Starting /dee2/code/volunteer_pipeline.sh SRR7168950 current disk space = 3058889641984 free memory = 1370334960 SRR7168950 SRAfilesize ee0dd56ab175f3e9061957725538bf2f SRR7168950.sra SRR7168950.sra file validated SRR7168950 is paired end SRR7168950 is conventional basespace SRR7168950 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168950_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2445 34.0 34.0 34.0 33.0 34.0 2 33.4415 34.0 34.0 34.0 33.0 34.0 3 33.5055 34.0 34.0 34.0 33.0 34.0 4 33.51825 34.0 34.0 34.0 33.0 34.0 5 33.52975 34.0 34.0 34.0 33.0 34.0 6 37.247 38.0 38.0 38.0 36.0 38.0 7 37.39825 38.0 38.0 38.0 37.0 38.0 8 37.4215 38.0 38.0 38.0 37.0 38.0 9 37.49075 38.0 38.0 38.0 37.0 38.0 10-14 37.454449999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.49425 38.0 38.0 38.0 37.6 38.0 20-24 37.4851 38.0 38.0 38.0 37.4 38.0 25-29 37.442049999999995 38.0 38.0 38.0 37.2 38.0 30-34 37.47105 38.0 38.0 38.0 37.0 38.0 35-39 37.2808 38.0 38.0 38.0 36.8 38.0 40-44 37.2467 38.0 38.0 38.0 37.0 38.0 45-49 37.21845 38.0 38.0 38.0 36.4 38.0 50-54 37.20115 38.0 38.0 38.0 36.4 38.0 55-59 37.088499999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.13185 38.0 38.0 38.0 36.2 38.0 65-69 37.01005 38.0 38.0 38.0 36.0 38.0 70-74 37.0119 38.0 38.0 38.0 36.0 38.0 75-79 36.85125 38.0 38.0 38.0 35.2 38.0 80-84 36.716550000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.577549999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.444950000000006 38.0 38.0 38.0 33.8 38.0 95-99 36.27065 38.0 37.6 38.0 33.0 38.0 100-104 35.9861 38.0 37.0 38.0 31.4 38.0 105-109 35.663349999999994 38.0 37.0 38.0 30.4 38.0 110-114 35.180099999999996 38.0 36.6 38.0 28.8 38.0 115-119 34.8996 38.0 36.2 38.0 27.8 38.0 120-124 34.20895 38.0 34.6 38.0 23.4 38.0 125-129 33.916199999999996 38.0 34.0 38.0 22.6 38.0 130-134 33.219899999999996 38.0 33.0 38.0 18.4 38.0 135-139 32.20845 38.0 31.6 38.0 13.6 38.0 140-144 31.03245 36.6 28.6 38.0 12.6 38.0 145-149 29.36825 36.0 26.4 38.0 2.0 38.0 150-151 21.21675 19.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 3.0 17 5.0 18 5.0 19 8.0 20 9.0 21 7.0 22 9.0 23 13.0 24 17.0 25 25.0 26 32.0 27 24.0 28 33.0 29 59.0 30 66.0 31 84.0 32 103.0 33 137.0 34 240.0 35 416.0 36 1087.0 37 1615.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.26686807653575 13.645518630412889 7.955689828801611 33.131923464249745 2 23.075000000000003 16.3 34.775 25.85 3 19.375 22.05 27.125 31.45 4 21.375 30.349999999999998 23.474999999999998 24.8 5 21.68584292146073 35.09254627313656 23.6368184092046 19.5847923961981 6 20.25 36.525 24.3 18.925 7 14.7 26.650000000000002 40.8 17.849999999999998 8 18.975 25.1 29.825000000000003 26.1 9 16.825000000000003 26.150000000000002 32.45 24.575 10-14 20.244999999999997 29.854999999999997 26.43 23.47 15-19 19.375 29.354999999999997 27.694999999999997 23.575 20-24 19.509999999999998 29.770000000000003 27.195000000000004 23.525 25-29 19.695 29.74 27.605 22.96 30-34 19.84 29.060000000000002 27.245 23.855 35-39 20.185 28.77 27.275 23.77 40-44 19.759999999999998 28.62 27.575 24.044999999999998 45-49 20.330000000000002 29.075 26.72 23.875 50-54 20.655 28.470000000000002 27.57 23.305 55-59 19.869999999999997 28.775000000000002 27.575 23.78 60-64 20.005 28.249999999999996 27.505000000000003 24.240000000000002 65-69 20.235 28.410000000000004 27.455000000000002 23.9 70-74 20.235 28.999999999999996 27.27 23.494999999999997 75-79 20.200000000000003 28.939999999999998 26.88 23.98 80-84 20.52 28.58 27.084999999999997 23.815 85-89 20.91 28.815 26.700000000000003 23.575 90-94 20.815 28.355000000000004 27.235 23.595 95-99 20.165 28.449999999999996 27.310000000000002 24.075 100-104 20.41 28.675 27.045 23.87 105-109 20.29 28.765 27.115000000000002 23.830000000000002 110-114 20.51 27.865000000000002 28.12 23.505000000000003 115-119 20.8 28.315 27.389999999999997 23.494999999999997 120-124 20.665 28.235 26.924999999999997 24.175 125-129 20.57 28.1 27.155 24.175 130-134 21.14 28.095 27.450000000000003 23.315 135-139 20.19 28.275 27.49 24.044999999999998 140-144 20.365 28.07 26.900000000000002 24.665 145-149 21.029999999999998 27.634999999999998 27.474999999999998 23.86 150-151 20.674999999999997 27.8125 26.9125 24.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 2.5 26 4.5 27 6.5 28 10.5 29 17.0 30 18.5 31 19.0 32 33.5 33 52.5 34 58.0 35 77.5 36 103.5 37 98.5 38 113.5 39 150.0 40 178.5 41 206.0 42 232.5 43 255.0 44 259.5 45 272.0 46 280.5 47 262.0 48 243.5 49 212.0 50 168.0 51 139.0 52 113.0 53 99.0 54 92.0 55 61.0 56 38.5 57 35.0 58 27.0 59 17.0 60 10.5 61 8.5 62 5.0 63 3.5 64 2.5 65 1.0 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168950 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168950_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.793 33.0 33.0 34.0 32.0 34.0 2 32.89825 34.0 33.0 34.0 32.0 34.0 3 32.8235 34.0 33.0 34.0 31.0 34.0 4 32.86 34.0 33.0 34.0 32.0 34.0 5 32.8275 34.0 33.0 34.0 31.0 34.0 6 37.03825 38.0 38.0 38.0 36.0 38.0 7 36.98625 38.0 38.0 38.0 36.0 38.0 8 37.06375 38.0 38.0 38.0 37.0 38.0 9 37.01875 38.0 38.0 38.0 37.0 38.0 10-14 37.01005 38.0 38.0 38.0 36.6 38.0 15-19 36.9339 38.0 38.0 38.0 36.0 38.0 20-24 36.868100000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.79715 38.0 38.0 38.0 36.0 38.0 30-34 36.72605 38.0 38.0 38.0 36.0 38.0 35-39 36.62435 38.0 38.0 38.0 35.6 38.0 40-44 36.624900000000004 38.0 38.0 38.0 35.2 38.0 45-49 36.5107 38.0 38.0 38.0 35.0 38.0 50-54 36.272749999999995 38.0 38.0 38.0 34.0 38.0 55-59 36.24345 38.0 38.0 38.0 33.8 38.0 60-64 36.10045 38.0 38.0 38.0 33.4 38.0 65-69 35.93075 38.0 37.2 38.0 33.0 38.0 70-74 35.83345 38.0 37.0 38.0 32.2 38.0 75-79 35.627900000000004 38.0 37.0 38.0 30.6 38.0 80-84 35.36935 38.0 36.6 38.0 29.0 38.0 85-89 35.19295 38.0 36.4 38.0 28.8 38.0 90-94 34.7803 38.0 35.8 38.0 27.0 38.0 95-99 34.41415 38.0 35.0 38.0 25.0 38.0 100-104 33.8214 38.0 34.2 38.0 20.8 38.0 105-109 33.15535 38.0 32.6 38.0 15.0 38.0 110-114 32.58855 37.8 31.4 38.0 14.8 38.0 115-119 31.64765 37.0 29.8 38.0 13.6 38.0 120-124 30.5373 37.0 28.0 38.0 12.4 38.0 125-129 29.272600000000004 35.2 24.0 38.0 9.4 38.0 130-134 28.14205 33.6 20.6 38.0 2.0 38.0 135-139 27.13675 33.0 17.2 38.0 2.0 38.0 140-144 25.389950000000002 32.2 12.8 38.0 2.0 38.0 145-149 22.9761 30.6 3.8 37.8 2.0 38.0 150-151 16.093 14.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 8.0 4 6.0 5 1.0 6 3.0 7 2.0 8 1.0 9 1.0 10 1.0 11 4.0 12 9.0 13 4.0 14 4.0 15 5.0 16 14.0 17 10.0 18 16.0 19 14.0 20 24.0 21 29.0 22 29.0 23 27.0 24 39.0 25 41.0 26 53.0 27 77.0 28 80.0 29 73.0 30 96.0 31 139.0 32 207.0 33 292.0 34 446.0 35 709.0 36 983.0 37 539.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.35 24.65 10.5 24.5 2 27.2022022022022 25.8008008008008 30.08008008008008 16.916916916916914 3 19.06312625250501 29.008016032064127 30.886773547094187 21.04208416833667 4 22.970941883767534 34.018036072144284 24.04809619238477 18.962925851703407 5 24.50513655725382 36.60736657479329 21.09746930593836 17.790027562014533 6 21.66624968726545 38.65399049286965 21.541155866900176 18.138603952964726 7 21.4160620465349 20.965724293219914 37.277958468851644 20.340255191393545 8 21.66624968726545 26.09457092819615 26.8951713785339 25.344008006004504 9 20.935467733866933 25.387693846923458 29.71485742871436 23.961980990495245 10-14 22.94303006052118 29.015155304356526 26.444255489421298 21.597559145700995 15-19 22.709083633453382 28.026210484193676 27.751100440176067 21.51360544217687 20-24 23.431715857928964 27.973986993496748 27.173586793396698 21.42071035517759 25-29 23.050372667700465 27.202241008453804 28.47781501675754 21.26957130708819 30-34 22.958775265159094 28.066840104062436 27.65159095457274 21.322793676205723 35-39 23.325496473413036 27.762493121904857 27.307288279725878 21.60472212495623 40-44 22.86914765906363 28.581432573029215 27.55602240896359 20.99339735894358 45-49 23.133880328196916 28.301981188713228 27.25135081048629 21.312787672603562 50-54 23.185433445050272 28.162673202941324 27.392326546946126 21.259566805062278 55-59 23.301650825412707 27.85892946473237 28.23911955977989 20.60030015007504 60-64 23.27814735157305 28.14485069774421 28.329915470414647 20.247086480268095 65-69 23.348171860151055 28.309908467963783 27.33456709848447 21.007352573400688 70-74 23.281640820410203 27.99899949974988 27.978989494747374 20.740370185092548 75-79 23.965784603071384 27.342304036816568 27.717472862788256 20.974438497323796 80-84 23.060377169726376 27.917562903306486 28.137661947876545 20.88439797909059 85-89 23.609443777511004 27.355942376950782 28.306322529011606 20.72829131652661 90-94 23.238133346671336 27.354574100935324 28.079827939778923 21.327464612614417 95-99 23.383184114440052 27.184514580103038 27.999799929975495 21.43250137548142 100-104 24.322296689006702 27.20816244873462 27.643292987896366 20.82624787436231 105-109 23.39467893578716 27.40548109621924 28.540708141628322 20.659131826365275 110-114 23.570892723180794 27.176794198549636 27.76694173543386 21.48537134283571 115-119 23.739495798319325 28.106242496998803 27.485994397759107 20.66826730692277 120-124 23.82929757854713 27.601560936561935 27.366419851911143 21.202721632979788 125-129 23.80166116281397 27.789452616831785 27.304112879015314 21.104773341338937 130-134 24.17208604302151 27.603801900950476 27.293646823411706 20.930465232616307 135-139 24.43221610805403 27.05352676338169 27.238619309654826 21.275637818909455 140-144 24.035816117252764 27.73247961582712 27.5423940773348 20.689310189585314 145-149 24.29228768630589 27.128138441532464 27.7333199959988 20.846253876162848 150-151 25.26263131565783 25.962981490745374 28.16408204102051 20.610305152576288 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 1.5 28 2.5 29 6.0 30 13.0 31 17.0 32 20.0 33 32.5 34 39.0 35 55.0 36 89.5 37 117.0 38 138.0 39 161.0 40 189.5 41 214.0 42 236.5 43 261.5 44 277.0 45 289.0 46 298.5 47 255.0 48 234.5 49 225.0 50 177.5 51 157.5 52 134.5 53 97.0 54 64.5 55 45.0 56 35.0 57 28.0 58 19.5 59 12.0 60 7.0 61 7.5 62 5.5 63 1.0 64 1.0 65 1.0 66 0.5 67 1.0 68 1.5 69 2.0 70 3.0 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.2 4 0.2 5 0.22499999999999998 6 0.075 7 0.075 8 0.075 9 0.05 10-14 0.034999999999999996 15-19 0.04 20-24 0.05 25-29 0.045 30-34 0.06 35-39 0.045 40-44 0.04 45-49 0.06 50-54 0.045 55-59 0.05 60-64 0.034999999999999996 65-69 0.034999999999999996 70-74 0.05 75-79 0.045 80-84 0.045 85-89 0.04 90-94 0.034999999999999996 95-99 0.034999999999999996 100-104 0.03 105-109 0.02 110-114 0.025 115-119 0.04 120-124 0.06 125-129 0.06999999999999999 130-134 0.05 135-139 0.05 140-144 0.045 145-149 0.03 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTAAAG 10 0.0065840036 146.77216 1 TGCAACA 10 0.0068396386 144.9375 7 ATGCAAC 10 0.0068396386 144.9375 6 >>END_MODULE Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771130 spots for SRR7168950.sra Written 771130 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra Read 771125 spots for SRR7168950.sra Written 771125 spots for SRR7168950.sra SRR ids: ['SRR7168950.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f293628m SRR7168950.sra spots: 15422505 blocks: [[1, 771125], [771126, 1542250], [1542251, 2313375], [2313376, 3084500], [3084501, 3855625], [3855626, 4626750], [4626751, 5397875], [5397876, 6169000], [6169001, 6940125], [6940126, 7711250], [7711251, 8482375], [8482376, 9253500], [9253501, 10024625], [10024626, 10795750], [10795751, 11566875], [11566876, 12338000], [12338001, 13109125], [13109126, 13880250], [13880251, 14651375], [14651376, 15422505]] SRR7168950 file size 5204480 SRR7168950 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168950 SRR7168950_1.fastq SRR7168950_2.fastq Input file: SRR7168950_1.fastq Paired file: SRR7168950_2.fastq trimmed: SRR7168950-trimmed-pair1.fastq, SRR7168950-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:49:47 2025 >> started Mon Feb 10 11:50:03 2025 >> done (15.904s) 15422505 read pairs processed; of these: 22306 ( 0.14%) short read pairs filtered out after trimming by size control 16385 ( 0.11%) empty read pairs filtered out after trimming by size control 15383814 (99.75%) read pairs available; of these: 6664874 (43.32%) trimmed read pairs available after processing 8718940 (56.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 4 0.00% 21 5 0.00% 22 11 0.00% 23 6 0.00% 24 8 0.00% 25 7 0.00% 26 6 0.00% 27 7 0.00% 28 6 0.00% 29 5 0.00% 30 8 0.00% 31 6 0.00% 32 3 0.00% 33 4 0.00% 34 8 0.00% 35 11 0.00% 36 5 0.00% 37 6 0.00% 38 9 0.00% 39 7 0.00% 40 12 0.00% 41 9 0.00% 42 17 0.00% 43 12 0.00% 44 10 0.00% 45 7 0.00% 46 14 0.00% 47 8 0.00% 48 11 0.00% 49 28 0.00% 50 19 0.00% 51 24 0.00% 52 29 0.00% 53 42 0.00% 54 35 0.00% 55 45 0.00% 56 34 0.00% 57 50 0.00% 58 55 0.00% 59 71 0.00% 60 72 0.00% 61 86 0.00% 62 122 0.00% 63 112 0.00% 64 115 0.00% 65 122 0.00% 66 132 0.00% 67 143 0.00% 68 197 0.00% 69 223 0.00% 70 261 0.00% 71 261 0.00% 72 325 0.00% 73 344 0.00% 74 413 0.00% 75 404 0.00% 76 437 0.00% 77 548 0.00% 78 602 0.00% 79 736 0.00% 80 799 0.01% 81 963 0.01% 82 1139 0.01% 83 1354 0.01% 84 2340 0.02% 85 3070 0.02% 86 3125 0.02% 87 3268 0.02% 88 3452 0.02% 89 3510 0.02% 90 3600 0.02% 91 3743 0.02% 92 4057 0.03% 93 4176 0.03% 94 4671 0.03% 95 4995 0.03% 96 5280 0.03% 97 5498 0.04% 98 5892 0.04% 99 6200 0.04% 100 6816 0.04% 101 7050 0.05% 102 7656 0.05% 103 8235 0.05% 104 8606 0.06% 105 9334 0.06% 106 9901 0.06% 107 10351 0.07% 108 10981 0.07% 109 11456 0.07% 110 12403 0.08% 111 12926 0.08% 112 13726 0.09% 113 15120 0.10% 114 15838 0.10% 115 17174 0.11% 116 17661 0.11% 117 18618 0.12% 118 19608 0.13% 119 20476 0.13% 120 21646 0.14% 121 22932 0.15% 122 24306 0.16% 123 26125 0.17% 124 28134 0.18% 125 29629 0.19% 126 31247 0.20% 127 32808 0.21% 128 34575 0.22% 129 36489 0.24% 130 38828 0.25% 131 41025 0.27% 132 43899 0.29% 133 47439 0.31% 134 50705 0.33% 135 54863 0.36% 136 58950 0.38% 137 64219 0.42% 138 68944 0.45% 139 73812 0.48% 140 80955 0.53% 141 89261 0.58% 142 99203 0.64% 143 113307 0.74% 144 131813 0.86% 145 156764 1.02% 146 194728 1.27% 147 258705 1.68% 148 383176 2.49% 149 713822 4.64% 150 3281169 21.33% 151 8718940 56.68% 15383814 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.3 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=94.48 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.1 sequence=AAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTATTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.94 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=4.2 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=52.73 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.8 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7168950 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:50:46 Started mapping on | Feb 10 11:50:46 Finished on | Feb 10 11:52:05 Mapping speed, Million of reads per hour | 701.03 Number of input reads | 15383814 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14670469 Uniquely mapped reads % | 95.36% Average mapped length | 295.73 Number of splices: Total | 13556711 Number of splices: Annotated (sjdb) | 13335145 Number of splices: GT/AG | 13378541 Number of splices: GC/AG | 140608 Number of splices: AT/AC | 11193 Number of splices: Non-canonical | 26369 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248469 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 34269 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485167 485167 485167 N_multimapping 248469 248469 248469 N_noFeature 322479 14475724 394854 N_ambiguous 179957 758 57127 UnstrandedReadsAssigned:14168033 PositiveStrandReadsAssigned:193987 NegativeStrandReadsAssigned:14218488 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168950 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168950-trimmed-pair1.fastq SRR7168950-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,383,814 reads, 14,110,440 reads pseudoaligned [quant] estimated average fragment length: 260.988 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR7168950.ke.tsv 34699 SRR7168950.se.tsv 87100 total ==> SRR7168950.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.01 213 7.96919 Potri.005G024800.1.v4.1 1035 775.012 26 2.20659 Potri.004G059700.1.v4.1 961 701.102 2 0.187631 Potri.007G009000.2.v4.1 1416 1156.01 0 0 Potri.003G141000.2.v4.1 2943 2683.01 254 6.22684 Potri.016G087400.1.v4.1 270 70.9486 1160.42 1075.79 Potri.015G069301.1.v4.1 564 312.557 0 0 Potri.010G195200.1.v4.1 1773 1513.01 11 0.478197 Potri.012G127500.1.v4.1 977 717.058 3984 365.445 ==> SRR7168950.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1752 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 212 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168950 completed mapping pipeline successfully