035043804755944 20.750938673341675 100-104 23.809762202753443 27.098873591989985 27.68961201501877 21.401752190237797 105-109 23.384230287859825 27.894868585732162 27.71964956195244 21.00125156445557 110-114 23.98498122653317 27.71964956195244 27.434292866082604 20.86107634543179 115-119 24.05006257822278 27.399249061326657 27.869837296620776 20.680851063829785 120-124 23.509386733416772 27.774718397997493 27.729662077596995 20.986232790988733 125-129 24.185231539424283 27.3441802252816 27.964956195244056 20.505632040050063 130-134 24.180225281602002 27.59949937421777 27.909887359198997 20.310387984981226 135-139 23.60450563204005 27.143929912390487 27.819774718397998 21.431789737171464 140-144 24.250312891113893 27.759699624530665 26.87859824780976 21.111389236545683 145-149 23.704630788485606 27.829787234042552 28.105131414267838 20.360450563204004 150-151 24.62154385086951 26.98611284874265 27.198798949080444 21.193544351307395 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.5 25 2.5 26 2.5 27 1.5 28 2.0 29 4.0 30 8.0 31 12.0 32 16.5 33 28.0 34 31.0 35 43.0 36 74.0 37 98.0 38 125.5 39 159.5 40 190.5 41 237.5 42 270.5 43 301.0 44 308.0 45 295.0 46 298.0 47 272.5 48 235.0 49 205.0 50 166.5 51 134.5 52 116.0 53 86.0 54 64.0 55 49.5 56 34.5 57 31.0 58 28.0 59 17.0 60 12.0 61 10.0 62 5.5 63 2.0 64 1.5 65 4.0 66 3.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.3 3 0.3 4 0.3 5 0.3 6 0.125 7 0.125 8 0.125 9 0.125 10-14 0.12 15-19 0.125 20-24 0.125 25-29 0.125 30-34 0.125 35-39 0.125 40-44 0.125 45-49 0.125 50-54 0.125 55-59 0.125 60-64 0.125 65-69 0.125 70-74 0.125 75-79 0.125 80-84 0.125 85-89 0.125 90-94 0.125 95-99 0.125 100-104 0.125 105-109 0.125 110-114 0.125 115-119 0.125 120-124 0.125 125-129 0.125 130-134 0.125 135-139 0.125 140-144 0.125 145-149 0.125 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.30143180105501133 0.6 3 0.050238633509168545 0.15 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.7875 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.95 0.0 0.0 0.0 0.0 132-133 1.05 0.0 0.0 0.0 0.0 134-135 1.2000000000000002 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030208 spots for SRR7168944.sra Written 1030208 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra Read 1030201 spots for SRR7168944.sra Written 1030201 spots for SRR7168944.sra SRR ids: ['SRR7168944.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yjqh81dj SRR7168944.sra spots: 20604027 blocks: [[1, 1030201], [1030202, 2060402], [2060403, 3090603], [3090604, 4120804], [4120805, 5151005], [5151006, 6181206], [6181207, 7211407], [7211408, 8241608], [8241609, 9271809], [9271810, 10302010], [10302011, 11332211], [11332212, 12362412], [12362413, 13392613], [13392614, 14422814], [14422815, 15453015], [15453016, 16483216], [16483217, 17513417], [17513418, 18543618], [18543619, 19573819], [19573820, 20604027]] SRR7168944 file size 6960328 SRR7168944 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168944 SRR7168944_1.fastq SRR7168944_2.fastq Input file: SRR7168944_1.fastq Paired file: SRR7168944_2.fastq trimmed: SRR7168944-trimmed-pair1.fastq, SRR7168944-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:30:23 2025 >> started Mon Feb 10 11:30:54 2025 >> done (30.724s) 20604027 read pairs processed; of these: 28507 ( 0.14%) short read pairs filtered out after trimming by size control 72629 ( 0.35%) empty read pairs filtered out after trimming by size control 20502891 (99.51%) read pairs available; of these: 10312475 (50.30%) trimmed read pairs available after processing 10190416 (49.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 3 0.00% 21 6 0.00% 22 6 0.00% 23 6 0.00% 24 3 0.00% 25 6 0.00% 26 6 0.00% 27 4 0.00% 28 6 0.00% 29 10 0.00% 30 7 0.00% 31 9 0.00% 32 5 0.00% 33 3 0.00% 34 10 0.00% 35 14 0.00% 36 7 0.00% 37 8 0.00% 38 15 0.00% 39 12 0.00% 40 20 0.00% 41 17 0.00% 42 27 0.00% 43 17 0.00% 44 29 0.00% 45 22 0.00% 46 26 0.00% 47 26 0.00% 48 45 0.00% 49 51 0.00% 50 60 0.00% 51 40 0.00% 52 52 0.00% 53 78 0.00% 54 63 0.00% 55 78 0.00% 56 72 0.00% 57 76 0.00% 58 108 0.00% 59 113 0.00% 60 141 0.00% 61 151 0.00% 62 167 0.00% 63 175 0.00% 64 200 0.00% 65 220 0.00% 66 235 0.00% 67 262 0.00% 68 306 0.00% 69 384 0.00% 70 401 0.00% 71 409 0.00% 72 451 0.00% 73 561 0.00% 74 580 0.00% 75 680 0.00% 76 749 0.00% 77 832 0.00% 78 960 0.00% 79 1120 0.01% 80 1218 0.01% 81 1326 0.01% 82 1631 0.01% 83 1923 0.01% 84 2993 0.01% 85 3557 0.02% 86 3609 0.02% 87 3914 0.02% 88 4073 0.02% 89 4060 0.02% 90 4257 0.02% 91 4426 0.02% 92 4963 0.02% 93 5234 0.03% 94 5404 0.03% 95 5859 0.03% 96 6111 0.03% 97 6419 0.03% 98 6755 0.03% 99 7114 0.03% 100 7595 0.04% 101 7968 0.04% 102 8691 0.04% 103 9556 0.05% 104 10146 0.05% 105 11093 0.05% 106 11444 0.06% 107 11972 0.06% 108 12547 0.06% 109 13504 0.07% 110 14164 0.07% 111 15088 0.07% 112 16342 0.08% 113 17467 0.09% 114 18624 0.09% 115 20280 0.10% 116 21190 0.10% 117 22557 0.11% 118 23659 0.12% 119 24958 0.12% 120 26101 0.13% 121 27756 0.14% 122 29725 0.14% 123 32097 0.16% 124 34940 0.17% 125 37087 0.18% 126 39785 0.19% 127 42762 0.21% 128 45063 0.22% 129 47901 0.23% 130 51056 0.25% 131 54576 0.27% 132 59051 0.29% 133 63881 0.31% 134 69319 0.34% 135 75452 0.37% 136 81905 0.40% 137 87790 0.43% 138 95801 0.47% 139 104859 0.51% 140 116948 0.57% 141 131410 0.64% 142 149239 0.73% 143 172820 0.84% 144 202243 0.99% 145 248737 1.21% 146 314836 1.54% 147 429711 2.10% 148 653454 3.19% 149 1255761 6.12% 150 5136558 25.05% 151 10190416 49.70% 20502891 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=268.87 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=41 prefix-density=0.31 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=260.76 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=27.8 sequence=AAGAAGAAGAAG SRR7168944 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:31:40 Started mapping on | Feb 10 11:31:41 Finished on | Feb 10 11:33:52 Mapping speed, Million of reads per hour | 563.44 Number of input reads | 20502891 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19345154 Uniquely mapped reads % | 94.35% Average mapped length | 295.70 Number of splices: Total | 18943722 Number of splices: Annotated (sjdb) | 18648167 Number of splices: GT/AG | 18668090 Number of splices: GC/AG | 223155 Number of splices: AT/AC | 14561 Number of splices: Non-canonical | 37916 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393295 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 36765 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 787448 787448 787448 N_multimapping 393295 393295 393295 N_noFeature 373684 19163232 455432 N_ambiguous 178760 1123 77801 UnstrandedReadsAssigned:18792710 PositiveStrandReadsAssigned:180799 NegativeStrandReadsAssigned:18811921 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168944 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168944-trimmed-pair1.fastq SRR7168944-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,502,891 reads, 18,683,229 reads pseudoaligned [quant] estimated average fragment length: 266.612 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7168944.ke.tsv 34699 SRR7168944.se.tsv 87100 total ==> SRR7168944.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.39 508 13.539 Potri.005G024800.1.v4.1 1035 769.388 76 4.61339 Potri.004G059700.1.v4.1 961 695.438 6 0.402944 Potri.007G009000.2.v4.1 1416 1150.39 0 0 Potri.003G141000.2.v4.1 2943 2677.39 297.028 5.18129 Potri.016G087400.1.v4.1 270 65.6118 1644 1170.23 Potri.015G069301.1.v4.1 564 304.5 0 0 Potri.010G195200.1.v4.1 1773 1507.39 83 2.57161 Potri.012G127500.1.v4.1 977 711.405 12921 848.265 ==> SRR7168944.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1192 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168944 completed mapping pipeline successfully