Starting /dee2/code/volunteer_pipeline.sh SRR7168952 current disk space = 3058899697664 free memory = 1456989420 SRR7168952 SRAfilesize 56c2e9cec28336130f2290694dd90358 SRR7168952.sra SRR7168952.sra file validated SRR7168952 is paired end SRR7168952 is conventional basespace SRR7168952 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168952_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.57275 34.0 34.0 34.0 33.0 34.0 2 33.71575 34.0 34.0 34.0 33.0 34.0 3 33.7285 34.0 34.0 34.0 33.0 34.0 4 33.74625 34.0 34.0 34.0 33.0 34.0 5 33.76425 34.0 34.0 34.0 33.0 34.0 6 37.49225 38.0 38.0 38.0 37.0 38.0 7 37.73025 38.0 38.0 38.0 38.0 38.0 8 37.746 38.0 38.0 38.0 38.0 38.0 9 37.61725 38.0 38.0 38.0 38.0 38.0 10-14 37.7244 38.0 38.0 38.0 38.0 38.0 15-19 37.7355 38.0 38.0 38.0 38.0 38.0 20-24 37.7047 38.0 38.0 38.0 38.0 38.0 25-29 37.68945 38.0 38.0 38.0 38.0 38.0 30-34 37.687200000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.5387 38.0 38.0 38.0 38.0 38.0 40-44 37.438300000000005 38.0 38.0 38.0 37.4 38.0 45-49 37.43175 38.0 38.0 38.0 37.0 38.0 50-54 37.421499999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.3487 38.0 38.0 38.0 37.0 38.0 60-64 37.30775 38.0 38.0 38.0 37.0 38.0 65-69 37.2419 38.0 38.0 38.0 37.0 38.0 70-74 37.188900000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.154 38.0 38.0 38.0 36.8 38.0 80-84 37.0394 38.0 38.0 38.0 36.0 38.0 85-89 36.9958 38.0 38.0 38.0 36.0 38.0 90-94 36.942249999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.90585 38.0 38.0 38.0 36.0 38.0 100-104 36.77589999999999 38.0 38.0 38.0 35.4 38.0 105-109 36.64045 38.0 38.0 38.0 35.0 38.0 110-114 36.500800000000005 38.0 38.0 38.0 34.2 38.0 115-119 36.4062 38.0 38.0 38.0 34.2 38.0 120-124 36.17885 38.0 38.0 38.0 33.8 38.0 125-129 35.9873 38.0 37.6 38.0 33.4 38.0 130-134 35.7989 38.0 37.0 38.0 32.6 38.0 135-139 35.59755 38.0 36.4 38.0 31.6 38.0 140-144 35.3053 38.0 36.0 38.0 31.0 38.0 145-149 34.79025 38.0 36.0 38.0 29.2 38.0 150-151 31.72 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 5.0 16 3.0 17 2.0 18 2.0 19 4.0 20 4.0 21 6.0 22 5.0 23 7.0 24 5.0 25 5.0 26 9.0 27 19.0 28 19.0 29 17.0 30 23.0 31 44.0 32 47.0 33 66.0 34 82.0 35 173.0 36 482.0 37 2968.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.884538152610446 15.612449799196787 11.27008032128514 33.23293172690763 2 23.523523523523522 16.14114114114114 32.45745745745746 27.87787787787788 3 18.125 23.175 28.025 30.675 4 21.05 28.375 25.6 24.975 5 20.925 32.625 24.95 21.5 6 20.625 34.8 25.75 18.825 7 15.174999999999999 28.9 38.375 17.549999999999997 8 16.85 29.275000000000002 30.9 22.975 9 17.0 27.474999999999998 33.900000000000006 21.625 10-14 19.03 31.94 26.795 22.235 15-19 18.665000000000003 31.130000000000003 27.339999999999996 22.865 20-24 19.105 30.34 27.575 22.98 25-29 19.205 30.45 27.165 23.18 30-34 18.955 30.805 27.150000000000002 23.09 35-39 19.189999999999998 30.740000000000002 27.125 22.945 40-44 19.02 30.505 27.195000000000004 23.28 45-49 19.64 30.175 27.395000000000003 22.79 50-54 19.825 30.37 26.56 23.244999999999997 55-59 19.775000000000002 30.669999999999998 26.965 22.59 60-64 19.72 30.725 26.75 22.805 65-69 19.650000000000002 30.075000000000003 27.0 23.275000000000002 70-74 19.885 30.5 26.740000000000002 22.875 75-79 19.35 30.285 27.02 23.345 80-84 19.400000000000002 29.69 27.61 23.3 85-89 20.165 29.425 27.534999999999997 22.875 90-94 19.509999999999998 29.735 27.43 23.325000000000003 95-99 19.775000000000002 29.4 27.005000000000003 23.82 100-104 19.91 29.675 26.56 23.855 105-109 20.200000000000003 29.48 26.845000000000002 23.474999999999998 110-114 20.66 29.160000000000004 26.935 23.244999999999997 115-119 20.1 29.29 27.395000000000003 23.215 120-124 20.49 28.92 26.58 24.01 125-129 20.275000000000002 28.660000000000004 27.48 23.585 130-134 20.52 28.854999999999997 27.025 23.599999999999998 135-139 20.435 29.134999999999998 26.87 23.56 140-144 20.47 28.715000000000003 26.895000000000003 23.919999999999998 145-149 20.205000000000002 29.03 26.834999999999997 23.93 150-151 20.65 28.6125 27.237499999999997 23.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 1.5 21 2.0 22 1.5 23 2.5 24 5.5 25 8.5 26 12.0 27 19.0 28 26.0 29 35.5 30 39.5 31 50.5 32 68.5 33 89.0 34 108.5 35 114.0 36 121.5 37 134.0 38 155.0 39 177.0 40 185.0 41 188.0 42 204.0 43 230.5 44 230.5 45 220.0 46 224.0 47 218.5 48 197.5 49 173.5 50 148.5 51 121.5 52 103.0 53 88.0 54 75.5 55 57.0 56 35.5 57 27.5 58 25.5 59 20.0 60 13.5 61 10.5 62 7.5 63 5.5 64 3.0 65 0.5 66 0.5 67 2.5 68 3.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2125 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.0750000000000002 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.45 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.8375 0.0 0.0 0.0 0.0 134-135 2.15 0.0 0.0 0.0 0.0 136-137 2.475 0.0 0.0 0.0 0.0 138-139 2.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTATC 10 0.006830828 145.0 145 ACAACAC 10 0.006830828 145.0 145 >>END_MODULE SRR7168952 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168952_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16725 34.0 33.0 34.0 33.0 34.0 2 33.238 34.0 33.0 34.0 33.0 34.0 3 33.1805 34.0 33.0 34.0 33.0 34.0 4 33.234 34.0 33.0 34.0 33.0 34.0 5 33.205 34.0 33.0 34.0 33.0 34.0 6 37.4245 38.0 38.0 38.0 38.0 38.0 7 37.41525 38.0 38.0 38.0 38.0 38.0 8 37.41375 38.0 38.0 38.0 38.0 38.0 9 37.39975 38.0 38.0 38.0 38.0 38.0 10-14 37.3775 38.0 38.0 38.0 38.0 38.0 15-19 37.27909999999999 38.0 38.0 38.0 37.8 38.0 20-24 37.2875 38.0 38.0 38.0 38.0 38.0 25-29 37.2428 38.0 38.0 38.0 38.0 38.0 30-34 37.242599999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.199650000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.1224 38.0 38.0 38.0 37.8 38.0 45-49 37.0793 38.0 38.0 38.0 37.0 38.0 50-54 37.02505000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.0134 38.0 38.0 38.0 37.0 38.0 60-64 36.96565 38.0 38.0 38.0 36.8 38.0 65-69 36.9677 38.0 38.0 38.0 37.0 38.0 70-74 36.877449999999996 38.0 38.0 38.0 37.0 38.0 75-79 36.76965 38.0 38.0 38.0 36.0 38.0 80-84 36.69965 38.0 38.0 38.0 36.0 38.0 85-89 36.621249999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.56445000000001 38.0 38.0 38.0 35.8 38.0 95-99 36.30335 38.0 38.0 38.0 34.2 38.0 100-104 36.2572 38.0 38.0 38.0 34.2 38.0 105-109 36.161950000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.0043 38.0 38.0 38.0 33.6 38.0 115-119 35.880849999999995 38.0 38.0 38.0 33.4 38.0 120-124 35.319100000000006 38.0 36.8 38.0 30.0 38.0 125-129 35.19445 38.0 36.8 38.0 29.6 38.0 130-134 34.92165000000001 38.0 36.0 38.0 28.6 38.0 135-139 34.4962 38.0 35.8 38.0 26.2 38.0 140-144 34.004650000000005 38.0 34.4 38.0 23.2 38.0 145-149 33.15635 38.0 33.2 38.0 16.6 38.0 150-151 29.152124999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 5.0 4 2.0 5 1.0 6 2.0 7 4.0 8 1.0 9 2.0 10 3.0 11 3.0 12 2.0 13 3.0 14 2.0 15 2.0 16 5.0 17 6.0 18 3.0 19 4.0 20 3.0 21 9.0 22 5.0 23 10.0 24 14.0 25 20.0 26 17.0 27 22.0 28 18.0 29 34.0 30 35.0 31 46.0 32 47.0 33 65.0 34 109.0 35 195.0 36 519.0 37 2769.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.91945972986493 23.36168084042021 13.081540770385192 24.637318659329665 2 26.85 27.500000000000004 28.95 16.7 3 21.825 29.75 29.525000000000002 18.9 4 24.025 33.074999999999996 23.35 19.55 5 24.4 36.175000000000004 22.775000000000002 16.650000000000002 6 23.549999999999997 36.35 22.525000000000002 17.575 7 20.65 23.549999999999997 36.3 19.5 8 22.7 25.5 25.825 25.974999999999998 9 20.45 26.5 29.349999999999998 23.7 10-14 23.575 28.71 26.07 21.645 15-19 23.724999999999998 27.91 27.74 20.625 20-24 23.544999999999998 28.549999999999997 27.125 20.78 25-29 23.855 27.87 27.05 21.224999999999998 30-34 23.665 27.825 27.67 20.84 35-39 23.735 28.305000000000003 27.04 20.919999999999998 40-44 23.515 28.005000000000003 27.35 21.13 45-49 24.13 26.91 27.750000000000004 21.21 50-54 23.47 28.175 27.810000000000002 20.544999999999998 55-59 23.47 27.065 28.015 21.45 60-64 23.200000000000003 27.889999999999997 27.725 21.185000000000002 65-69 23.39 27.034999999999997 28.17 21.404999999999998 70-74 23.51 27.865000000000002 28.005000000000003 20.62 75-79 23.3 27.435 28.050000000000004 21.215 80-84 22.665 27.500000000000004 28.7 21.135 85-89 23.455000000000002 27.18 28.03 21.335 90-94 24.07 27.41 28.215 20.305 95-99 23.369999999999997 27.555000000000003 28.444999999999997 20.630000000000003 100-104 23.76 26.96 28.875 20.405 105-109 23.215 27.74 28.29 20.755000000000003 110-114 22.97 28.345 27.665 21.02 115-119 23.935000000000002 27.855 27.750000000000004 20.46 120-124 23.18 27.060000000000002 28.904999999999998 20.855 125-129 23.445 27.744999999999997 28.389999999999997 20.419999999999998 130-134 23.7 27.6 28.244999999999997 20.455000000000002 135-139 23.505000000000003 26.919999999999998 29.025000000000002 20.549999999999997 140-144 24.035 27.365000000000002 28.365000000000002 20.235 145-149 24.01 27.62 28.549999999999997 19.82 150-151 24.525 26.5125 27.775 21.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 2.0 20 1.5 21 1.0 22 1.0 23 0.0 24 1.0 25 2.5 26 4.0 27 6.0 28 5.5 29 5.5 30 15.0 31 17.0 32 17.0 33 35.5 34 43.5 35 63.0 36 77.0 37 96.5 38 133.0 39 158.5 40 181.5 41 212.0 42 258.5 43 268.0 44 267.5 45 281.5 46 283.0 47 265.0 48 232.0 49 208.0 50 176.0 51 148.0 52 127.5 53 96.5 54 74.5 55 59.0 56 41.5 57 27.0 58 19.5 59 17.0 60 14.5 61 11.5 62 9.5 63 6.0 64 4.0 65 2.5 66 1.5 67 1.0 68 2.0 69 1.5 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.5 90 1.5 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.5 98 1.5 99 1.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5284348263714143 1.05 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.6749999999999998 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.125 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138-139 2.5999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCACC 10 0.006830828 145.0 7 ACTGGGG 10 0.006830828 145.0 1 >>END_MODULE Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647727 spots for SRR7168952.sra Written 647727 spots for SRR7168952.sra Read 647743 spots for SRR7168952.sra Written 647743 spots for SRR7168952.sra SRR ids: ['SRR7168952.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i4lyy071 SRR7168952.sra spots: 12954556 blocks: [[1, 647727], [647728, 1295454], [1295455, 1943181], [1943182, 2590908], [2590909, 3238635], [3238636, 3886362], [3886363, 4534089], [4534090, 5181816], [5181817, 5829543], [5829544, 6477270], [6477271, 7124997], [7124998, 7772724], [7772725, 8420451], [8420452, 9068178], [9068179, 9715905], [9715906, 10363632], [10363633, 11011359], [11011360, 11659086], [11659087, 12306813], [12306814, 12954556]] SRR7168952 file size 4368173 SRR7168952 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168952 SRR7168952_1.fastq SRR7168952_2.fastq Input file: SRR7168952_1.fastq Paired file: SRR7168952_2.fastq trimmed: SRR7168952-trimmed-pair1.fastq, SRR7168952-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:57:48 2025 >> started Mon Feb 10 11:58:03 2025 >> done (14.636s) 12954556 read pairs processed; of these: 17934 ( 0.14%) short read pairs filtered out after trimming by size control 12864 ( 0.10%) empty read pairs filtered out after trimming by size control 12923758 (99.76%) read pairs available; of these: 5052405 (39.09%) trimmed read pairs available after processing 7871353 (60.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 12 0.00% 20 12 0.00% 21 14 0.00% 22 8 0.00% 23 16 0.00% 24 7 0.00% 25 20 0.00% 26 12 0.00% 27 15 0.00% 28 10 0.00% 29 13 0.00% 30 17 0.00% 31 17 0.00% 32 11 0.00% 33 16 0.00% 34 18 0.00% 35 14 0.00% 36 13 0.00% 37 16 0.00% 38 14 0.00% 39 16 0.00% 40 11 0.00% 41 13 0.00% 42 12 0.00% 43 19 0.00% 44 18 0.00% 45 11 0.00% 46 14 0.00% 47 24 0.00% 48 20 0.00% 49 24 0.00% 50 23 0.00% 51 29 0.00% 52 28 0.00% 53 33 0.00% 54 38 0.00% 55 37 0.00% 56 46 0.00% 57 39 0.00% 58 47 0.00% 59 46 0.00% 60 72 0.00% 61 50 0.00% 62 87 0.00% 63 86 0.00% 64 92 0.00% 65 107 0.00% 66 90 0.00% 67 122 0.00% 68 144 0.00% 69 207 0.00% 70 266 0.00% 71 227 0.00% 72 209 0.00% 73 230 0.00% 74 244 0.00% 75 277 0.00% 76 338 0.00% 77 337 0.00% 78 346 0.00% 79 421 0.00% 80 436 0.00% 81 524 0.00% 82 625 0.00% 83 759 0.01% 84 1542 0.01% 85 2160 0.02% 86 2289 0.02% 87 2426 0.02% 88 2671 0.02% 89 2685 0.02% 90 2748 0.02% 91 2974 0.02% 92 2985 0.02% 93 3165 0.02% 94 3355 0.03% 95 3525 0.03% 96 3722 0.03% 97 3901 0.03% 98 4062 0.03% 99 4243 0.03% 100 4543 0.04% 101 5057 0.04% 102 5418 0.04% 103 5706 0.04% 104 6200 0.05% 105 6631 0.05% 106 6970 0.05% 107 7483 0.06% 108 7601 0.06% 109 7952 0.06% 110 8672 0.07% 111 8924 0.07% 112 9620 0.07% 113 10552 0.08% 114 11284 0.09% 115 11746 0.09% 116 12421 0.10% 117 12969 0.10% 118 13405 0.10% 119 14118 0.11% 120 14413 0.11% 121 15382 0.12% 122 16425 0.13% 123 17445 0.13% 124 18747 0.15% 125 19993 0.15% 126 20994 0.16% 127 21943 0.17% 128 22659 0.18% 129 24077 0.19% 130 25576 0.20% 131 27100 0.21% 132 29035 0.22% 133 31373 0.24% 134 34011 0.26% 135 37071 0.29% 136 40405 0.31% 137 43483 0.34% 138 46394 0.36% 139 49399 0.38% 140 53931 0.42% 141 58041 0.45% 142 64126 0.50% 143 72448 0.56% 144 83326 0.64% 145 99734 0.77% 146 122734 0.95% 147 164402 1.27% 148 251404 1.95% 149 494604 3.83% 150 2798881 21.66% 151 7871353 60.91% 12923758 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=56.60 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.8 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.12 fanout-score-rank=20 prefix-density=0.38 prefix-fanout=3.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=208.56 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=23.9 sequence=GAAGAAGAAGAAA SRR7168952 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:58:47 Started mapping on | Feb 10 11:58:47 Finished on | Feb 10 12:00:26 Mapping speed, Million of reads per hour | 469.95 Number of input reads | 12923758 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12191665 Uniquely mapped reads % | 94.34% Average mapped length | 296.68 Number of splices: Total | 9761364 Number of splices: Annotated (sjdb) | 9590130 Number of splices: GT/AG | 9614588 Number of splices: GC/AG | 111351 Number of splices: AT/AC | 8484 Number of splices: Non-canonical | 26941 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.03% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236848 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 20410 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 512851 512851 512851 N_multimapping 236848 236848 236848 N_noFeature 281836 12013112 355909 N_ambiguous 155129 923 50057 UnstrandedReadsAssigned:11754700 PositiveStrandReadsAssigned:177630 NegativeStrandReadsAssigned:11785699 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168952 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168952-trimmed-pair1.fastq SRR7168952-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,923,758 reads, 11,747,755 reads pseudoaligned [quant] estimated average fragment length: 251.636 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR7168952.ke.tsv 34699 SRR7168952.se.tsv 87100 total ==> SRR7168952.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.36 195 7.71107 Potri.005G024800.1.v4.1 1035 784.364 57 5.07882 Potri.004G059700.1.v4.1 961 710.379 4 0.393528 Potri.007G009000.2.v4.1 1416 1165.36 0 0 Potri.003G141000.2.v4.1 2943 2692.36 172 4.46479 Potri.016G087400.1.v4.1 270 67.4681 1601 1658.44 Potri.015G069301.1.v4.1 564 316.449 0 0 Potri.010G195200.1.v4.1 1773 1522.36 20 0.918158 Potri.012G127500.1.v4.1 977 726.374 3870 372.354 ==> SRR7168952.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1718 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168952 completed mapping pipeline successfully