Starting /dee2/code/volunteer_pipeline.sh SRR7168945 current disk space = 3059004358656 free memory = 1532866904 SRR7168945 SRAfilesize 178981be277a911e562abcc56f88da5f SRR7168945.sra SRR7168945.sra file validated SRR7168945 is paired end SRR7168945 is conventional basespace SRR7168945 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168945_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.044 34.0 34.0 34.0 33.0 34.0 2 33.4735 34.0 34.0 34.0 33.0 34.0 3 33.4775 34.0 34.0 34.0 33.0 34.0 4 33.56175 34.0 34.0 34.0 33.0 34.0 5 33.506 34.0 34.0 34.0 33.0 34.0 6 37.1645 38.0 38.0 38.0 36.0 38.0 7 37.48425 38.0 38.0 38.0 37.0 38.0 8 37.598 38.0 38.0 38.0 38.0 38.0 9 37.59625 38.0 38.0 38.0 38.0 38.0 10-14 37.5981 38.0 38.0 38.0 38.0 38.0 15-19 37.61825 38.0 38.0 38.0 38.0 38.0 20-24 37.60074999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.5633 38.0 38.0 38.0 38.0 38.0 30-34 37.563599999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.47279999999999 38.0 38.0 38.0 37.4 38.0 40-44 37.38145 38.0 38.0 38.0 37.2 38.0 45-49 37.36135 38.0 38.0 38.0 37.0 38.0 50-54 37.3245 38.0 38.0 38.0 37.0 38.0 55-59 37.24795 38.0 38.0 38.0 37.0 38.0 60-64 37.267250000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.2228 38.0 38.0 38.0 37.0 38.0 70-74 37.205149999999996 38.0 38.0 38.0 36.8 38.0 75-79 37.12179999999999 38.0 38.0 38.0 36.6 38.0 80-84 37.007200000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.96725 38.0 38.0 38.0 36.0 38.0 90-94 36.88825 38.0 38.0 38.0 35.8 38.0 95-99 36.77615 38.0 38.0 38.0 35.2 38.0 100-104 36.648649999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.54755 38.0 38.0 38.0 34.6 38.0 110-114 36.429649999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.3035 38.0 38.0 38.0 34.0 38.0 120-124 36.05595 38.0 38.0 38.0 33.6 38.0 125-129 35.8999 38.0 37.4 38.0 33.0 38.0 130-134 35.7139 38.0 36.8 38.0 32.2 38.0 135-139 35.5273 38.0 36.4 38.0 31.8 38.0 140-144 35.1171 38.0 36.0 38.0 30.6 38.0 145-149 34.6073 38.0 35.4 38.0 27.8 38.0 150-151 31.917375 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 2.0 15 2.0 16 0.0 17 2.0 18 5.0 19 5.0 20 3.0 21 7.0 22 6.0 23 6.0 24 5.0 25 9.0 26 14.0 27 16.0 28 21.0 29 26.0 30 26.0 31 43.0 32 51.0 33 64.0 34 110.0 35 203.0 36 493.0 37 2877.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.31784716933232 10.535668951510536 15.765422696115767 41.38106118304138 2 21.675 14.224999999999998 33.95 30.15 3 21.05 18.95 25.15 34.849999999999994 4 22.55 26.85 22.575 28.025 5 23.549999999999997 31.175000000000004 23.225 22.05 6 19.375 35.85 24.474999999999998 20.3 7 16.2 26.474999999999998 38.775 18.55 8 18.475 26.825 30.625000000000004 24.075 9 16.675 26.700000000000003 32.875 23.75 10-14 19.605 30.245 26.91 23.24 15-19 20.155 28.235 27.544999999999998 24.065 20-24 19.82 28.410000000000004 27.860000000000003 23.91 25-29 19.950000000000003 28.735 27.49 23.825 30-34 19.865 28.744999999999997 27.250000000000004 24.14 35-39 20.135 28.96 26.625 24.279999999999998 40-44 19.68 28.749999999999996 27.515 24.055 45-49 20.39 28.23 27.26 24.12 50-54 19.825 28.660000000000004 27.315 24.2 55-59 19.794999999999998 28.95 27.27 23.985 60-64 20.025000000000002 28.660000000000004 26.85 24.465 65-69 20.095 29.065 26.974999999999998 23.865 70-74 20.155 28.65 27.310000000000002 23.885 75-79 20.095 28.09 27.584999999999997 24.23 80-84 20.575 28.71 27.465 23.25 85-89 20.435 28.255000000000003 27.700000000000003 23.61 90-94 20.28 28.34 27.485 23.895 95-99 20.04 28.15 27.560000000000002 24.25 100-104 21.21 28.13 27.01 23.65 105-109 20.565 28.105000000000004 27.889999999999997 23.44 110-114 20.16 28.244999999999997 27.595 24.0 115-119 20.62 28.405 27.26 23.715 120-124 20.365 28.505000000000003 27.415 23.715 125-129 20.685000000000002 28.144999999999996 27.29 23.880000000000003 130-134 20.885 28.24 26.815 24.060000000000002 135-139 21.279999999999998 27.58 26.96 24.18 140-144 21.255 27.425 27.634999999999998 23.685000000000002 145-149 21.205 28.455000000000002 26.565 23.775 150-151 20.75 27.750000000000004 27.400000000000002 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 2.5 24 2.5 25 3.5 26 5.0 27 6.0 28 10.5 29 13.5 30 15.0 31 21.0 32 32.5 33 43.0 34 56.0 35 67.0 36 82.5 37 98.0 38 127.5 39 153.0 40 161.0 41 208.0 42 239.5 43 249.0 44 265.5 45 269.5 46 272.0 47 252.0 48 225.5 49 214.5 50 187.0 51 153.5 52 137.0 53 121.5 54 90.5 55 52.5 56 37.0 57 31.0 58 21.0 59 21.0 60 16.0 61 7.0 62 6.0 63 6.0 64 4.0 65 2.5 66 1.0 67 0.5 68 1.5 69 1.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69879518072288 99.3 2 0.25100401606425704 0.5 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACCCAGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.7250000000000001 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.7000000000000002 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2750000000000004 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.7375 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.7874999999999996 0.0 0.0 0.0 0.0 136-137 4.1375 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGATC 25 8.716269E-4 86.9925 145 >>END_MODULE SRR7168945 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168945_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00825 33.0 33.0 34.0 32.0 34.0 2 33.1525 34.0 33.0 34.0 33.0 34.0 3 33.1555 34.0 33.0 34.0 33.0 34.0 4 33.12625 34.0 33.0 34.0 33.0 34.0 5 33.11425 34.0 33.0 34.0 33.0 34.0 6 37.1925 38.0 38.0 38.0 37.0 38.0 7 37.337 38.0 38.0 38.0 37.0 38.0 8 37.26375 38.0 38.0 38.0 37.0 38.0 9 37.2505 38.0 38.0 38.0 37.0 38.0 10-14 37.2447 38.0 38.0 38.0 37.0 38.0 15-19 37.25435 38.0 38.0 38.0 37.0 38.0 20-24 37.20139999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.22 38.0 38.0 38.0 37.0 38.0 30-34 37.20015 38.0 38.0 38.0 37.0 38.0 35-39 37.1976 38.0 38.0 38.0 37.0 38.0 40-44 37.14335 38.0 38.0 38.0 37.0 38.0 45-49 37.112649999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.065 38.0 38.0 38.0 36.8 38.0 55-59 37.0302 38.0 38.0 38.0 36.4 38.0 60-64 36.9892 38.0 38.0 38.0 36.2 38.0 65-69 36.966150000000006 38.0 38.0 38.0 36.2 38.0 70-74 36.824949999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.7614 38.0 38.0 38.0 35.8 38.0 80-84 36.696000000000005 38.0 38.0 38.0 35.4 38.0 85-89 36.595 38.0 38.0 38.0 35.0 38.0 90-94 36.49305 38.0 38.0 38.0 34.6 38.0 95-99 36.39045 38.0 38.0 38.0 34.0 38.0 100-104 36.2228 38.0 38.0 38.0 34.0 38.0 105-109 36.13005 38.0 38.0 38.0 34.0 38.0 110-114 35.96055 38.0 37.8 38.0 33.2 38.0 115-119 35.77395 38.0 37.4 38.0 32.4 38.0 120-124 35.5937 38.0 37.0 38.0 31.2 38.0 125-129 35.362199999999994 38.0 36.6 38.0 31.0 38.0 130-134 34.8527 38.0 35.8 38.0 28.0 38.0 135-139 34.515750000000004 38.0 35.2 38.0 26.6 38.0 140-144 34.2046 38.0 35.0 38.0 24.0 38.0 145-149 33.5111 38.0 34.2 38.0 20.2 38.0 150-151 29.198499999999996 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 4.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 2.0 12 3.0 13 1.0 14 5.0 15 3.0 16 3.0 17 4.0 18 3.0 19 4.0 20 7.0 21 7.0 22 6.0 23 6.0 24 16.0 25 13.0 26 18.0 27 19.0 28 26.0 29 34.0 30 32.0 31 52.0 32 65.0 33 75.0 34 137.0 35 219.0 36 590.0 37 2629.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.549999999999997 18.5 21.6 31.35 2 26.619964973730298 25.469101826369776 30.022516887665752 17.888416312234177 3 22.147147147147148 27.52752752752753 29.904904904904907 20.42042042042042 4 24.14914914914915 31.556556556556558 23.723723723723726 20.57057057057057 5 25.5005005005005 33.25825825825826 23.4984984984985 17.74274274274274 6 21.025 36.55 24.349999999999998 18.075 7 20.325 21.175 37.45 21.05 8 22.025 24.75 27.375 25.85 9 21.175 25.324999999999996 29.725 23.775 10-14 23.808571285692853 28.01420213031955 26.38895834375156 21.788268240236036 15-19 23.6565595917142 27.259081356949867 27.63434404082858 21.450015010507357 20-24 23.644457783113246 27.926170468187273 27.455982392957186 20.9733893557423 25-29 23.556778389194598 28.154077038519258 26.948474237118557 21.340670335167584 30-34 23.37434973989596 28.00120048019208 28.106242496998803 20.518207282913163 35-39 23.715672052423592 27.467360312140464 27.502376069231154 21.31459156620479 40-44 23.349339735894358 27.581032412965182 27.996198479391754 21.073429371748702 45-49 23.139255702280913 28.206282513005203 27.536014405762305 21.11844737895158 50-54 23.564712942588518 28.010602120424082 27.515503100620126 20.909181836367274 55-59 23.97219165749725 27.46824047214164 27.753325997799337 20.806241872561767 60-64 23.87074183382522 27.98759441748787 27.152218498324242 20.989445250362664 65-69 23.387863324828658 27.805292911101105 27.920356195907747 20.88648756816249 70-74 23.859315589353614 27.746647988793278 27.64658795277166 20.747448469081448 75-79 23.541770885442723 27.253626813406704 27.71385692846423 21.490745372686344 80-84 23.805712570656794 27.807513381021458 27.67745485468461 20.70931919363714 85-89 24.131032758189548 28.052013003250813 27.09177294323581 20.72518129532383 90-94 23.638273395688493 27.72970539688891 27.75471414995248 20.877307057470116 95-99 24.066016504126033 27.526881720430108 27.966991747936987 20.44011002750688 100-104 24.16483296659332 26.990398079615925 28.030606121224245 20.814162832566513 105-109 23.54853227984198 27.889183377506626 27.989198379756964 20.57308596289443 110-114 23.68855328299245 27.45411811771766 28.529279391908783 20.328049207381106 115-119 23.95317424583521 27.685226874781126 27.895342438341086 20.466256441042574 120-124 24.02301726294721 27.550662997247937 27.715786840130097 20.710532899674757 125-129 23.99559713813979 27.677990693951067 27.507880122079353 20.81853204582979 130-134 24.744897959183675 27.270908363345335 27.751100440176067 20.23309323729492 135-139 24.16345721002351 27.709698394438053 27.78972640424148 20.337117991296953 140-144 24.69481689013408 28.547128276966177 26.941164698819293 19.81689013408045 145-149 25.038771324228325 27.58016909300115 27.475111311221173 19.905948271549352 150-151 24.840525328330205 27.879924953095685 27.74233896185116 19.537210756722953 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 1.5 26 3.0 27 4.5 28 3.0 29 5.0 30 8.0 31 11.0 32 16.0 33 30.0 34 40.0 35 45.0 36 64.0 37 93.0 38 117.5 39 145.0 40 185.5 41 220.0 42 262.0 43 306.0 44 302.0 45 286.5 46 281.5 47 262.5 48 232.5 49 206.5 50 173.5 51 140.0 52 124.0 53 98.5 54 74.5 55 59.0 56 44.5 57 37.0 58 30.5 59 23.0 60 17.0 61 12.0 62 9.0 63 5.0 64 4.0 65 3.5 66 2.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.06999999999999999 20-24 0.04 25-29 0.05 30-34 0.04 35-39 0.045 40-44 0.04 45-49 0.04 50-54 0.02 55-59 0.03 60-64 0.045 65-69 0.055 70-74 0.06 75-79 0.05 80-84 0.045 85-89 0.025 90-94 0.034999999999999996 95-99 0.025 100-104 0.02 105-109 0.015 110-114 0.015 115-119 0.055 120-124 0.075 125-129 0.065 130-134 0.04 135-139 0.034999999999999996 140-144 0.06 145-149 0.055 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.37678975131876413 0.75 3 0.0 0.0 4 0.0 0.0 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5249999999999999 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.7375 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.4375 0.0 0.0 0.0 0.0 134-135 3.8 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTAAG 10 0.006830828 145.0 145 >>END_MODULE Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783401 spots for SRR7168945.sra Written 783401 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra Read 783392 spots for SRR7168945.sra Written 783392 spots for SRR7168945.sra SRR ids: ['SRR7168945.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tyyr24ll SRR7168945.sra spots: 15667849 blocks: [[1, 783392], [783393, 1566784], [1566785, 2350176], [2350177, 3133568], [3133569, 3916960], [3916961, 4700352], [4700353, 5483744], [5483745, 6267136], [6267137, 7050528], [7050529, 7833920], [7833921, 8617312], [8617313, 9400704], [9400705, 10184096], [10184097, 10967488], [10967489, 11750880], [11750881, 12534272], [12534273, 13317664], [13317665, 14101056], [14101057, 14884448], [14884449, 15667849]] SRR7168945 file size 5287619 SRR7168945 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168945 SRR7168945_1.fastq SRR7168945_2.fastq Input file: SRR7168945_1.fastq Paired file: SRR7168945_2.fastq trimmed: SRR7168945-trimmed-pair1.fastq, SRR7168945-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:43:07 2025 >> started Mon Feb 10 11:43:25 2025 >> done (17.580s) 15667849 read pairs processed; of these: 23483 ( 0.15%) short read pairs filtered out after trimming by size control 40922 ( 0.26%) empty read pairs filtered out after trimming by size control 15603444 (99.59%) read pairs available; of these: 6562615 (42.06%) trimmed read pairs available after processing 9040829 (57.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 7 0.00% 25 11 0.00% 26 7 0.00% 27 8 0.00% 28 9 0.00% 29 5 0.00% 30 6 0.00% 31 6 0.00% 32 7 0.00% 33 11 0.00% 34 6 0.00% 35 4 0.00% 36 14 0.00% 37 13 0.00% 38 10 0.00% 39 18 0.00% 40 21 0.00% 41 25 0.00% 42 17 0.00% 43 14 0.00% 44 24 0.00% 45 25 0.00% 46 25 0.00% 47 45 0.00% 48 26 0.00% 49 43 0.00% 50 43 0.00% 51 42 0.00% 52 57 0.00% 53 63 0.00% 54 72 0.00% 55 70 0.00% 56 89 0.00% 57 88 0.00% 58 113 0.00% 59 141 0.00% 60 114 0.00% 61 139 0.00% 62 122 0.00% 63 151 0.00% 64 187 0.00% 65 217 0.00% 66 282 0.00% 67 371 0.00% 68 475 0.00% 69 871 0.01% 70 941 0.01% 71 533 0.00% 72 496 0.00% 73 588 0.00% 74 582 0.00% 75 631 0.00% 76 715 0.00% 77 823 0.01% 78 852 0.01% 79 1015 0.01% 80 1121 0.01% 81 1195 0.01% 82 1487 0.01% 83 1724 0.01% 84 2593 0.02% 85 3255 0.02% 86 3513 0.02% 87 3641 0.02% 88 3985 0.03% 89 4133 0.03% 90 4173 0.03% 91 4432 0.03% 92 4805 0.03% 93 5250 0.03% 94 5692 0.04% 95 6212 0.04% 96 6623 0.04% 97 7192 0.05% 98 7581 0.05% 99 7878 0.05% 100 8514 0.05% 101 8985 0.06% 102 9501 0.06% 103 10202 0.07% 104 10649 0.07% 105 11894 0.08% 106 12411 0.08% 107 13185 0.08% 108 13984 0.09% 109 14696 0.09% 110 15445 0.10% 111 16517 0.11% 112 17376 0.11% 113 18580 0.12% 114 19480 0.12% 115 21063 0.13% 116 22310 0.14% 117 23291 0.15% 118 24428 0.16% 119 25425 0.16% 120 26635 0.17% 121 27912 0.18% 122 29041 0.19% 123 30505 0.20% 124 31996 0.21% 125 34282 0.22% 126 35857 0.23% 127 38156 0.24% 128 39678 0.25% 129 41576 0.27% 130 44083 0.28% 131 45859 0.29% 132 48599 0.31% 133 51710 0.33% 134 54018 0.35% 135 57170 0.37% 136 61040 0.39% 137 65135 0.42% 138 69689 0.45% 139 74570 0.48% 140 80224 0.51% 141 87300 0.56% 142 96204 0.62% 143 106533 0.68% 144 121405 0.78% 145 142012 0.91% 146 170697 1.09% 147 224299 1.44% 148 327790 2.10% 149 631861 4.05% 150 3251048 20.84% 151 9040829 57.94% 15603444 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=261.51 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=28.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=40 prefix-density=0.27 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=292.78 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=28.4 sequence=AAGAAGAAGAAG SRR7168945 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:44:12 Started mapping on | Feb 10 11:44:12 Finished on | Feb 10 11:45:42 Mapping speed, Million of reads per hour | 624.14 Number of input reads | 15603444 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14914584 Uniquely mapped reads % | 95.59% Average mapped length | 295.28 Number of splices: Total | 14290504 Number of splices: Annotated (sjdb) | 14058318 Number of splices: GT/AG | 14073656 Number of splices: GC/AG | 172746 Number of splices: AT/AC | 12126 Number of splices: Non-canonical | 31976 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301844 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 40325 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 402332 402332 402332 N_multimapping 301844 301844 301844 N_noFeature 313531 14770723 376884 N_ambiguous 136461 857 55410 UnstrandedReadsAssigned:14464592 PositiveStrandReadsAssigned:143004 NegativeStrandReadsAssigned:14482290 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168945 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168945-trimmed-pair1.fastq SRR7168945-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,603,444 reads, 14,421,485 reads pseudoaligned [quant] estimated average fragment length: 238.105 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52401 SRR7168945.ke.tsv 34699 SRR7168945.se.tsv 87100 total ==> SRR7168945.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.89 265 9.45212 Potri.005G024800.1.v4.1 1035 797.895 45 3.58252 Potri.004G059700.1.v4.1 961 723.906 2 0.175497 Potri.007G009000.2.v4.1 1416 1178.89 0 0 Potri.003G141000.2.v4.1 2943 2705.89 319 7.48861 Potri.016G087400.1.v4.1 270 77.4627 1719 1409.63 Potri.015G069301.1.v4.1 564 330.572 0 0 Potri.010G195200.1.v4.1 1773 1535.89 47 1.94383 Potri.012G127500.1.v4.1 977 739.9 7294 626.201 ==> SRR7168945.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1214 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168945 completed mapping pipeline successfully