Starting /dee2/code/volunteer_pipeline.sh SRR7168946 current disk space = 3058989453312 free memory = 1531145928 SRR7168946 SRAfilesize 36fd821fc5df0a7b814acb879d4c8f75 SRR7168946.sra SRR7168946.sra file validated SRR7168946 is paired end SRR7168946 is conventional basespace SRR7168946 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168946_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0125 34.0 33.0 34.0 33.0 34.0 2 33.34075 34.0 34.0 34.0 33.0 34.0 3 33.466 34.0 34.0 34.0 33.0 34.0 4 33.49625 34.0 34.0 34.0 33.0 34.0 5 33.484 34.0 34.0 34.0 33.0 34.0 6 37.252 38.0 38.0 38.0 36.0 38.0 7 37.46775 38.0 38.0 38.0 37.0 38.0 8 37.5395 38.0 38.0 38.0 37.0 38.0 9 37.569 38.0 38.0 38.0 38.0 38.0 10-14 37.5706 38.0 38.0 38.0 38.0 38.0 15-19 37.56755 38.0 38.0 38.0 38.0 38.0 20-24 37.5524 38.0 38.0 38.0 38.0 38.0 25-29 37.5115 38.0 38.0 38.0 37.8 38.0 30-34 37.49400000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.4496 38.0 38.0 38.0 37.4 38.0 40-44 37.34585 38.0 38.0 38.0 37.0 38.0 45-49 37.27755 38.0 38.0 38.0 37.0 38.0 50-54 37.2292 38.0 38.0 38.0 36.6 38.0 55-59 37.1559 38.0 38.0 38.0 36.0 38.0 60-64 37.15604999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.11505 38.0 38.0 38.0 36.0 38.0 70-74 37.1323 38.0 38.0 38.0 36.0 38.0 75-79 36.99995 38.0 38.0 38.0 35.8 38.0 80-84 36.95225 38.0 38.0 38.0 36.0 38.0 85-89 36.9525 38.0 38.0 38.0 35.4 38.0 90-94 36.8357 38.0 38.0 38.0 35.0 38.0 95-99 36.70145 38.0 38.0 38.0 34.6 38.0 100-104 36.5845 38.0 38.0 38.0 34.0 38.0 105-109 36.464299999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.18265 38.0 37.2 38.0 33.4 38.0 115-119 36.064099999999996 38.0 37.0 38.0 33.2 38.0 120-124 36.01989999999999 38.0 37.0 38.0 33.0 38.0 125-129 35.7304 38.0 36.8 38.0 31.4 38.0 130-134 35.486450000000005 38.0 36.0 38.0 30.4 38.0 135-139 35.24615 38.0 36.0 38.0 29.2 38.0 140-144 34.9643 38.0 35.6 38.0 28.0 38.0 145-149 34.382999999999996 38.0 35.0 38.0 26.8 38.0 150-151 31.18 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 4.0 18 2.0 19 0.0 20 3.0 21 6.0 22 6.0 23 4.0 24 3.0 25 9.0 26 12.0 27 16.0 28 24.0 29 30.0 30 34.0 31 53.0 32 60.0 33 76.0 34 140.0 35 247.0 36 629.0 37 2636.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.69629253428136 14.753682072117828 7.6434738445911625 35.90655154900965 2 21.875 16.675 36.675000000000004 24.775 3 18.5 22.575 28.375 30.55 4 22.725 30.55 22.825 23.9 5 22.280570142535634 35.483870967741936 22.9057264316079 19.32983245811453 6 19.475 37.0 24.2 19.325 7 15.174999999999999 26.924999999999997 40.425 17.474999999999998 8 16.825000000000003 26.1 31.075000000000003 26.0 9 17.7 24.4 33.75 24.15 10-14 20.24 29.53 26.584999999999997 23.645 15-19 19.96 29.225 27.165 23.65 20-24 19.650000000000002 29.325000000000003 27.355 23.669999999999998 25-29 19.439999999999998 29.82 27.045 23.695 30-34 20.001000050002503 29.216460823041153 27.486374318715935 23.296164808240412 35-39 20.508076211431714 28.61929289393409 26.989048357253587 23.883582537380608 40-44 19.925 28.915000000000003 27.395000000000003 23.765 45-49 20.445 28.76 27.139999999999997 23.655 50-54 20.575 28.060000000000002 27.644999999999996 23.72 55-59 20.395 28.68 27.169999999999998 23.755000000000003 60-64 20.3 28.685 27.54 23.474999999999998 65-69 20.155 29.075 27.105 23.665 70-74 20.25 29.145 26.985 23.62 75-79 20.49 28.285 27.37 23.855 80-84 20.525 28.084999999999997 27.725 23.665 85-89 20.445 28.744999999999997 27.775 23.035 90-94 19.98 29.04 27.115000000000002 23.865 95-99 20.355 28.105000000000004 27.875 23.665 100-104 20.685000000000002 29.25 26.85 23.215 105-109 20.385 28.325 27.389999999999997 23.9 110-114 20.385 28.675 26.729999999999997 24.21 115-119 20.76 28.32 27.474999999999998 23.445 120-124 20.200000000000003 28.575 27.595 23.630000000000003 125-129 20.75 28.044999999999998 27.689999999999998 23.515 130-134 20.794999999999998 27.98 27.935 23.29 135-139 20.86104305215261 27.77638881944097 27.92639631981599 23.43617180859043 140-144 21.175 28.244999999999997 26.97 23.61 145-149 20.424999999999997 27.915 27.705000000000002 23.955000000000002 150-151 20.2125 28.3875 26.575 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.5 22 1.5 23 1.5 24 0.5 25 2.0 26 7.0 27 8.5 28 10.5 29 16.5 30 18.5 31 19.5 32 27.5 33 51.0 34 61.0 35 64.0 36 84.0 37 108.0 38 125.5 39 141.5 40 174.5 41 214.0 42 252.5 43 268.0 44 263.0 45 284.0 46 281.5 47 252.0 48 244.5 49 223.0 50 179.5 51 142.0 52 122.0 53 94.5 54 68.0 55 46.5 56 33.5 57 32.0 58 20.5 59 12.5 60 10.5 61 8.0 62 5.0 63 3.0 64 1.5 65 2.0 66 2.0 67 1.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.0499999999999998 0.0 0.0 0.0 0.0 130-131 1.1875 0.0 0.0 0.0 0.0 132-133 1.2625 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168946 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168946_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.956 33.0 33.0 34.0 32.0 34.0 2 33.08475 34.0 33.0 34.0 32.0 34.0 3 33.142 34.0 33.0 34.0 32.0 34.0 4 33.09475 34.0 33.0 34.0 32.0 34.0 5 33.156 34.0 33.0 34.0 33.0 34.0 6 37.2915 38.0 38.0 38.0 37.0 38.0 7 37.34025 38.0 38.0 38.0 37.0 38.0 8 37.31425 38.0 38.0 38.0 37.0 38.0 9 37.2845 38.0 38.0 38.0 37.0 38.0 10-14 37.2846 38.0 38.0 38.0 37.0 38.0 15-19 37.21169999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.21589999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.1744 38.0 38.0 38.0 37.0 38.0 30-34 37.1853 38.0 38.0 38.0 37.0 38.0 35-39 37.1194 38.0 38.0 38.0 37.0 38.0 40-44 37.067750000000004 38.0 38.0 38.0 36.4 38.0 45-49 37.03294999999999 38.0 38.0 38.0 36.0 38.0 50-54 37.0556 38.0 38.0 38.0 36.2 38.0 55-59 37.02235 38.0 38.0 38.0 36.0 38.0 60-64 36.9016 38.0 38.0 38.0 36.0 38.0 65-69 36.7955 38.0 38.0 38.0 35.8 38.0 70-74 36.757600000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.66695 38.0 38.0 38.0 35.0 38.0 80-84 36.58385 38.0 38.0 38.0 34.4 38.0 85-89 36.5042 38.0 38.0 38.0 34.4 38.0 90-94 36.3137 38.0 38.0 38.0 34.0 38.0 95-99 36.233050000000006 38.0 38.0 38.0 33.6 38.0 100-104 36.0722 38.0 38.0 38.0 33.4 38.0 105-109 35.9786 38.0 37.6 38.0 33.0 38.0 110-114 35.80585 38.0 37.0 38.0 32.2 38.0 115-119 35.57195 38.0 37.0 38.0 30.6 38.0 120-124 35.2134 38.0 36.0 38.0 28.4 38.0 125-129 35.089749999999995 38.0 36.0 38.0 28.6 38.0 130-134 34.758950000000006 38.0 35.6 38.0 27.6 38.0 135-139 34.3908 38.0 35.0 38.0 25.0 38.0 140-144 33.978500000000004 38.0 35.0 38.0 23.0 38.0 145-149 33.300599999999996 38.0 34.0 38.0 18.6 38.0 150-151 29.03425 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 1.0 15 8.0 16 4.0 17 4.0 18 4.0 19 5.0 20 8.0 21 6.0 22 10.0 23 5.0 24 18.0 25 17.0 26 19.0 27 24.0 28 31.0 29 31.0 30 51.0 31 55.0 32 72.0 33 105.0 34 163.0 35 252.0 36 655.0 37 2437.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0 23.75 9.9 26.35 2 26.200000000000003 25.874999999999996 31.2 16.725 3 19.975 26.924999999999997 32.225 20.875 4 23.35 33.775 23.599999999999998 19.275000000000002 5 23.9 38.074999999999996 20.5 17.525 6 20.125 37.925 23.400000000000002 18.55 7 18.725 21.7 40.075 19.5 8 21.775 23.799999999999997 28.15 26.275 9 20.724999999999998 24.349999999999998 31.25 23.674999999999997 10-14 23.095 28.634999999999998 26.565 21.705 15-19 23.345 27.705000000000002 27.439999999999998 21.51 20-24 22.525000000000002 27.98 27.97 21.525 25-29 22.900000000000002 28.09 28.12 20.89 30-34 23.115 27.74 28.15 20.995 35-39 22.835 28.560000000000002 27.325 21.279999999999998 40-44 23.47 27.615000000000002 27.77 21.145 45-49 22.965 27.435 28.37 21.23 50-54 23.13 28.13 27.505000000000003 21.235 55-59 23.185 27.26 28.04 21.515 60-64 23.16 28.04 27.79 21.01 65-69 23.215 27.855 28.115000000000002 20.815 70-74 22.99 27.894999999999996 27.97 21.145 75-79 23.025000000000002 27.805000000000003 28.51 20.66 80-84 23.715 27.77 27.66 20.855 85-89 23.235 27.615000000000002 28.535 20.615 90-94 23.799999999999997 27.52 27.994999999999997 20.685000000000002 95-99 23.515 27.865000000000002 28.215 20.405 100-104 23.419999999999998 27.735 27.74 21.105 105-109 23.035 27.97 28.29 20.705000000000002 110-114 23.39 27.485 28.000000000000004 21.125 115-119 23.57 28.389999999999997 27.785 20.255000000000003 120-124 23.47 27.785 28.09 20.655 125-129 23.53 27.935 27.61 20.925 130-134 24.095 27.505000000000003 27.675 20.724999999999998 135-139 23.585 27.439999999999998 28.18 20.794999999999998 140-144 23.71 27.839999999999996 27.485 20.965 145-149 23.84 28.999999999999996 26.924999999999997 20.235 150-151 23.9875 27.712500000000002 27.8875 20.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 3.5 25 2.5 26 2.0 27 5.0 28 6.5 29 7.5 30 10.5 31 12.0 32 20.0 33 30.5 34 42.0 35 59.0 36 74.5 37 112.5 38 147.0 39 165.5 40 207.0 41 241.0 42 238.0 43 258.5 44 280.0 45 284.0 46 282.0 47 252.5 48 237.5 49 217.0 50 160.0 51 133.5 52 130.5 53 103.0 54 74.5 55 53.0 56 36.0 57 27.5 58 21.5 59 15.0 60 13.0 61 8.5 62 6.0 63 4.5 64 3.0 65 1.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4526024641689716 0.8999999999999999 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.2375 0.0 0.0 0.0 0.0 134-135 1.3875000000000002 0.0 0.0 0.0 0.0 136-137 1.5750000000000002 0.0 0.0 0.0 0.0 138-139 1.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCTT 10 0.006830828 145.0 145 CCTCCTC 10 0.006830828 145.0 8 CCGAGTT 10 0.006830828 145.0 6 GGGAATT 10 0.006830828 145.0 1 AAAAAAA 80 0.0020131238 12.6875 50-54 >>END_MODULE Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659581 spots for SRR7168946.sra Written 659581 spots for SRR7168946.sra Read 659595 spots for SRR7168946.sra Written 659595 spots for SRR7168946.sra SRR ids: ['SRR7168946.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x2al7pfr SRR7168946.sra spots: 13191634 blocks: [[1, 659581], [659582, 1319162], [1319163, 1978743], [1978744, 2638324], [2638325, 3297905], [3297906, 3957486], [3957487, 4617067], [4617068, 5276648], [5276649, 5936229], [5936230, 6595810], [6595811, 7255391], [7255392, 7914972], [7914973, 8574553], [8574554, 9234134], [9234135, 9893715], [9893716, 10553296], [10553297, 11212877], [11212878, 11872458], [11872459, 12532039], [12532040, 13191634]] SRR7168946 file size 4448511 SRR7168946 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168946 SRR7168946_1.fastq SRR7168946_2.fastq Input file: SRR7168946_1.fastq Paired file: SRR7168946_2.fastq trimmed: SRR7168946-trimmed-pair1.fastq, SRR7168946-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:44:26 2025 >> started Mon Feb 10 11:44:40 2025 >> done (14.191s) 13191634 read pairs processed; of these: 12066 ( 0.09%) short read pairs filtered out after trimming by size control 10596 ( 0.08%) empty read pairs filtered out after trimming by size control 13168972 (99.83%) read pairs available; of these: 5299116 (40.24%) trimmed read pairs available after processing 7869856 (59.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 5 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 4 0.00% 25 4 0.00% 26 5 0.00% 27 2 0.00% 28 1 0.00% 29 5 0.00% 30 5 0.00% 31 3 0.00% 32 1 0.00% 33 4 0.00% 34 3 0.00% 35 6 0.00% 36 4 0.00% 37 6 0.00% 38 7 0.00% 39 4 0.00% 40 5 0.00% 41 5 0.00% 42 6 0.00% 43 6 0.00% 44 11 0.00% 45 12 0.00% 46 4 0.00% 47 15 0.00% 48 15 0.00% 49 14 0.00% 50 23 0.00% 51 18 0.00% 52 27 0.00% 53 29 0.00% 54 20 0.00% 55 21 0.00% 56 24 0.00% 57 33 0.00% 58 34 0.00% 59 33 0.00% 60 38 0.00% 61 51 0.00% 62 49 0.00% 63 65 0.00% 64 77 0.00% 65 75 0.00% 66 90 0.00% 67 83 0.00% 68 114 0.00% 69 130 0.00% 70 173 0.00% 71 168 0.00% 72 175 0.00% 73 211 0.00% 74 222 0.00% 75 265 0.00% 76 314 0.00% 77 317 0.00% 78 378 0.00% 79 450 0.00% 80 453 0.00% 81 535 0.00% 82 592 0.00% 83 756 0.01% 84 1248 0.01% 85 1719 0.01% 86 1750 0.01% 87 1867 0.01% 88 1983 0.02% 89 2038 0.02% 90 2077 0.02% 91 2214 0.02% 92 2550 0.02% 93 2587 0.02% 94 2864 0.02% 95 3047 0.02% 96 3177 0.02% 97 3352 0.03% 98 3516 0.03% 99 3720 0.03% 100 4018 0.03% 101 4315 0.03% 102 4644 0.04% 103 4916 0.04% 104 5255 0.04% 105 5606 0.04% 106 5994 0.05% 107 6211 0.05% 108 6906 0.05% 109 7060 0.05% 110 7560 0.06% 111 8007 0.06% 112 8468 0.06% 113 9115 0.07% 114 9900 0.08% 115 10459 0.08% 116 11329 0.09% 117 11913 0.09% 118 12448 0.09% 119 13101 0.10% 120 13834 0.11% 121 14487 0.11% 122 15268 0.12% 123 16551 0.13% 124 17628 0.13% 125 18842 0.14% 126 20210 0.15% 127 21294 0.16% 128 22389 0.17% 129 23768 0.18% 130 25442 0.19% 131 26856 0.20% 132 29179 0.22% 133 31223 0.24% 134 33950 0.26% 135 36918 0.28% 136 39691 0.30% 137 43200 0.33% 138 47126 0.36% 139 51225 0.39% 140 56441 0.43% 141 63215 0.48% 142 71027 0.54% 143 80671 0.61% 144 94340 0.72% 145 112539 0.85% 146 139884 1.06% 147 189335 1.44% 148 288363 2.19% 149 567614 4.31% 150 2883445 21.90% 151 7869856 59.76% 13168972 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=31 prefix-density=0.24 prefix-fanout=2.7 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=273.59 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=34 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=12 fanout-score=47.48 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.7 sequence=TGTTGGTGGTGG SRR7168946 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:45:23 Started mapping on | Feb 10 11:45:23 Finished on | Feb 10 11:46:36 Mapping speed, Million of reads per hour | 649.43 Number of input reads | 13168972 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12504984 Uniquely mapped reads % | 94.96% Average mapped length | 296.82 Number of splices: Total | 11949646 Number of splices: Annotated (sjdb) | 11756179 Number of splices: GT/AG | 11782576 Number of splices: GC/AG | 134147 Number of splices: AT/AC | 9927 Number of splices: Non-canonical | 22996 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 222943 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 40033 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 453295 453295 453295 N_multimapping 222943 222943 222943 N_noFeature 321368 12359680 393537 N_ambiguous 127252 736 53577 UnstrandedReadsAssigned:12056364 PositiveStrandReadsAssigned:144568 NegativeStrandReadsAssigned:12057870 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168946 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168946-trimmed-pair1.fastq SRR7168946-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,168,972 reads, 11,965,023 reads pseudoaligned [quant] estimated average fragment length: 270.458 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7168946.ke.tsv 34699 SRR7168946.se.tsv 87100 total ==> SRR7168946.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.54 250 11.4124 Potri.005G024800.1.v4.1 1035 765.542 11 1.14693 Potri.004G059700.1.v4.1 961 691.664 1 0.115403 Potri.007G009000.2.v4.1 1416 1146.54 0 0 Potri.003G141000.2.v4.1 2943 2673.54 203 6.0607 Potri.016G087400.1.v4.1 270 65.485 1150 1401.75 Potri.015G069301.1.v4.1 564 303.352 0 0 Potri.010G195200.1.v4.1 1773 1503.54 21 1.11485 Potri.012G127500.1.v4.1 977 707.61 3344 377.212 ==> SRR7168946.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1402 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168946 completed mapping pipeline successfully