Starting /dee2/code/volunteer_pipeline.sh SRR7168947 current disk space = 3058911092736 free memory = 1486522024 SRR7168947 SRAfilesize 253f2cc7a2bce5374036d2f00ca1752d SRR7168947.sra SRR7168947.sra file validated SRR7168947 is paired end SRR7168947 is conventional basespace SRR7168947 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168947_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.713 34.0 33.0 34.0 32.0 34.0 2 33.095 34.0 33.0 34.0 32.0 34.0 3 33.114 34.0 33.0 34.0 32.0 34.0 4 33.0785 34.0 33.0 34.0 32.0 34.0 5 33.1425 34.0 33.0 34.0 32.0 34.0 6 37.00725 38.0 37.0 38.0 36.0 38.0 7 37.2315 38.0 38.0 38.0 36.0 38.0 8 37.339 38.0 38.0 38.0 37.0 38.0 9 37.401 38.0 38.0 38.0 37.0 38.0 10-14 37.4032 38.0 38.0 38.0 37.0 38.0 15-19 37.29565 38.0 38.0 38.0 37.0 38.0 20-24 37.16815 38.0 38.0 38.0 36.0 38.0 25-29 37.10269999999999 38.0 38.0 38.0 36.0 38.0 30-34 37.069 38.0 38.0 38.0 36.0 38.0 35-39 36.91915 38.0 38.0 38.0 35.6 38.0 40-44 36.739250000000006 38.0 38.0 38.0 34.8 38.0 45-49 36.867399999999996 38.0 38.0 38.0 35.0 38.0 50-54 36.80945 38.0 38.0 38.0 34.8 38.0 55-59 36.5462 38.0 38.0 38.0 34.0 38.0 60-64 36.59544999999999 38.0 38.0 38.0 34.0 38.0 65-69 36.51960000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.43485 38.0 37.8 38.0 34.0 38.0 75-79 36.414049999999996 38.0 37.0 38.0 33.8 38.0 80-84 35.8703 38.0 36.8 38.0 31.4 38.0 85-89 35.78485 38.0 37.0 38.0 31.0 38.0 90-94 35.486000000000004 38.0 36.4 38.0 29.8 38.0 95-99 35.3856 38.0 36.2 38.0 29.2 38.0 100-104 35.1906 38.0 36.0 38.0 28.8 38.0 105-109 35.33075 38.0 36.0 38.0 29.0 38.0 110-114 34.758500000000005 38.0 35.2 38.0 26.8 38.0 115-119 34.58475 38.0 35.0 38.0 25.8 38.0 120-124 34.110049999999994 37.8 34.0 38.0 23.2 38.0 125-129 33.36085 38.0 33.8 38.0 17.8 38.0 130-134 32.7483 37.4 32.6 38.0 17.4 38.0 135-139 33.21815 38.0 34.0 38.0 18.6 38.0 140-144 32.9749 38.0 33.6 38.0 17.2 38.0 145-149 31.848699999999997 37.2 32.0 38.0 11.2 38.0 150-151 27.0375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 4.0 16 2.0 17 3.0 18 3.0 19 11.0 20 7.0 21 8.0 22 9.0 23 12.0 24 19.0 25 26.0 26 28.0 27 42.0 28 50.0 29 70.0 30 69.0 31 88.0 32 109.0 33 171.0 34 254.0 35 462.0 36 934.0 37 1615.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.32428317685867 15.300685105303222 9.109363105810708 33.265668612027405 2 21.75 17.875 35.175 25.2 3 19.1 24.625 27.3 28.975 4 20.549999999999997 32.324999999999996 24.0 23.125 5 21.8304576144036 35.08377094273568 24.18104526131533 18.904726181545385 6 20.175 35.975 23.1 20.75 7 14.475 26.400000000000002 40.25 18.875 8 17.925 24.125 30.425 27.525 9 17.825 25.874999999999996 31.5 24.8 10-14 20.47 29.345 26.19 23.995 15-19 19.435 29.165000000000003 27.400000000000002 24.0 20-24 20.145 29.25 26.96 23.645 25-29 19.805 29.17 27.21 23.815 30-34 19.89 28.965000000000003 27.345000000000002 23.799999999999997 35-39 19.851985198519852 29.21792179217922 27.3977397739774 23.532353235323534 40-44 19.945 28.645 27.68 23.73 45-49 19.885994299714984 29.311465573278667 26.84134206710336 23.961198059902994 50-54 19.505 29.020000000000003 27.694999999999997 23.78 55-59 19.79 29.18 26.840000000000003 24.19 60-64 19.785 28.78 27.245 24.19 65-69 20.116005800290015 28.7914395719786 27.176358817940898 23.916195809790487 70-74 20.23202320232023 29.17791779177918 27.04770477047705 23.54235423542354 75-79 20.19 28.985 26.93 23.895 80-84 20.520405093753133 28.6072395467763 27.514288579163743 23.358066780306828 85-89 20.631019261637242 28.792134831460675 26.785714285714285 23.7911316211878 90-94 20.188452285485166 28.814153969526863 27.150160384923815 23.847233360064156 95-99 20.080361627322954 28.81968859869412 26.976393771973882 24.123556002009042 100-104 20.491104986218993 28.454021548484086 27.30142821348033 23.753445251816586 105-109 20.366098294884655 28.31995987963892 27.331995987963893 23.981945837512537 110-114 20.83730258210078 28.478315367259967 26.944096264728003 23.740285785911254 115-119 20.5102501127763 27.562528194075487 27.818154478472255 24.109067214675957 120-124 20.487048704870485 28.537853785378537 27.197719771977198 23.77737773777378 125-129 20.551993588459226 28.170707273091566 27.659787617711885 23.617511520737327 130-134 20.728516804185954 28.65264640772791 26.670356208492656 23.94848057959348 135-139 20.86772699818804 27.61224078920878 27.974632574994967 23.545399637608213 140-144 21.00781406531757 28.145662191945505 27.52454417952314 23.321979563213784 145-149 20.92298411421677 28.332998190227226 27.39292177759903 23.351095917956968 150-151 21.10540167940845 27.547311693194636 27.359318210302042 23.987968417094873 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 1.0 22 2.0 23 2.5 24 3.5 25 5.0 26 4.5 27 6.5 28 12.0 29 13.5 30 16.5 31 29.0 32 37.0 33 45.5 34 63.5 35 83.0 36 95.5 37 97.5 38 116.5 39 155.0 40 192.0 41 215.0 42 237.5 43 262.5 44 264.5 45 258.5 46 256.5 47 251.5 48 236.0 49 211.5 50 170.5 51 135.5 52 122.0 53 100.0 54 70.5 55 51.0 56 39.0 57 30.0 58 24.5 59 14.0 60 13.0 61 13.5 62 7.5 63 6.0 64 3.0 65 3.5 66 5.5 67 3.0 68 2.0 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.01 75-79 0.0 80-84 0.27 85-89 0.32 90-94 0.24 95-99 0.44999999999999996 100-104 0.22499999999999998 105-109 0.3 110-114 0.27499999999999997 115-119 0.245 120-124 0.01 125-129 0.18 130-134 0.62 135-139 0.66 140-144 0.18 145-149 0.54 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.2875 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAC 10 0.006832588 144.9875 3 AAGAACT 10 0.006832588 144.9875 4 ACCCAAC 10 0.006832588 144.9875 8 >>END_MODULE SRR7168947 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168947_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7265 33.0 33.0 34.0 32.0 34.0 2 32.82675 34.0 33.0 34.0 32.0 34.0 3 32.806 34.0 33.0 34.0 32.0 34.0 4 32.7505 34.0 33.0 34.0 32.0 34.0 5 32.745 34.0 33.0 34.0 32.0 34.0 6 36.749 38.0 38.0 38.0 36.0 38.0 7 36.7045 38.0 38.0 38.0 36.0 38.0 8 36.41325 38.0 38.0 38.0 35.0 38.0 9 36.59175 38.0 38.0 38.0 35.0 38.0 10-14 36.0923 38.0 38.0 38.0 33.8 38.0 15-19 35.8663 38.0 38.0 38.0 34.0 38.0 20-24 36.18985 38.0 38.0 38.0 34.0 38.0 25-29 36.42525 38.0 38.0 38.0 34.6 38.0 30-34 36.33495 38.0 38.0 38.0 34.8 38.0 35-39 36.3761 38.0 38.0 38.0 34.6 38.0 40-44 36.393299999999996 38.0 38.0 38.0 34.6 38.0 45-49 36.399 38.0 38.0 38.0 35.2 38.0 50-54 35.80875 38.0 38.0 38.0 33.2 38.0 55-59 35.02585 38.0 38.0 38.0 28.0 38.0 60-64 35.27325 38.0 38.0 38.0 29.8 38.0 65-69 35.4947 38.0 38.0 38.0 31.8 38.0 70-74 35.2515 38.0 37.6 38.0 29.2 38.0 75-79 35.132450000000006 38.0 37.8 38.0 28.2 38.0 80-84 35.307599999999994 38.0 38.0 38.0 29.8 38.0 85-89 35.3474 38.0 38.0 38.0 30.6 38.0 90-94 35.0652 38.0 37.4 38.0 28.6 38.0 95-99 34.98305 38.0 37.0 38.0 28.0 38.0 100-104 34.64575 38.0 37.0 38.0 26.4 38.0 105-109 34.440000000000005 38.0 36.8 38.0 24.8 38.0 110-114 34.20655000000001 38.0 36.0 38.0 21.8 38.0 115-119 34.1691 38.0 36.0 38.0 22.6 38.0 120-124 34.26754999999999 38.0 36.0 38.0 23.2 38.0 125-129 33.97375 38.0 35.4 38.0 22.2 38.0 130-134 33.612649999999995 38.0 34.8 38.0 20.0 38.0 135-139 32.8248 38.0 34.0 38.0 14.2 38.0 140-144 32.5762 38.0 34.0 38.0 14.0 38.0 145-149 31.76475 38.0 33.0 38.0 6.4 38.0 150-151 28.256999999999998 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 19.0 4 4.0 5 1.0 6 2.0 7 6.0 8 16.0 9 10.0 10 14.0 11 25.0 12 12.0 13 4.0 14 2.0 15 6.0 16 6.0 17 9.0 18 6.0 19 12.0 20 15.0 21 12.0 22 13.0 23 20.0 24 22.0 25 35.0 26 31.0 27 34.0 28 42.0 29 45.0 30 57.0 31 61.0 32 89.0 33 104.0 34 163.0 35 247.0 36 518.0 37 2321.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.35 21.85 12.5 27.3 2 26.400000000000002 27.525 29.25 16.825000000000003 3 19.650000000000002 29.75 30.725 19.875 4 23.23080770192548 34.55863965991498 23.48087021755439 18.72968242060515 5 23.50587646911728 35.98399599899975 23.93098274568642 16.579144786196547 6 20.801001251564454 36.470588235294116 23.704630788485606 19.02377972465582 7 19.95487590874906 21.15818500877413 38.631235898721485 20.255703183755326 8 21.77867609903992 25.543203638201113 28.09499747347145 24.58312278928752 9 20.801001251564454 25.231539424280353 30.18773466833542 23.779724655819777 10-14 23.508522727272727 28.454748376623378 26.36465097402597 21.67207792207792 15-19 23.159940667996523 28.054830954938364 27.46151092015754 21.323717456907577 20-24 23.124336886778156 27.954327287424846 27.519830243015207 21.40150558278179 25-29 23.468161794152984 27.673207849419303 27.758309971966362 21.100320384461355 30-34 23.339543783674905 27.816103529885694 27.816103529885694 21.028249156553706 35-39 22.11842700015067 28.049821706594347 28.662548340113503 21.16920295314148 40-44 23.18891510618003 28.4401827400974 27.662031226467192 20.708870927255386 45-49 23.174953589885103 28.016657468265514 27.891224725302294 20.91716421654709 50-54 23.058943089430894 27.88109756097561 28.226626016260166 20.833333333333336 55-59 23.632328654004954 27.87469033856317 27.518579686209744 20.974401321222132 60-64 22.88449660284126 27.954498661725346 28.61334156886967 20.547663166563723 65-69 23.78655564581641 27.726441917140537 27.538586515028435 20.94841592201462 70-74 23.988970588235293 27.60927287581699 27.762459150326794 20.639297385620914 75-79 23.643786680275582 27.558050523092625 28.09390150548609 20.704261291145702 80-84 23.146399959177426 27.60116344338419 28.45333469408583 20.799101903352554 85-89 23.25581395348837 27.667803165233323 28.400590300748053 20.675792580530253 90-94 23.869847269755326 27.34841906318639 28.35470194616131 20.42703172089697 95-99 23.245191087651627 27.65061158199259 28.1327716591382 20.97142567121758 100-104 23.264675592173017 27.63645726055613 28.027806385169928 21.071060762100927 105-109 23.24939986720466 26.993207007508047 28.699116400224728 21.058276725062566 110-114 23.45691691486084 28.027113073842045 28.006572866385948 20.509397144911162 115-119 23.719621386543874 27.352264006139677 28.14530570478383 20.78280890253262 120-124 23.619538834951456 27.18952265372168 28.377831715210355 20.813106796116504 125-129 23.94387600040523 27.50481207577753 28.072130483233714 20.479181440583528 130-134 23.804181540030598 27.531871494135647 27.735849056603772 20.928097909229983 135-139 23.59196133299415 28.02340371406767 27.641821419486135 20.742813533452047 140-144 23.925948284535668 27.29147801589697 27.88509910453768 20.89747459502968 145-149 24.080706179066837 28.05044136191677 27.142496847414883 20.726355611601512 150-151 23.629441624365484 28.197969543147206 28.185279187817258 19.987309644670052 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.5 9 1.5 10 2.5 11 4.0 12 4.0 13 4.5 14 4.5 15 4.5 16 5.0 17 4.5 18 5.5 19 4.0 20 2.0 21 3.5 22 5.0 23 5.5 24 4.5 25 4.5 26 8.0 27 10.0 28 9.5 29 10.5 30 16.0 31 20.0 32 21.0 33 37.0 34 50.5 35 63.0 36 81.0 37 98.0 38 124.0 39 159.5 40 192.5 41 222.0 42 251.0 43 277.0 44 282.5 45 278.0 46 280.0 47 258.0 48 232.5 49 196.5 50 148.5 51 122.5 52 106.0 53 94.0 54 78.5 55 55.5 56 36.5 57 24.5 58 20.0 59 16.5 60 12.0 61 10.5 62 7.5 63 4.5 64 4.0 65 3.0 66 1.5 67 1.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.125 7 0.27499999999999997 8 1.05 9 0.125 10-14 1.44 15-19 2.245 20-24 1.035 25-29 0.12 30-34 0.705 35-39 0.445 40-44 0.40499999999999997 45-49 0.345 50-54 1.6 55-59 3.1199999999999997 60-64 2.86 65-69 1.52 70-74 2.08 75-79 2.025 80-84 2.015 85-89 1.745 90-94 2.1149999999999998 95-99 1.485 100-104 2.9000000000000004 105-109 2.105 110-114 2.63 115-119 2.275 120-124 1.1199999999999999 125-129 1.29 130-134 1.95 135-139 1.725 140-144 0.61 145-149 0.8750000000000001 150-151 1.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 0.8374999999999999 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.3624999999999998 0.0 0.0 0.0 0.0 136-137 1.5375 0.0 0.0 0.0 0.0 138-139 1.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAAGT 10 0.006830828 145.0 6 TGCCTTC 10 0.006830828 145.0 9 GGGGGGG 20 0.00593511 29.0 90-94 >>END_MODULE Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807712 spots for SRR7168947.sra Written 807712 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra Read 807695 spots for SRR7168947.sra Written 807695 spots for SRR7168947.sra SRR ids: ['SRR7168947.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kmhectf9 SRR7168947.sra spots: 16153917 blocks: [[1, 807695], [807696, 1615390], [1615391, 2423085], [2423086, 3230780], [3230781, 4038475], [4038476, 4846170], [4846171, 5653865], [5653866, 6461560], [6461561, 7269255], [7269256, 8076950], [8076951, 8884645], [8884646, 9692340], [9692341, 10500035], [10500036, 11307730], [11307731, 12115425], [12115426, 12923120], [12923121, 13730815], [13730816, 14538510], [14538511, 15346205], [15346206, 16153917]] SRR7168947 file size 5452332 SRR7168947 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168947 SRR7168947_1.fastq SRR7168947_2.fastq Input file: SRR7168947_1.fastq Paired file: SRR7168947_2.fastq trimmed: SRR7168947-trimmed-pair1.fastq, SRR7168947-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:27:11 2025 >> started Mon Feb 10 11:27:34 2025 >> done (22.968s) 16153917 read pairs processed; of these: 44242 ( 0.27%) short read pairs filtered out after trimming by size control 38338 ( 0.24%) empty read pairs filtered out after trimming by size control 16071337 (99.49%) read pairs available; of these: 7134619 (44.39%) trimmed read pairs available after processing 8936718 (55.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 4 0.00% 21 9 0.00% 22 6 0.00% 23 12 0.00% 24 9 0.00% 25 8 0.00% 26 4 0.00% 27 9 0.00% 28 13 0.00% 29 7 0.00% 30 9 0.00% 31 14 0.00% 32 7 0.00% 33 8 0.00% 34 7 0.00% 35 12 0.00% 36 5 0.00% 37 16 0.00% 38 12 0.00% 39 9 0.00% 40 12 0.00% 41 16 0.00% 42 14 0.00% 43 8 0.00% 44 22 0.00% 45 16 0.00% 46 20 0.00% 47 23 0.00% 48 16 0.00% 49 22 0.00% 50 26 0.00% 51 27 0.00% 52 29 0.00% 53 47 0.00% 54 29 0.00% 55 34 0.00% 56 48 0.00% 57 55 0.00% 58 66 0.00% 59 53 0.00% 60 77 0.00% 61 83 0.00% 62 90 0.00% 63 109 0.00% 64 111 0.00% 65 105 0.00% 66 136 0.00% 67 141 0.00% 68 177 0.00% 69 196 0.00% 70 225 0.00% 71 260 0.00% 72 283 0.00% 73 316 0.00% 74 343 0.00% 75 403 0.00% 76 423 0.00% 77 536 0.00% 78 589 0.00% 79 680 0.00% 80 790 0.00% 81 849 0.01% 82 1022 0.01% 83 1296 0.01% 84 2695 0.02% 85 3252 0.02% 86 3282 0.02% 87 3206 0.02% 88 3490 0.02% 89 3362 0.02% 90 3568 0.02% 91 3676 0.02% 92 3948 0.02% 93 3895 0.02% 94 4082 0.03% 95 4292 0.03% 96 4393 0.03% 97 4736 0.03% 98 4984 0.03% 99 5172 0.03% 100 6239 0.04% 101 6112 0.04% 102 6548 0.04% 103 6641 0.04% 104 7200 0.04% 105 7541 0.05% 106 8156 0.05% 107 8393 0.05% 108 9122 0.06% 109 9299 0.06% 110 9731 0.06% 111 10410 0.06% 112 11130 0.07% 113 11824 0.07% 114 12678 0.08% 115 13395 0.08% 116 13977 0.09% 117 14943 0.09% 118 15626 0.10% 119 16310 0.10% 120 17163 0.11% 121 18194 0.11% 122 19310 0.12% 123 20815 0.13% 124 22323 0.14% 125 24229 0.15% 126 25960 0.16% 127 26306 0.16% 128 28189 0.18% 129 29948 0.19% 130 31737 0.20% 131 33883 0.21% 132 36864 0.23% 133 39743 0.25% 134 43250 0.27% 135 46694 0.29% 136 50406 0.31% 137 54596 0.34% 138 59842 0.37% 139 64997 0.40% 140 71836 0.45% 141 79929 0.50% 142 90976 0.57% 143 105811 0.66% 144 125812 0.78% 145 152661 0.95% 146 192905 1.20% 147 268722 1.67% 148 406483 2.53% 149 798900 4.97% 150 3868812 24.07% 151 8936718 55.61% 16071337 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=41 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=5 fanout-score=80.15 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=16.6 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=39 prefix-density=0.30 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=39 fanout-score=98.84 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=13.8 sequence=CTGTTGTTGAGGCCATGAC SRR7168947 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:28:20 Started mapping on | Feb 10 11:28:21 Finished on | Feb 10 11:30:08 Mapping speed, Million of reads per hour | 540.72 Number of input reads | 16071337 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15023055 Uniquely mapped reads % | 93.48% Average mapped length | 296.52 Number of splices: Total | 14016300 Number of splices: Annotated (sjdb) | 13792086 Number of splices: GT/AG | 13815027 Number of splices: GC/AG | 160835 Number of splices: AT/AC | 10489 Number of splices: Non-canonical | 29949 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298984 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 52287 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.28% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 778976 778976 778976 N_multimapping 298984 298984 298984 N_noFeature 345462 14857334 420015 N_ambiguous 154326 784 62603 UnstrandedReadsAssigned:14523267 PositiveStrandReadsAssigned:164937 NegativeStrandReadsAssigned:14540437 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168947 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168947-trimmed-pair1.fastq SRR7168947-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,071,337 reads, 14,506,404 reads pseudoaligned [quant] estimated average fragment length: 265.587 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 SRR7168947.ke.tsv 34699 SRR7168947.se.tsv 87100 total ==> SRR7168947.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.41 266 9.64858 Potri.005G024800.1.v4.1 1035 770.413 39 3.21964 Potri.004G059700.1.v4.1 961 696.467 8 0.730559 Potri.007G009000.2.v4.1 1416 1151.41 0 0 Potri.003G141000.2.v4.1 2943 2678.41 202 4.79667 Potri.016G087400.1.v4.1 270 65.2086 1320 1287.46 Potri.015G069301.1.v4.1 564 305.493 0 0 Potri.010G195200.1.v4.1 1773 1508.41 29 1.22277 Potri.012G127500.1.v4.1 977 712.435 6434 574.383 ==> SRR7168947.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1635 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168947 completed mapping pipeline successfully