Starting /dee2/code/volunteer_pipeline.sh SRR7168948 current disk space = 3058877198336 free memory = 1566570104 SRR7168948 SRAfilesize c30afebcf44cb7aa665c78b755798f81 SRR7168948.sra SRR7168948.sra file validated SRR7168948 is paired end SRR7168948 is conventional basespace SRR7168948 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168948_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.861 34.0 33.0 34.0 32.0 34.0 2 32.9965 34.0 33.0 34.0 32.0 34.0 3 33.06225 34.0 33.0 34.0 32.0 34.0 4 32.87775 34.0 33.0 34.0 32.0 34.0 5 32.72175 34.0 33.0 34.0 32.0 34.0 6 36.52875 38.0 37.0 38.0 34.0 38.0 7 36.97075 38.0 38.0 38.0 36.0 38.0 8 37.2 38.0 38.0 38.0 36.0 38.0 9 37.37925 38.0 38.0 38.0 37.0 38.0 10-14 37.279399999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.206849999999996 38.0 38.0 38.0 36.4 38.0 20-24 37.10555 38.0 38.0 38.0 36.0 38.0 25-29 36.944649999999996 38.0 38.0 38.0 35.4 38.0 30-34 36.83565 38.0 38.0 38.0 35.0 38.0 35-39 36.78995 38.0 38.0 38.0 34.6 38.0 40-44 36.43525000000001 38.0 38.0 38.0 34.0 38.0 45-49 36.5917 38.0 38.0 38.0 34.0 38.0 50-54 36.61225 38.0 38.0 38.0 34.0 38.0 55-59 36.3498 38.0 37.4 38.0 33.6 38.0 60-64 36.43765 38.0 37.6 38.0 33.8 38.0 65-69 36.31265 38.0 37.4 38.0 33.4 38.0 70-74 36.26855 38.0 37.0 38.0 33.4 38.0 75-79 35.9593 38.0 37.0 38.0 32.2 38.0 80-84 35.9461 38.0 37.0 38.0 32.2 38.0 85-89 35.4462 38.0 36.2 38.0 29.2 38.0 90-94 35.21085 38.0 36.0 38.0 28.6 38.0 95-99 35.47005 38.0 36.0 38.0 29.0 38.0 100-104 34.98325 38.0 35.4 38.0 27.4 38.0 105-109 35.1229 38.0 36.0 38.0 28.2 38.0 110-114 34.747550000000004 38.0 35.0 38.0 26.6 38.0 115-119 34.4378 38.0 34.6 38.0 25.2 38.0 120-124 34.296749999999996 38.0 34.4 38.0 23.8 38.0 125-129 33.26365 37.4 33.0 38.0 17.8 38.0 130-134 33.16799999999999 37.4 33.4 38.0 17.4 38.0 135-139 32.681200000000004 36.8 31.4 38.0 19.6 38.0 140-144 32.79945 37.8 32.4 38.0 17.4 38.0 145-149 30.85365 36.0 31.0 38.0 8.6 38.0 150-151 25.836125000000003 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 1.0 14 3.0 15 0.0 16 3.0 17 2.0 18 2.0 19 5.0 20 0.0 21 10.0 22 13.0 23 14.0 24 19.0 25 17.0 26 36.0 27 30.0 28 67.0 29 77.0 30 84.0 31 110.0 32 134.0 33 217.0 34 297.0 35 492.0 36 937.0 37 1424.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 12.875 8.799999999999999 38.550000000000004 2 22.925 15.25 35.05 26.775 3 19.675 20.3 27.1 32.925 4 22.875 27.825 23.525 25.775 5 22.401208155046564 32.74603574125346 23.206644852756103 21.64611125094387 6 18.125 35.35 26.05 20.474999999999998 7 14.825 26.474999999999998 39.725 18.975 8 17.474999999999998 24.675 32.025 25.825 9 16.525000000000002 25.0 33.925 24.55 10-14 19.75 29.799999999999997 26.715 23.735 15-19 19.96 28.335 27.52 24.185000000000002 20-24 19.765 29.17 27.229999999999997 23.835 25-29 20.005 28.92 27.08 23.995 30-34 19.695 29.075 27.405 23.825 35-39 19.985 29.12 27.11 23.785 40-44 19.564999999999998 29.43 26.83 24.175 45-49 20.175 28.660000000000004 27.26 23.905 50-54 20.185 28.785 27.075 23.955000000000002 55-59 20.19903980796159 28.85077015403081 27.290458091618326 23.65973194638928 60-64 20.23 28.185 27.54 24.044999999999998 65-69 19.575 28.689999999999998 27.35 24.385 70-74 19.55 28.77 27.505000000000003 24.175 75-79 19.939984996249063 28.64216054013503 27.291822955738937 24.12603150787697 80-84 20.420105026256564 28.93223305826457 26.571642910727682 24.07601900475119 85-89 20.312343577935728 28.856742416658328 27.204925417959757 23.62598858744619 90-94 20.43508913284319 27.80743277268607 27.69161043408198 24.065867660388758 95-99 20.01 28.475 27.21 24.305 100-104 20.53 28.63 27.534999999999997 23.305 105-109 20.398957497995188 28.683841218925423 26.8644747393745 24.052726543704892 110-114 20.474999999999998 28.395 27.115000000000002 24.015 115-119 20.54 28.355000000000004 27.465 23.64 120-124 20.75 28.025 27.565 23.66 125-129 20.244999999999997 27.805000000000003 27.915 24.035 130-134 20.794158831766353 27.360472094418885 28.430686137227447 23.414682936587315 135-139 20.200000000000003 27.73 27.98 24.09 140-144 20.635 27.36 27.515 24.490000000000002 145-149 21.04388130384402 27.825079349085595 27.331351705375585 23.799687641694796 150-151 20.52565707133917 27.74718397997497 27.384230287859822 24.342928660826033 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 3.5 27 5.0 28 6.5 29 10.0 30 18.5 31 26.5 32 30.0 33 46.0 34 60.5 35 72.0 36 89.0 37 116.0 38 132.5 39 151.0 40 186.5 41 225.5 42 240.0 43 232.0 44 258.0 45 281.5 46 270.5 47 251.5 48 231.5 49 200.0 50 168.5 51 132.0 52 112.0 53 96.5 54 70.5 55 59.0 56 50.0 57 42.5 58 29.0 59 19.0 60 19.0 61 11.5 62 7.0 63 7.0 64 6.5 65 5.0 66 1.5 67 2.5 68 3.0 69 2.0 70 1.5 71 0.5 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.675 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.02 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.025 80-84 0.025 85-89 0.11 90-94 0.7100000000000001 95-99 0.0 100-104 0.0 105-109 0.24 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.0 140-144 0.0 145-149 0.755 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.6499999999999999 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.825 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.1124999999999998 0.0 0.0 0.0 0.0 138-139 1.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168948 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168948_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3085 33.0 33.0 34.0 32.0 34.0 2 32.511 33.0 33.0 34.0 32.0 34.0 3 32.394 34.0 33.0 34.0 32.0 34.0 4 32.13825 34.0 33.0 34.0 31.0 34.0 5 32.31 34.0 33.0 34.0 31.0 34.0 6 36.29175 38.0 38.0 38.0 34.0 38.0 7 36.413 38.0 38.0 38.0 34.0 38.0 8 35.8875 38.0 38.0 38.0 33.0 38.0 9 36.1695 38.0 38.0 38.0 33.0 38.0 10-14 36.15305 38.0 38.0 38.0 33.6 38.0 15-19 36.0313 38.0 38.0 38.0 32.8 38.0 20-24 36.211149999999996 38.0 38.0 38.0 34.0 38.0 25-29 36.1585 38.0 38.0 38.0 33.8 38.0 30-34 36.001999999999995 38.0 38.0 38.0 33.0 38.0 35-39 36.11645 38.0 38.0 38.0 34.0 38.0 40-44 36.1906 38.0 38.0 38.0 34.0 38.0 45-49 36.1358 38.0 38.0 38.0 33.8 38.0 50-54 35.8635 38.0 38.0 38.0 32.6 38.0 55-59 35.22975 38.0 37.6 38.0 28.4 38.0 60-64 35.2801 38.0 37.4 38.0 28.6 38.0 65-69 35.3543 38.0 38.0 38.0 29.4 38.0 70-74 35.7252 38.0 38.0 38.0 32.4 38.0 75-79 35.4531 38.0 37.2 38.0 29.4 38.0 80-84 35.490249999999996 38.0 37.6 38.0 30.0 38.0 85-89 35.52910000000001 38.0 37.4 38.0 30.2 38.0 90-94 35.635949999999994 38.0 37.4 38.0 31.6 38.0 95-99 35.211499999999994 38.0 37.0 38.0 29.0 38.0 100-104 35.102999999999994 38.0 37.0 38.0 28.2 38.0 105-109 34.6265 38.0 36.0 38.0 25.0 38.0 110-114 34.53185 38.0 36.2 38.0 25.2 38.0 115-119 34.3551 38.0 36.0 38.0 23.6 38.0 120-124 34.37975 38.0 35.2 38.0 24.2 38.0 125-129 34.16135 38.0 35.0 38.0 22.6 38.0 130-134 34.0016 38.0 35.0 38.0 22.2 38.0 135-139 33.49185 38.0 34.8 38.0 18.6 38.0 140-144 32.636649999999996 38.0 33.6 38.0 14.0 38.0 145-149 31.16805 38.0 31.6 38.0 6.4 38.0 150-151 27.405625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 12.0 4 7.0 5 3.0 6 3.0 7 5.0 8 2.0 9 1.0 10 1.0 11 3.0 12 5.0 13 2.0 14 5.0 15 4.0 16 4.0 17 14.0 18 6.0 19 11.0 20 15.0 21 24.0 22 17.0 23 20.0 24 29.0 25 33.0 26 35.0 27 44.0 28 40.0 29 76.0 30 64.0 31 73.0 32 79.0 33 136.0 34 183.0 35 256.0 36 572.0 37 2186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.59520807061791 21.94199243379571 12.660781841109712 28.802017654476668 2 28.14851981936779 25.539387857501257 29.954841946813847 16.357250376317108 3 20.28289972215206 27.557464006062137 30.94215711038141 21.217479161404395 4 22.73882113821138 34.578252032520325 22.96747967479675 19.715447154471544 5 24.461152882205514 37.142857142857146 21.478696741854638 16.917293233082706 6 19.864729458917836 37.95090180360721 23.772545090180362 18.41182364729459 7 19.14572864321608 21.20603015075377 39.246231155778894 20.402010050251256 8 21.056642113284227 25.044450088900177 28.651257302514605 25.247650495300988 9 21.671281147747294 25.295746287440224 30.103196576894035 22.92977598791845 10-14 23.81576956061141 28.214700095848254 26.363315340765777 21.606215002774555 15-19 23.420506854165613 28.069199251353126 27.29020183114978 21.220092063331478 20-24 23.090478827853584 28.2563818538845 27.224208247318867 21.428931070943054 25-29 23.459822547496113 27.861045666449446 27.525189232542985 21.153942553511452 30-34 23.450148323193726 28.362411383176628 27.49761174518578 20.689828548443863 35-39 22.99511064065729 27.844145370230354 28.1818640052422 20.978879983870154 40-44 23.66504244738032 28.457326568543728 27.492841713969963 20.384789270105994 45-49 23.62833191104864 28.111038602479795 27.503639375533357 20.756990110938204 50-54 23.862721417069245 27.6268115942029 27.74255233494364 20.76791465378422 55-59 23.513238289205702 27.800407331975556 27.39307535641548 21.293279022403258 60-64 23.283338434853587 28.068564432200795 28.05325987144169 20.59483726150393 65-69 24.0800285816363 26.677895166641147 28.137600163323633 21.10447608839892 70-74 24.149762841860934 27.78786961348269 27.434655363810677 20.627712180845695 75-79 23.74500783580203 27.05121075779789 28.092614124665083 21.111167281735 80-84 24.017622037674702 27.47113631760178 27.5217743568969 20.989467287826617 85-89 23.990379797574906 27.437618999899787 27.718208237298324 20.853792965226976 90-94 23.90116774419887 27.790307221971634 28.050919661203828 20.25760537262567 95-99 23.49334003518472 27.52450364413169 27.86629806484041 21.115858255843175 100-104 23.737093930999748 27.373457567363385 28.164190380256866 20.725258121380005 105-109 23.72323733360328 26.942349546996002 28.081186414941538 21.25322670445918 110-114 23.644616718518897 27.801295455704594 27.627887999183965 20.926199826592544 115-119 24.201168402336805 27.061214122428247 28.016256032512064 20.721361442722884 120-124 23.509070862984867 27.773879923824797 28.014433196351607 20.70261601683873 125-129 24.043140205668422 27.775269626285425 28.116378229245047 20.065211938801102 130-134 24.015866639887527 27.570797348865234 28.19341233179353 20.219923679453704 135-139 24.391834277975626 27.371219340923908 27.521693334002105 20.715253047098358 140-144 24.048025720888173 27.408821460866072 27.68512006430222 20.858032753943533 145-149 24.679309824437848 27.56174857890236 27.752905075708036 20.00603652095176 150-151 24.109382839939787 27.433517310587053 27.86001003512293 20.597089814350227 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 0.5 14 1.5 15 1.5 16 4.0 17 5.0 18 1.5 19 2.5 20 2.5 21 3.5 22 5.0 23 3.0 24 3.5 25 4.5 26 6.0 27 9.0 28 9.0 29 9.0 30 12.0 31 13.5 32 18.0 33 31.5 34 37.5 35 48.5 36 73.0 37 102.0 38 136.5 39 165.0 40 194.0 41 230.0 42 262.0 43 270.5 44 267.5 45 264.0 46 269.5 47 282.5 48 247.0 49 203.5 50 172.0 51 129.5 52 109.5 53 96.0 54 69.5 55 46.0 56 38.0 57 28.5 58 19.0 59 15.5 60 15.5 61 13.5 62 13.5 63 12.0 64 4.0 65 3.0 66 2.5 67 1.5 68 1.0 69 1.0 70 1.5 71 1.0 72 2.0 73 1.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.35000000000000003 3 1.0250000000000001 4 1.6 5 0.25 6 0.2 7 0.5 8 1.575 9 0.675 10-14 0.885 15-19 1.155 20-24 0.695 25-29 0.255 30-34 0.555 35-39 0.8049999999999999 40-44 0.46499999999999997 45-49 0.395 50-54 0.64 55-59 1.7999999999999998 60-64 1.9900000000000002 65-69 2.035 70-74 0.91 75-79 1.095 80-84 1.26 85-89 0.21 90-94 0.23500000000000001 95-99 0.525 100-104 0.7250000000000001 105-109 1.2149999999999999 110-114 1.965 115-119 1.575 120-124 0.22999999999999998 125-129 0.325 130-134 0.42 135-139 0.315 140-144 0.47000000000000003 145-149 0.605 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42021678850517 98.6 2 0.4789513486261659 0.95 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025207965717166627 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.6499999999999999 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.8375 0.0 0.0 0.0 0.0 134-135 0.9874999999999999 0.0 0.0 0.0 0.0 136-137 1.1625 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAAAAT 10 0.0068822475 144.58975 3 >>END_MODULE Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866683 spots for SRR7168948.sra Written 866683 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra Read 866674 spots for SRR7168948.sra Written 866674 spots for SRR7168948.sra SRR ids: ['SRR7168948.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_78dnppii SRR7168948.sra spots: 17333489 blocks: [[1, 866674], [866675, 1733348], [1733349, 2600022], [2600023, 3466696], [3466697, 4333370], [4333371, 5200044], [5200045, 6066718], [6066719, 6933392], [6933393, 7800066], [7800067, 8666740], [8666741, 9533414], [9533415, 10400088], [10400089, 11266762], [11266763, 12133436], [12133437, 13000110], [13000111, 13866784], [13866785, 14733458], [14733459, 15600132], [15600133, 16466806], [16466807, 17333489]] SRR7168948 file size 5852050 SRR7168948 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168948 SRR7168948_1.fastq SRR7168948_2.fastq Input file: SRR7168948_1.fastq Paired file: SRR7168948_2.fastq trimmed: SRR7168948-trimmed-pair1.fastq, SRR7168948-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:57:29 2025 >> started Mon Feb 10 11:57:48 2025 >> done (18.718s) 17333489 read pairs processed; of these: 28200 ( 0.16%) short read pairs filtered out after trimming by size control 33517 ( 0.19%) empty read pairs filtered out after trimming by size control 17271772 (99.64%) read pairs available; of these: 8123749 (47.03%) trimmed read pairs available after processing 9148023 (52.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 7 0.00% 25 9 0.00% 26 4 0.00% 27 8 0.00% 28 6 0.00% 29 5 0.00% 30 15 0.00% 31 4 0.00% 32 6 0.00% 33 8 0.00% 34 6 0.00% 35 18 0.00% 36 3 0.00% 37 18 0.00% 38 8 0.00% 39 10 0.00% 40 19 0.00% 41 16 0.00% 42 16 0.00% 43 18 0.00% 44 16 0.00% 45 17 0.00% 46 11 0.00% 47 22 0.00% 48 24 0.00% 49 20 0.00% 50 37 0.00% 51 34 0.00% 52 33 0.00% 53 34 0.00% 54 41 0.00% 55 49 0.00% 56 51 0.00% 57 55 0.00% 58 55 0.00% 59 75 0.00% 60 83 0.00% 61 76 0.00% 62 80 0.00% 63 90 0.00% 64 110 0.00% 65 151 0.00% 66 156 0.00% 67 166 0.00% 68 157 0.00% 69 211 0.00% 70 258 0.00% 71 253 0.00% 72 300 0.00% 73 370 0.00% 74 419 0.00% 75 408 0.00% 76 464 0.00% 77 595 0.00% 78 643 0.00% 79 724 0.00% 80 809 0.00% 81 932 0.01% 82 1141 0.01% 83 1351 0.01% 84 2537 0.01% 85 2857 0.02% 86 2909 0.02% 87 3024 0.02% 88 3259 0.02% 89 3208 0.02% 90 3314 0.02% 91 3468 0.02% 92 3641 0.02% 93 3891 0.02% 94 3985 0.02% 95 4576 0.03% 96 4777 0.03% 97 4873 0.03% 98 5260 0.03% 99 5588 0.03% 100 5588 0.03% 101 6131 0.04% 102 6512 0.04% 103 6936 0.04% 104 7334 0.04% 105 7939 0.05% 106 8581 0.05% 107 8871 0.05% 108 9282 0.05% 109 10198 0.06% 110 10627 0.06% 111 10825 0.06% 112 11669 0.07% 113 12420 0.07% 114 12939 0.07% 115 13658 0.08% 116 14668 0.08% 117 15485 0.09% 118 16319 0.09% 119 16945 0.10% 120 18079 0.10% 121 19003 0.11% 122 19860 0.11% 123 21525 0.12% 124 23047 0.13% 125 24538 0.14% 126 26045 0.15% 127 28366 0.16% 128 30153 0.17% 129 31919 0.18% 130 34342 0.20% 131 37607 0.22% 132 39882 0.23% 133 43350 0.25% 134 47174 0.27% 135 51704 0.30% 136 56418 0.33% 137 61261 0.35% 138 67067 0.39% 139 75323 0.44% 140 83881 0.49% 141 93903 0.54% 142 107698 0.62% 143 126054 0.73% 144 150856 0.87% 145 187203 1.08% 146 240982 1.40% 147 333268 1.93% 148 509034 2.95% 149 966354 5.59% 150 4283013 24.80% 151 9148023 52.97% 17271772 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=34 prefix-density=0.19 prefix-fanout=2.6 sequence=CCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCGCCGAAGCGGCCTTGGGTCCAAAAAGAGGGGCAGCGCCCCGCCTCCGATTCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACCTTCGCCGAAGCTCCCACTTATCCTACACCTCTCAAGTCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=241.64 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=18.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=33 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=213.02 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=24.4 sequence=GAAGAAGAAGAAA SRR7168948 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:58:32 Started mapping on | Feb 10 11:58:33 Finished on | Feb 10 12:00:50 Mapping speed, Million of reads per hour | 453.86 Number of input reads | 17271772 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15656748 Uniquely mapped reads % | 90.65% Average mapped length | 296.44 Number of splices: Total | 15023688 Number of splices: Annotated (sjdb) | 14791184 Number of splices: GT/AG | 14808582 Number of splices: GC/AG | 175282 Number of splices: AT/AC | 11497 Number of splices: Non-canonical | 28327 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331780 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 635625 % of reads mapped to too many loci | 3.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1308693 1308693 1308693 N_multimapping 331780 331780 331780 N_noFeature 357833 15481183 436339 N_ambiguous 162764 1463 64522 UnstrandedReadsAssigned:15136151 PositiveStrandReadsAssigned:174102 NegativeStrandReadsAssigned:15155887 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168948 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168948-trimmed-pair1.fastq SRR7168948-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,271,772 reads, 15,504,234 reads pseudoaligned [quant] estimated average fragment length: 270.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52401 SRR7168948.ke.tsv 34699 SRR7168948.se.tsv 87100 total ==> SRR7168948.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.23 312 10.1847 Potri.005G024800.1.v4.1 1035 765.225 65 4.84745 Potri.004G059700.1.v4.1 961 691.268 4 0.33022 Potri.007G009000.2.v4.1 1416 1146.23 0 0 Potri.003G141000.2.v4.1 2943 2673.23 281.066 6.00015 Potri.016G087400.1.v4.1 270 62.1083 1553 1426.96 Potri.015G069301.1.v4.1 564 299.815 0 0 Potri.010G195200.1.v4.1 1773 1503.23 31 1.17687 Potri.012G127500.1.v4.1 977 707.247 7685 620.101 ==> SRR7168948.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1278 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168948 completed mapping pipeline successfully