Starting /dee2/code/volunteer_pipeline.sh SRR7168949 current disk space = 3058888474624 free memory = 1285229556 SRR7168949 SRAfilesize ab90695fa8e82c4ac9b517ba165bc177 SRR7168949.sra SRR7168949.sra file validated SRR7168949 is paired end SRR7168949 is conventional basespace SRR7168949 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168949_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3375 34.0 34.0 34.0 33.0 34.0 2 33.52375 34.0 34.0 34.0 33.0 34.0 3 33.5715 34.0 34.0 34.0 33.0 34.0 4 33.5895 34.0 34.0 34.0 33.0 34.0 5 33.6045 34.0 34.0 34.0 33.0 34.0 6 37.37225 38.0 38.0 38.0 37.0 38.0 7 37.5455 38.0 38.0 38.0 37.0 38.0 8 37.566 38.0 38.0 38.0 37.0 38.0 9 37.5545 38.0 38.0 38.0 38.0 38.0 10-14 37.60805 38.0 38.0 38.0 38.0 38.0 15-19 37.645050000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.63685 38.0 38.0 38.0 38.0 38.0 25-29 37.5713 38.0 38.0 38.0 38.0 38.0 30-34 37.5869 38.0 38.0 38.0 38.0 38.0 35-39 37.41375000000001 38.0 38.0 38.0 37.4 38.0 40-44 37.42605 38.0 38.0 38.0 37.0 38.0 45-49 37.42739999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.35845 38.0 38.0 38.0 37.0 38.0 55-59 37.25635 38.0 38.0 38.0 37.0 38.0 60-64 37.27845 38.0 38.0 38.0 37.0 38.0 65-69 37.204049999999995 38.0 38.0 38.0 36.8 38.0 70-74 37.13535 38.0 38.0 38.0 36.0 38.0 75-79 37.10029999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.93194999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.7791 38.0 38.0 38.0 35.0 38.0 90-94 36.65915 38.0 38.0 38.0 34.6 38.0 95-99 36.447649999999996 38.0 38.0 38.0 33.8 38.0 100-104 36.15895 38.0 37.4 38.0 32.8 38.0 105-109 35.9301 38.0 37.0 38.0 32.0 38.0 110-114 35.51445 38.0 37.0 38.0 29.8 38.0 115-119 35.3149 38.0 36.6 38.0 29.2 38.0 120-124 34.742050000000006 38.0 35.8 38.0 26.8 38.0 125-129 34.3853 38.0 34.8 38.0 25.6 38.0 130-134 33.7927 38.0 33.6 38.0 21.8 38.0 135-139 32.80785000000001 38.0 32.6 38.0 17.0 38.0 140-144 31.806399999999996 37.8 31.4 38.0 13.0 38.0 145-149 29.8919 36.0 28.0 38.0 3.8 38.0 150-151 22.263624999999998 27.0 11.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 2.0 14 0.0 15 2.0 16 3.0 17 0.0 18 3.0 19 2.0 20 6.0 21 7.0 22 7.0 23 10.0 24 16.0 25 17.0 26 19.0 27 31.0 28 34.0 29 44.0 30 50.0 31 61.0 32 74.0 33 131.0 34 226.0 35 407.0 36 1015.0 37 1830.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.11726220432813 12.657272269753397 8.706592853548061 37.51887267237041 2 22.675 14.274999999999999 35.525 27.525 3 18.925 20.95 26.1 34.025 4 23.150000000000002 29.225 23.425 24.2 5 22.59194395796848 33.950462847135356 23.417563172379285 20.040030022516888 6 19.05 36.525 24.7 19.725 7 15.15 25.6 41.65 17.599999999999998 8 18.7 25.650000000000002 30.5 25.15 9 17.599999999999998 25.624999999999996 32.6 24.175 10-14 20.455000000000002 29.294999999999998 26.650000000000002 23.599999999999998 15-19 20.435 28.1 28.305000000000003 23.16 20-24 19.74 28.78 27.87 23.61 25-29 20.080000000000002 28.98 27.474999999999998 23.465 30-34 20.46 28.59 27.46 23.49 35-39 20.169999999999998 29.085 27.544999999999998 23.200000000000003 40-44 20.52 28.82 27.584999999999997 23.075000000000003 45-49 20.115 28.51 27.415 23.96 50-54 20.345 28.744999999999997 27.589999999999996 23.32 55-59 20.345 28.475 27.735 23.445 60-64 20.155 28.63 27.565 23.65 65-69 20.84 28.775000000000002 26.790000000000003 23.595 70-74 20.8 28.365000000000002 26.795 24.04 75-79 20.215 28.78 27.48 23.525 80-84 20.24 28.155 27.63 23.974999999999998 85-89 20.65 28.050000000000004 27.060000000000002 24.240000000000002 90-94 20.580000000000002 28.299999999999997 27.439999999999998 23.68 95-99 21.125 28.065 27.474999999999998 23.335 100-104 20.294999999999998 28.389999999999997 27.73 23.585 105-109 20.815 28.17 27.474999999999998 23.54 110-114 20.965 28.16 27.169999999999998 23.705000000000002 115-119 20.549999999999997 28.065 27.555000000000003 23.830000000000002 120-124 21.025 28.349999999999998 27.224999999999998 23.400000000000002 125-129 20.43 28.544999999999998 27.089999999999996 23.935000000000002 130-134 21.245 27.860000000000003 27.265 23.630000000000003 135-139 21.45 27.965 27.650000000000002 22.935 140-144 20.669999999999998 28.345 27.700000000000003 23.285 145-149 21.57 28.865000000000002 26.405 23.16 150-151 22.3375 27.425 27.900000000000002 22.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 2.5 24 3.5 25 2.5 26 3.0 27 3.5 28 5.0 29 9.5 30 16.5 31 20.5 32 31.5 33 36.5 34 45.5 35 76.5 36 91.5 37 101.0 38 117.5 39 139.5 40 178.0 41 210.5 42 246.5 43 277.5 44 293.0 45 287.0 46 266.5 47 255.5 48 238.5 49 199.0 50 173.0 51 154.0 52 128.0 53 111.5 54 77.5 55 47.5 56 32.5 57 26.0 58 21.0 59 17.0 60 16.0 61 9.5 62 4.0 63 4.5 64 3.0 65 2.5 66 3.0 67 2.0 68 2.0 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2125 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.65 0.0 0.0 0.0 0.0 126-127 1.8625 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.5375 0.0 0.0 0.0 0.0 134-135 2.8125 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCATG 10 0.006830828 145.0 1 >>END_MODULE SRR7168949 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168949_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96175 33.0 33.0 34.0 32.0 34.0 2 33.074 34.0 33.0 34.0 33.0 34.0 3 33.061 34.0 33.0 34.0 33.0 34.0 4 33.10175 34.0 33.0 34.0 33.0 34.0 5 33.02525 34.0 33.0 34.0 33.0 34.0 6 37.221 38.0 38.0 38.0 37.0 38.0 7 37.247 38.0 38.0 38.0 37.0 38.0 8 37.2435 38.0 38.0 38.0 37.0 38.0 9 37.29175 38.0 38.0 38.0 37.0 38.0 10-14 37.23435 38.0 38.0 38.0 37.2 38.0 15-19 37.171350000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.1132 38.0 38.0 38.0 37.0 38.0 25-29 37.0377 38.0 38.0 38.0 37.0 38.0 30-34 37.0382 38.0 38.0 38.0 36.8 38.0 35-39 36.9619 38.0 38.0 38.0 36.4 38.0 40-44 36.9048 38.0 38.0 38.0 36.0 38.0 45-49 36.800650000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.64185 38.0 38.0 38.0 35.0 38.0 55-59 36.539 38.0 38.0 38.0 34.8 38.0 60-64 36.4129 38.0 38.0 38.0 34.4 38.0 65-69 36.312599999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.2277 38.0 38.0 38.0 34.0 38.0 75-79 35.98555 38.0 37.2 38.0 33.4 38.0 80-84 35.76255 38.0 37.0 38.0 31.4 38.0 85-89 35.6601 38.0 37.0 38.0 31.4 38.0 90-94 35.212300000000006 38.0 36.4 38.0 28.6 38.0 95-99 34.9461 38.0 36.0 38.0 28.2 38.0 100-104 34.4427 38.0 34.6 38.0 25.0 38.0 105-109 33.838049999999996 38.0 33.4 38.0 21.8 38.0 110-114 33.35265 38.0 33.0 38.0 18.2 38.0 115-119 32.397450000000006 37.8 32.0 38.0 14.0 38.0 120-124 31.419249999999998 37.0 28.8 38.0 13.4 38.0 125-129 30.3007 36.2 27.2 38.0 12.2 38.0 130-134 29.2866 35.0 24.2 38.0 11.4 38.0 135-139 28.704950000000004 34.0 22.6 38.0 3.8 38.0 140-144 26.7315 33.0 16.0 38.0 2.0 38.0 145-149 24.0836 32.2 6.2 38.0 2.0 38.0 150-151 17.16025 16.0 2.0 33.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 3.0 4 3.0 5 1.0 6 3.0 7 3.0 8 3.0 9 2.0 10 2.0 11 0.0 12 2.0 13 4.0 14 3.0 15 3.0 16 7.0 17 16.0 18 18.0 19 14.0 20 17.0 21 17.0 22 19.0 23 27.0 24 18.0 25 34.0 26 31.0 27 57.0 28 66.0 29 57.0 30 88.0 31 142.0 32 179.0 33 318.0 34 422.0 35 657.0 36 1074.0 37 678.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.7 19.75 11.95 28.599999999999998 2 27.47747747747748 24.824824824824827 31.456456456456454 16.24124124124124 3 20.555833750625936 25.56334501752629 33.02453680520781 20.85628442663996 4 24.768344603055347 32.10618582519409 23.29075882794891 19.834710743801654 5 23.741547708489858 36.06311044327573 22.96518908089156 17.230152767342847 6 20.06504878658994 38.32874655991994 23.14235676757568 18.463847885914436 7 18.939204403302476 21.04078058543908 38.42882161621216 21.591193395046286 8 21.341005754315738 25.494120590442833 28.271203402551915 24.893670252689517 9 21.1408556417313 24.843632724543408 30.2727045283963 23.742807105328996 10-14 23.628544281642245 28.784317647647146 26.553983097464616 21.03315497324599 15-19 22.851142557127858 27.371368568428423 27.931396569828493 21.84609230461523 20-24 22.69180754226268 28.008402520756228 27.69330799239772 21.606481944583376 25-29 22.68 28.185 27.88 21.255 30-34 22.430093542093942 28.10264619078585 28.112650692811762 21.35460957430844 35-39 22.9034355153273 27.73916087413112 27.999199879981994 21.358203730559584 40-44 22.660665166291576 28.127031757939484 28.02200550137534 21.1902975743936 45-49 22.60017007653444 27.67745485468461 28.4027812515632 21.319593817217747 50-54 22.79113955697785 27.996399819990998 28.016400820041003 21.19605980299015 55-59 23.442032609782935 27.433229968990698 28.15844753426028 20.966289886966088 60-64 22.538380757113565 27.359103865579836 28.854328149222386 21.248187228084213 65-69 22.814999999999998 28.205000000000002 28.34 20.64 70-74 23.42968593718744 27.465493098619724 28.030606121224245 21.074214842968594 75-79 23.299659931986398 27.265453090618124 28.275655131026205 21.159231846369273 80-84 23.213482022303346 27.729159373906086 28.064209631444715 20.99314897234585 85-89 23.678287400590207 27.724703646276193 27.669684389536336 20.927324563597256 90-94 23.03115155757788 27.78138906945347 28.241412070603527 20.946047302365116 95-99 23.305 27.794999999999998 27.575 21.325 100-104 23.669999999999998 28.005000000000003 27.3 21.025 105-109 23.461173058652932 27.69638481924096 27.956397819890995 20.88604430221511 110-114 23.24 28.035 27.845 20.880000000000003 115-119 23.432029608882665 27.518255476642995 28.363509052715813 20.686205861758527 120-124 23.36168084042021 27.518759379689843 28.124062031015505 20.995497748874435 125-129 23.87409927942354 27.77722177742194 27.507005604483588 20.841673338670937 130-134 24.20589265169326 27.612425591516182 27.627432344555046 20.554249412235507 135-139 23.6368184092046 27.63881940970485 27.818909454727365 20.905452726363183 140-144 24.08222466740022 28.57857357207162 26.718015404621386 20.621186355906772 145-149 24.167416741674167 27.867786778677868 26.94769476947695 21.01710171017102 150-151 26.0125 27.1 26.775 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 2.5 25 3.5 26 5.0 27 5.0 28 4.5 29 6.5 30 12.5 31 20.0 32 22.5 33 36.5 34 58.5 35 60.5 36 70.5 37 94.0 38 126.5 39 163.5 40 204.0 41 235.5 42 239.5 43 272.0 44 303.5 45 287.0 46 273.0 47 260.5 48 226.5 49 200.5 50 168.5 51 147.0 52 125.0 53 99.5 54 73.5 55 42.5 56 30.5 57 26.5 58 22.5 59 13.0 60 10.5 61 9.0 62 6.5 63 4.5 64 3.5 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 1.0 95 1.0 96 0.5 97 1.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.15 4 0.17500000000000002 5 0.17500000000000002 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.015 15-19 0.005 20-24 0.03 25-29 0.0 30-34 0.045 35-39 0.015 40-44 0.025 45-49 0.045 50-54 0.005 55-59 0.03 60-64 0.015 65-69 0.0 70-74 0.02 75-79 0.02 80-84 0.015 85-89 0.034999999999999996 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.03 120-124 0.05 125-129 0.08 130-134 0.045 135-139 0.05 140-144 0.03 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.6000000000000001 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.3250000000000002 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.9500000000000002 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGG 10 0.006830828 145.0 145 CTAGAAA 10 0.006830828 145.0 1 >>END_MODULE Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918846 spots for SRR7168949.sra Written 918846 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra Read 918844 spots for SRR7168949.sra Written 918844 spots for SRR7168949.sra SRR ids: ['SRR7168949.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6l7fhk1c SRR7168949.sra spots: 18376882 blocks: [[1, 918844], [918845, 1837688], [1837689, 2756532], [2756533, 3675376], [3675377, 4594220], [4594221, 5513064], [5513065, 6431908], [6431909, 7350752], [7350753, 8269596], [8269597, 9188440], [9188441, 10107284], [10107285, 11026128], [11026129, 11944972], [11944973, 12863816], [12863817, 13782660], [13782661, 14701504], [14701505, 15620348], [15620349, 16539192], [16539193, 17458036], [17458037, 18376882]] SRR7168949 file size 6205621 SRR7168949 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168949 SRR7168949_1.fastq SRR7168949_2.fastq Input file: SRR7168949_1.fastq Paired file: SRR7168949_2.fastq trimmed: SRR7168949-trimmed-pair1.fastq, SRR7168949-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:58:52 2025 >> started Mon Feb 10 11:59:24 2025 >> done (31.979s) 18376882 read pairs processed; of these: 15839 ( 0.09%) short read pairs filtered out after trimming by size control 10120 ( 0.06%) empty read pairs filtered out after trimming by size control 18350923 (99.86%) read pairs available; of these: 7774332 (42.36%) trimmed read pairs available after processing 10576591 (57.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 5 0.00% 21 9 0.00% 22 14 0.00% 23 11 0.00% 24 5 0.00% 25 9 0.00% 26 6 0.00% 27 8 0.00% 28 9 0.00% 29 8 0.00% 30 7 0.00% 31 7 0.00% 32 8 0.00% 33 10 0.00% 34 11 0.00% 35 11 0.00% 36 9 0.00% 37 11 0.00% 38 8 0.00% 39 10 0.00% 40 12 0.00% 41 20 0.00% 42 13 0.00% 43 10 0.00% 44 11 0.00% 45 13 0.00% 46 16 0.00% 47 12 0.00% 48 25 0.00% 49 19 0.00% 50 25 0.00% 51 17 0.00% 52 31 0.00% 53 31 0.00% 54 38 0.00% 55 32 0.00% 56 48 0.00% 57 49 0.00% 58 60 0.00% 59 58 0.00% 60 57 0.00% 61 75 0.00% 62 80 0.00% 63 108 0.00% 64 100 0.00% 65 133 0.00% 66 150 0.00% 67 171 0.00% 68 170 0.00% 69 252 0.00% 70 254 0.00% 71 296 0.00% 72 295 0.00% 73 338 0.00% 74 424 0.00% 75 450 0.00% 76 547 0.00% 77 598 0.00% 78 696 0.00% 79 752 0.00% 80 843 0.00% 81 1018 0.01% 82 1158 0.01% 83 1316 0.01% 84 2235 0.01% 85 2780 0.02% 86 2935 0.02% 87 3047 0.02% 88 3292 0.02% 89 3491 0.02% 90 3741 0.02% 91 4007 0.02% 92 4110 0.02% 93 4512 0.02% 94 4874 0.03% 95 5320 0.03% 96 5677 0.03% 97 5899 0.03% 98 6285 0.03% 99 6885 0.04% 100 7379 0.04% 101 7856 0.04% 102 8336 0.05% 103 9000 0.05% 104 9667 0.05% 105 10447 0.06% 106 11049 0.06% 107 11825 0.06% 108 12446 0.07% 109 13202 0.07% 110 14178 0.08% 111 14877 0.08% 112 16027 0.09% 113 17125 0.09% 114 18189 0.10% 115 19600 0.11% 116 20693 0.11% 117 22191 0.12% 118 23734 0.13% 119 24529 0.13% 120 26142 0.14% 121 27700 0.15% 122 29402 0.16% 123 31282 0.17% 124 33439 0.18% 125 35690 0.19% 126 37214 0.20% 127 39973 0.22% 128 41811 0.23% 129 44590 0.24% 130 47534 0.26% 131 49802 0.27% 132 53283 0.29% 133 56651 0.31% 134 60218 0.33% 135 64802 0.35% 136 69862 0.38% 137 75293 0.41% 138 80507 0.44% 139 87562 0.48% 140 95749 0.52% 141 104809 0.57% 142 116957 0.64% 143 131512 0.72% 144 151982 0.83% 145 179855 0.98% 146 222393 1.21% 147 294628 1.61% 148 436093 2.38% 149 810682 4.42% 150 3864461 21.06% 151 10576591 57.64% 18350923 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCAGGTGGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=165.94 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=17.0 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=35 prefix-density=0.33 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=51.15 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.6 sequence=TGTTGGTGGTGG SRR7168949 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:01:12 Started mapping on | Feb 10 12:01:12 Finished on | Feb 10 12:02:53 Mapping speed, Million of reads per hour | 654.09 Number of input reads | 18350923 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17635836 Uniquely mapped reads % | 96.10% Average mapped length | 295.87 Number of splices: Total | 16777799 Number of splices: Annotated (sjdb) | 16500641 Number of splices: GT/AG | 16535728 Number of splices: GC/AG | 192181 Number of splices: AT/AC | 13724 Number of splices: Non-canonical | 36166 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330458 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 28141 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 399623 399623 399623 N_multimapping 330458 330458 330458 N_noFeature 451675 17384086 606255 N_ambiguous 173973 1123 75880 UnstrandedReadsAssigned:17010188 PositiveStrandReadsAssigned:250627 NegativeStrandReadsAssigned:16953701 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168949 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168949-trimmed-pair1.fastq SRR7168949-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,350,923 reads, 16,809,029 reads pseudoaligned [quant] estimated average fragment length: 248.803 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 968 rounds 52401 SRR7168949.ke.tsv 34699 SRR7168949.se.tsv 87100 total ==> SRR7168949.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.2 285 9.55908 Potri.005G024800.1.v4.1 1035 787.197 48 3.62035 Potri.004G059700.1.v4.1 961 713.256 5 0.416215 Potri.007G009000.2.v4.1 1416 1168.2 0 0 Potri.003G141000.2.v4.1 2943 2695.2 313.055 6.89641 Potri.016G087400.1.v4.1 270 73.602 1466 1182.6 Potri.015G069301.1.v4.1 564 322.617 0 0 Potri.010G195200.1.v4.1 1773 1525.2 11 0.428213 Potri.012G127500.1.v4.1 977 729.23 5233 426.068 ==> SRR7168949.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1345 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168949 completed mapping pipeline successfully