Starting /dee2/code/volunteer_pipeline.sh SRR7168951 current disk space = 3059145646080 free memory = 1206605568 SRR7168951 SRAfilesize 331bae7e783a9aad586d69f8352ff96a SRR7168951.sra SRR7168951.sra file validated SRR7168951 is paired end SRR7168951 is conventional basespace SRR7168951 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168951_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.04975 34.0 33.0 34.0 28.0 34.0 2 32.77575 34.0 33.0 34.0 28.0 34.0 3 32.91525 34.0 33.0 34.0 32.0 34.0 4 33.17125 34.0 33.0 34.0 32.0 34.0 5 33.1615 34.0 33.0 34.0 32.0 34.0 6 36.6685 38.0 37.0 38.0 34.0 38.0 7 37.15975 38.0 38.0 38.0 36.0 38.0 8 37.23725 38.0 38.0 38.0 36.0 38.0 9 37.3015 38.0 38.0 38.0 37.0 38.0 10-14 37.25175 38.0 38.0 38.0 36.6 38.0 15-19 37.3173 38.0 38.0 38.0 36.6 38.0 20-24 37.2716 38.0 38.0 38.0 36.4 38.0 25-29 37.1503 38.0 38.0 38.0 36.2 38.0 30-34 37.1684 38.0 38.0 38.0 36.0 38.0 35-39 37.09315 38.0 38.0 38.0 36.0 38.0 40-44 36.918099999999995 38.0 38.0 38.0 35.6 38.0 45-49 36.78405 38.0 38.0 38.0 35.0 38.0 50-54 36.69625 38.0 38.0 38.0 34.4 38.0 55-59 36.6082 38.0 38.0 38.0 34.0 38.0 60-64 36.46345 38.0 37.8 38.0 34.0 38.0 65-69 36.4012 38.0 37.4 38.0 33.8 38.0 70-74 36.3161 38.0 37.0 38.0 33.6 38.0 75-79 36.1246 38.0 37.0 38.0 33.0 38.0 80-84 36.12415 38.0 37.0 38.0 33.0 38.0 85-89 36.036500000000004 38.0 37.0 38.0 32.8 38.0 90-94 35.7373 38.0 37.0 38.0 31.0 38.0 95-99 35.5078 38.0 36.0 38.0 29.0 38.0 100-104 35.10875 38.0 35.8 38.0 28.6 38.0 105-109 35.0427 38.0 35.4 38.0 28.2 38.0 110-114 34.72175 38.0 35.0 38.0 26.8 38.0 115-119 34.5274 38.0 34.8 38.0 25.8 38.0 120-124 33.76595 38.0 34.0 38.0 19.8 38.0 125-129 33.4399 37.8 33.8 38.0 17.8 38.0 130-134 33.535000000000004 38.0 34.0 38.0 19.4 38.0 135-139 33.070949999999996 37.8 33.2 38.0 16.2 38.0 140-144 32.34495 36.8 33.0 38.0 14.2 38.0 145-149 30.8354 36.0 30.4 38.0 9.0 38.0 150-151 26.905375 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 2.0 16 3.0 17 3.0 18 4.0 19 6.0 20 10.0 21 10.0 22 6.0 23 11.0 24 8.0 25 18.0 26 36.0 27 43.0 28 53.0 29 52.0 30 81.0 31 100.0 32 132.0 33 156.0 34 280.0 35 505.0 36 1010.0 37 1464.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.025695931477514 11.937901498929335 9.823340471092077 39.21306209850107 2 21.725 16.0 34.275 28.000000000000004 3 18.85 19.675 25.174999999999997 36.3 4 23.075000000000003 27.575 22.425 26.924999999999997 5 22.7 33.35 24.0 19.950000000000003 6 18.925 37.925 23.35 19.8 7 14.95 27.400000000000002 39.7 17.95 8 18.8 26.875 29.799999999999997 24.525 9 17.0 25.75 32.9 24.349999999999998 10-14 20.26 29.865000000000002 26.805 23.07 15-19 19.85 29.37 27.584999999999997 23.195 20-24 19.915 29.12 27.47 23.494999999999997 25-29 20.015 29.345 27.38 23.26 30-34 20.21 28.965000000000003 27.474999999999998 23.35 35-39 19.73 29.520000000000003 26.900000000000002 23.849999999999998 40-44 19.994999999999997 29.54 26.525 23.94 45-49 20.165 28.4 27.61 23.825 50-54 20.375 29.035 27.495000000000005 23.095 55-59 19.509999999999998 29.12 27.57 23.799999999999997 60-64 19.945 28.87 27.139999999999997 24.044999999999998 65-69 20.655 29.160000000000004 27.095000000000002 23.09 70-74 20.54 28.68 27.54 23.24 75-79 20.02 28.51 27.46 24.01 80-84 20.76 28.505000000000003 27.075 23.66 85-89 19.985 29.125 27.32 23.57 90-94 20.46 28.13 27.735 23.674999999999997 95-99 20.49 28.575 27.48 23.455000000000002 100-104 20.175 28.854999999999997 27.13 23.84 105-109 21.04 27.83 27.42 23.71 110-114 20.13 28.825 27.1 23.945 115-119 20.43 28.754999999999995 27.3 23.515 120-124 20.645 28.4 27.169999999999998 23.785 125-129 20.225 28.765 27.134999999999998 23.875 130-134 21.255 28.015 27.455000000000002 23.275000000000002 135-139 20.515 28.555000000000003 27.12 23.810000000000002 140-144 20.43 28.255000000000003 27.07 24.245 145-149 20.435 28.525 27.11 23.93 150-151 21.1875 27.700000000000003 27.6875 23.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.5 20 1.5 21 0.5 22 0.0 23 0.0 24 2.5 25 6.0 26 5.5 27 4.5 28 6.0 29 9.0 30 19.0 31 34.0 32 35.5 33 48.5 34 70.5 35 82.5 36 94.5 37 111.5 38 129.0 39 155.5 40 188.0 41 204.0 42 229.5 43 242.0 44 254.0 45 278.0 46 273.5 47 254.0 48 226.5 49 201.0 50 169.0 51 138.0 52 122.5 53 99.0 54 80.5 55 63.0 56 40.5 57 28.0 58 23.5 59 20.0 60 14.0 61 9.5 62 6.5 63 4.0 64 3.0 65 2.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.6000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8375 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.2 0.0 0.0 0.0 0.0 134-135 1.4500000000000002 0.0 0.0 0.0 0.0 136-137 1.6375000000000002 0.0 0.0 0.0 0.0 138-139 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168951 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168951_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72175 33.0 33.0 34.0 32.0 34.0 2 32.72275 33.0 33.0 34.0 32.0 34.0 3 32.78575 34.0 33.0 34.0 32.0 34.0 4 32.75275 34.0 33.0 34.0 32.0 34.0 5 32.658 34.0 33.0 34.0 32.0 34.0 6 36.90275 38.0 38.0 38.0 36.0 38.0 7 37.0345 38.0 38.0 38.0 36.0 38.0 8 37.0165 38.0 38.0 38.0 36.0 38.0 9 36.8815 38.0 38.0 38.0 36.0 38.0 10-14 36.9481 38.0 38.0 38.0 36.0 38.0 15-19 36.931799999999996 38.0 38.0 38.0 36.2 38.0 20-24 36.9172 38.0 38.0 38.0 36.0 38.0 25-29 36.77565 38.0 38.0 38.0 35.8 38.0 30-34 36.691050000000004 38.0 38.0 38.0 35.4 38.0 35-39 36.7384 38.0 38.0 38.0 35.6 38.0 40-44 36.75175 38.0 38.0 38.0 35.8 38.0 45-49 36.7239 38.0 38.0 38.0 35.4 38.0 50-54 36.671749999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.5271 38.0 38.0 38.0 34.6 38.0 60-64 36.54615 38.0 38.0 38.0 34.8 38.0 65-69 36.42525 38.0 38.0 38.0 34.2 38.0 70-74 36.4394 38.0 38.0 38.0 34.2 38.0 75-79 36.355450000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.2488 38.0 38.0 38.0 34.0 38.0 85-89 36.138600000000004 38.0 38.0 38.0 33.6 38.0 90-94 36.013099999999994 38.0 38.0 38.0 32.8 38.0 95-99 35.823249999999994 38.0 37.6 38.0 31.4 38.0 100-104 35.642500000000005 38.0 37.0 38.0 30.8 38.0 105-109 35.584 38.0 37.0 38.0 31.0 38.0 110-114 35.42659999999999 38.0 37.0 38.0 30.2 38.0 115-119 35.11405 38.0 36.4 38.0 28.2 38.0 120-124 35.0954 38.0 36.0 38.0 28.6 38.0 125-129 34.652300000000004 38.0 35.8 38.0 26.6 38.0 130-134 34.19135 38.0 35.0 38.0 23.4 38.0 135-139 33.93325 38.0 35.0 38.0 22.6 38.0 140-144 33.633250000000004 38.0 34.8 38.0 20.2 38.0 145-149 32.95399999999999 38.0 33.8 38.0 15.2 38.0 150-151 28.50875 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 3.0 5 1.0 6 1.0 7 1.0 8 2.0 9 0.0 10 1.0 11 2.0 12 2.0 13 5.0 14 5.0 15 6.0 16 5.0 17 7.0 18 6.0 19 6.0 20 10.0 21 10.0 22 19.0 23 13.0 24 15.0 25 22.0 26 23.0 27 37.0 28 36.0 29 43.0 30 66.0 31 52.0 32 71.0 33 124.0 34 168.0 35 258.0 36 621.0 37 2346.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.113198096669166 21.68795391935888 14.099674430252943 28.09917355371901 2 27.641462193289932 26.84026039058588 29.944917376064094 15.573360040060091 3 21.21212121212121 27.573253193087904 30.077635862759827 21.136989732031054 4 22.915101427498122 33.70899073378412 24.467818682694716 18.90808915602304 5 25.219133483596295 34.710743801652896 22.088655146506387 17.981467568244426 6 20.02002002002002 38.26326326326326 22.097097097097095 19.61961961961962 7 19.51951951951952 21.546546546546548 39.91491491491492 19.01901901901902 8 21.67167167167167 24.674674674674673 28.503503503503502 25.150150150150154 9 22.12212212212212 25.425425425425423 29.57957957957958 22.872872872872875 10-14 23.47847847847848 28.303303303303302 26.38138138138138 21.836836836836838 15-19 23.443443443443442 28.033033033033032 27.442442442442445 21.08108108108108 20-24 23.053053053053052 27.637637637637635 27.74274274274274 21.566566566566568 25-29 23.36836836836837 28.233233233233236 27.24224224224224 21.156156156156154 30-34 23.74874874874875 27.45745745745746 28.36836836836837 20.425425425425423 35-39 23.58858858858859 28.298298298298295 27.022022022022025 21.09109109109109 40-44 23.173173173173172 27.822822822822822 27.52752752752753 21.476476476476478 45-49 23.493493493493496 27.5025025025025 27.68268268268268 21.32132132132132 50-54 23.183183183183186 27.81781781781782 27.65765765765766 21.34134134134134 55-59 23.67867867867868 27.86786786786787 27.90790790790791 20.545545545545547 60-64 23.92892892892893 28.24824824824825 27.467467467467465 20.355355355355357 65-69 24.245457730617147 27.3987687071425 27.639020972020624 20.71675259021973 70-74 23.79498473397067 27.78917863756945 27.598978927874267 20.816857700585615 75-79 23.593593593593592 27.792792792792792 27.73773773773774 20.875875875875877 80-84 23.659842834976725 27.333700385404676 28.249662145252515 20.756794634366084 85-89 23.68868868868869 27.62262262262262 27.64764764764765 21.04104104104104 90-94 23.863636363636363 27.157589106928313 27.818382058470164 21.16039247096516 95-99 23.6984381257509 27.843412094513415 27.888466159391267 20.569683620344414 100-104 23.677228813135105 27.296390849476897 28.4026630625219 20.623717274866095 105-109 24.286715386925618 27.335068575432974 28.12093302632896 20.257283011312445 110-114 23.90009509985485 27.739126082386505 27.894289003453625 20.46648981430502 115-119 23.783540248297957 27.748297957549056 27.848418101722068 20.619743692430916 120-124 23.351854632827752 27.887070130650248 27.91710467037093 20.843970566151075 125-129 24.16157773550906 28.105916508158973 27.054760236259884 20.67774552007208 130-134 24.133960752903487 27.638165798958752 27.68822587104525 20.53964757709251 135-139 24.016418059865853 27.54529982981279 27.75052557813595 20.687756532185404 140-144 23.942533914001103 27.26635630975622 27.897081643890477 20.894028132352204 145-149 23.887470591179856 27.431546278219955 27.902087400510588 20.7788957300896 150-151 24.14914914914915 27.08958958958959 27.715215215215217 21.046046046046047 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.0 28 2.5 29 2.0 30 4.5 31 7.5 32 14.0 33 26.5 34 40.5 35 50.5 36 64.0 37 89.0 38 119.0 39 156.5 40 197.5 41 228.0 42 250.0 43 284.0 44 306.5 45 298.5 46 295.0 47 298.5 48 264.0 49 203.0 50 169.5 51 142.0 52 111.5 53 94.5 54 71.5 55 55.0 56 43.5 57 29.0 58 18.5 59 14.5 60 13.5 61 7.5 62 5.0 63 5.0 64 3.5 65 1.5 66 1.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.15 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.1 15-19 0.1 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.105 70-74 0.105 75-79 0.1 80-84 0.105 85-89 0.1 90-94 0.12 95-99 0.12 100-104 0.11499999999999999 105-109 0.11 110-114 0.105 115-119 0.12 120-124 0.11499999999999999 125-129 0.11 130-134 0.12 135-139 0.11 140-144 0.11499999999999999 145-149 0.11499999999999999 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.32630522088353414 0.65 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.6625 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.9125000000000001 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.55 0.0 0.0 0.0 0.0 138-139 1.7999999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTATT 10 0.006830828 145.0 4 >>END_MODULE Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951092 spots for SRR7168951.sra Written 951092 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra Read 951075 spots for SRR7168951.sra Written 951075 spots for SRR7168951.sra SRR ids: ['SRR7168951.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r57cpji1 SRR7168951.sra spots: 19021517 blocks: [[1, 951075], [951076, 1902150], [1902151, 2853225], [2853226, 3804300], [3804301, 4755375], [4755376, 5706450], [5706451, 6657525], [6657526, 7608600], [7608601, 8559675], [8559676, 9510750], [9510751, 10461825], [10461826, 11412900], [11412901, 12363975], [12363976, 13315050], [13315051, 14266125], [14266126, 15217200], [15217201, 16168275], [16168276, 17119350], [17119351, 18070425], [18070426, 19021517]] SRR7168951 file size 6424067 SRR7168951 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168951 SRR7168951_1.fastq SRR7168951_2.fastq Input file: SRR7168951_1.fastq Paired file: SRR7168951_2.fastq trimmed: SRR7168951-trimmed-pair1.fastq, SRR7168951-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:37:49 2025 >> started Mon Feb 10 11:38:10 2025 >> done (21.386s) 19021517 read pairs processed; of these: 37543 ( 0.20%) short read pairs filtered out after trimming by size control 88818 ( 0.47%) empty read pairs filtered out after trimming by size control 18895156 (99.34%) read pairs available; of these: 9392068 (49.71%) trimmed read pairs available after processing 9503088 (50.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 0 0.00% 23 3 0.00% 24 5 0.00% 25 3 0.00% 26 2 0.00% 27 7 0.00% 28 6 0.00% 29 4 0.00% 30 10 0.00% 31 7 0.00% 32 9 0.00% 33 8 0.00% 34 13 0.00% 35 9 0.00% 36 7 0.00% 37 17 0.00% 38 20 0.00% 39 12 0.00% 40 21 0.00% 41 20 0.00% 42 23 0.00% 43 23 0.00% 44 28 0.00% 45 29 0.00% 46 25 0.00% 47 32 0.00% 48 36 0.00% 49 34 0.00% 50 37 0.00% 51 57 0.00% 52 53 0.00% 53 45 0.00% 54 64 0.00% 55 70 0.00% 56 70 0.00% 57 108 0.00% 58 112 0.00% 59 89 0.00% 60 110 0.00% 61 119 0.00% 62 145 0.00% 63 143 0.00% 64 182 0.00% 65 200 0.00% 66 191 0.00% 67 240 0.00% 68 272 0.00% 69 335 0.00% 70 367 0.00% 71 393 0.00% 72 429 0.00% 73 521 0.00% 74 513 0.00% 75 593 0.00% 76 680 0.00% 77 730 0.00% 78 885 0.00% 79 893 0.00% 80 1076 0.01% 81 1210 0.01% 82 1330 0.01% 83 1769 0.01% 84 3135 0.02% 85 3792 0.02% 86 3780 0.02% 87 3729 0.02% 88 3884 0.02% 89 3966 0.02% 90 4040 0.02% 91 4265 0.02% 92 4702 0.02% 93 4975 0.03% 94 5088 0.03% 95 5404 0.03% 96 5628 0.03% 97 5973 0.03% 98 6453 0.03% 99 6760 0.04% 100 7161 0.04% 101 7566 0.04% 102 7999 0.04% 103 8714 0.05% 104 9361 0.05% 105 9963 0.05% 106 10450 0.06% 107 11382 0.06% 108 11680 0.06% 109 12413 0.07% 110 13198 0.07% 111 14179 0.08% 112 14926 0.08% 113 16091 0.09% 114 17027 0.09% 115 18339 0.10% 116 19365 0.10% 117 20525 0.11% 118 21982 0.12% 119 23139 0.12% 120 24588 0.13% 121 25529 0.14% 122 27458 0.15% 123 29403 0.16% 124 32064 0.17% 125 33738 0.18% 126 36349 0.19% 127 38925 0.21% 128 41208 0.22% 129 44083 0.23% 130 46883 0.25% 131 49991 0.26% 132 53977 0.29% 133 58953 0.31% 134 62283 0.33% 135 67462 0.36% 136 73022 0.39% 137 79570 0.42% 138 86573 0.46% 139 95529 0.51% 140 106384 0.56% 141 119131 0.63% 142 135453 0.72% 143 156261 0.83% 144 183109 0.97% 145 223984 1.19% 146 285333 1.51% 147 389037 2.06% 148 593982 3.14% 149 1142615 6.05% 150 4683700 24.79% 151 9503088 50.29% 18895156 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=36 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=191.98 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=12.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=43 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=52.37 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.3 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7168951 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:39:05 Started mapping on | Feb 10 11:39:06 Finished on | Feb 10 11:41:18 Mapping speed, Million of reads per hour | 515.32 Number of input reads | 18895156 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17797860 Uniquely mapped reads % | 94.19% Average mapped length | 295.77 Number of splices: Total | 16282785 Number of splices: Annotated (sjdb) | 16015400 Number of splices: GT/AG | 16058570 Number of splices: GC/AG | 176912 Number of splices: AT/AC | 13328 Number of splices: Non-canonical | 33975 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357690 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 69290 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 764126 764126 764126 N_multimapping 357690 357690 357690 N_noFeature 372774 17576432 452254 N_ambiguous 215838 925 73337 UnstrandedReadsAssigned:17209248 PositiveStrandReadsAssigned:220503 NegativeStrandReadsAssigned:17272269 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168951 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168951-trimmed-pair1.fastq SRR7168951-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,895,156 reads, 17,205,944 reads pseudoaligned [quant] estimated average fragment length: 259.712 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR7168951.ke.tsv 34699 SRR7168951.se.tsv 87100 total ==> SRR7168951.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.29 328 9.92544 Potri.005G024800.1.v4.1 1035 776.288 29 1.98879 Potri.004G059700.1.v4.1 961 702.301 1 0.0758036 Potri.007G009000.2.v4.1 1416 1157.29 0 0 Potri.003G141000.2.v4.1 2943 2684.29 240.049 4.76085 Potri.016G087400.1.v4.1 270 65.5744 1798.82 1460.38 Potri.015G069301.1.v4.1 564 310.016 0 0 Potri.010G195200.1.v4.1 1773 1514.29 12 0.421877 Potri.012G127500.1.v4.1 977 718.295 3910 289.792 ==> SRR7168951.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2043 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 293 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168951 completed mapping pipeline successfully