Starting /dee2/code/volunteer_pipeline.sh SRR7168953 current disk space = 3058681393152 free memory = 1435312404 SRR7168953 SRAfilesize 5e46e5f0b480482d3fccf4a507d93ff3 SRR7168953.sra SRR7168953.sra file validated SRR7168953 is paired end SRR7168953 is conventional basespace SRR7168953 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168953_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.778 34.0 33.0 34.0 32.0 34.0 2 32.944 34.0 33.0 34.0 32.0 34.0 3 32.95825 34.0 33.0 34.0 32.0 34.0 4 32.818 34.0 33.0 34.0 32.0 34.0 5 32.66675 34.0 33.0 34.0 32.0 34.0 6 36.43525 38.0 37.0 38.0 34.0 38.0 7 36.96575 38.0 38.0 38.0 35.0 38.0 8 37.10775 38.0 38.0 38.0 36.0 38.0 9 37.1895 38.0 38.0 38.0 36.0 38.0 10-14 37.224599999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.114 38.0 38.0 38.0 36.0 38.0 20-24 37.059900000000006 38.0 38.0 38.0 36.0 38.0 25-29 36.8976 38.0 38.0 38.0 35.4 38.0 30-34 36.798500000000004 38.0 38.0 38.0 34.8 38.0 35-39 36.77225 38.0 38.0 38.0 34.8 38.0 40-44 36.328599999999994 38.0 37.8 38.0 33.4 38.0 45-49 36.550149999999995 38.0 38.0 38.0 34.0 38.0 50-54 36.523849999999996 38.0 37.8 38.0 34.2 38.0 55-59 36.202200000000005 38.0 37.2 38.0 33.0 38.0 60-64 36.338499999999996 38.0 37.2 38.0 33.4 38.0 65-69 36.259350000000005 38.0 37.0 38.0 33.0 38.0 70-74 36.318349999999995 38.0 37.2 38.0 33.6 38.0 75-79 36.0107 38.0 37.0 38.0 32.2 38.0 80-84 35.850350000000006 38.0 36.8 38.0 31.2 38.0 85-89 35.38869999999999 38.0 36.2 38.0 29.0 38.0 90-94 35.23180000000001 38.0 36.0 38.0 29.0 38.0 95-99 35.45375 38.0 36.0 38.0 29.0 38.0 100-104 34.898250000000004 38.0 35.4 38.0 26.8 38.0 105-109 35.1786 38.0 36.0 38.0 28.4 38.0 110-114 34.7624 38.0 35.0 38.0 26.2 38.0 115-119 34.373149999999995 38.0 34.4 38.0 24.2 38.0 120-124 34.2521 38.0 34.4 38.0 23.8 38.0 125-129 33.14915 37.4 33.0 38.0 16.6 38.0 130-134 33.2296 37.4 33.6 38.0 19.0 38.0 135-139 32.681349999999995 37.0 31.6 38.0 18.4 38.0 140-144 32.645149999999994 37.8 32.2 38.0 15.4 38.0 145-149 30.896300000000004 36.0 31.0 38.0 8.6 38.0 150-151 26.07 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 2.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 0.0 17 1.0 18 4.0 19 9.0 20 8.0 21 7.0 22 10.0 23 10.0 24 20.0 25 24.0 26 43.0 27 47.0 28 66.0 29 76.0 30 84.0 31 101.0 32 149.0 33 211.0 34 253.0 35 476.0 36 904.0 37 1486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45 11.425 10.100000000000001 40.025 2 22.425 15.15 35.675000000000004 26.75 3 19.925 20.150000000000002 25.5 34.425 4 23.95 27.700000000000003 22.1 26.25 5 22.13548224628557 33.140266935280785 24.175270712666837 20.54898010576681 6 18.375 36.025 24.349999999999998 21.25 7 14.2 28.349999999999998 39.324999999999996 18.125 8 17.849999999999998 24.525 31.7 25.924999999999997 9 17.349999999999998 23.1 34.0 25.55 10-14 19.715 30.2 26.99 23.095 15-19 20.19 28.799999999999997 27.175 23.835 20-24 19.925 28.82 27.644999999999996 23.61 25-29 19.939999999999998 28.735 27.310000000000002 24.015 30-34 19.875 28.62 27.655 23.849999999999998 35-39 20.32 28.24 27.37 24.07 40-44 20.275000000000002 28.895 27.089999999999996 23.74 45-49 20.32 28.33 27.54 23.810000000000002 50-54 20.06 28.994999999999997 27.400000000000002 23.544999999999998 55-59 20.04701645575952 28.815085279847946 27.3445705997099 23.79332766468264 60-64 20.02 28.560000000000002 27.200000000000003 24.22 65-69 19.975 28.665000000000003 27.07 24.29 70-74 19.66 28.955 27.82 23.565 75-79 20.805402701350676 28.18409204602301 27.48874437218609 23.52176088044022 80-84 20.054024310939923 28.827972587664448 27.092191486168776 24.025811615226853 85-89 20.11517275913871 29.298948422633952 26.855282924386582 23.73059589384076 90-94 20.46232876712329 29.059226430298146 26.47562449637389 24.002820306204672 95-99 20.53 28.000000000000004 27.485 23.985 100-104 20.165 28.575 27.565 23.695 105-109 20.518477661334806 28.140199568770996 26.99192699192699 24.349395777967207 110-114 20.7 28.49 27.29 23.52 115-119 20.794999999999998 27.63 27.900000000000002 23.674999999999997 120-124 20.775 27.82 27.76 23.645 125-129 20.71 28.025 27.465 23.799999999999997 130-134 20.396118835650697 28.383515054516355 27.403220966289886 23.817145143543065 135-139 20.419999999999998 28.155 27.395000000000003 24.03 140-144 20.580000000000002 28.044999999999998 27.439999999999998 23.935000000000002 145-149 20.88770215124188 27.351503854098443 27.386770114363447 24.374023880296235 150-151 20.51282051282051 28.818011257035646 25.97873671044403 24.690431519699814 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 2.5 27 3.0 28 5.0 29 10.5 30 15.5 31 22.0 32 28.0 33 41.0 34 60.0 35 76.5 36 91.0 37 103.5 38 123.0 39 148.5 40 184.0 41 203.0 42 215.5 43 255.0 44 276.5 45 286.0 46 287.0 47 275.5 48 247.0 49 213.5 50 175.0 51 142.0 52 128.5 53 103.0 54 76.5 55 51.0 56 36.0 57 29.5 58 25.0 59 16.0 60 10.0 61 8.0 62 6.5 63 5.5 64 3.5 65 2.0 66 0.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.7250000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.034999999999999996 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.05 80-84 0.045 85-89 0.15 90-94 0.72 95-99 0.0 100-104 0.0 105-109 0.28500000000000003 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.03 135-139 0.0 140-144 0.0 145-149 0.755 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9125000000000001 0.0 0.0 0.0 0.0 134-135 0.9874999999999999 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138-139 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATTCT 10 0.006624921 146.46835 3 >>END_MODULE SRR7168953 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168953_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.28125 33.0 33.0 34.0 32.0 34.0 2 32.4675 33.0 33.0 34.0 32.0 34.0 3 32.47675 34.0 33.0 34.0 32.0 34.0 4 32.19575 34.0 33.0 34.0 31.0 34.0 5 32.32875 34.0 33.0 34.0 31.0 34.0 6 36.22075 38.0 38.0 38.0 33.0 38.0 7 36.3825 38.0 38.0 38.0 34.0 38.0 8 36.05625 38.0 38.0 38.0 33.0 38.0 9 36.146 38.0 38.0 38.0 33.0 38.0 10-14 36.23535 38.0 38.0 38.0 33.6 38.0 15-19 36.11635 38.0 38.0 38.0 33.4 38.0 20-24 36.42274999999999 38.0 38.0 38.0 34.6 38.0 25-29 36.4089 38.0 38.0 38.0 34.4 38.0 30-34 36.2515 38.0 38.0 38.0 33.8 38.0 35-39 36.2924 38.0 38.0 38.0 34.2 38.0 40-44 36.35385 38.0 38.0 38.0 34.2 38.0 45-49 36.304950000000005 38.0 38.0 38.0 34.2 38.0 50-54 36.0475 38.0 38.0 38.0 33.4 38.0 55-59 35.4534 38.0 37.8 38.0 29.6 38.0 60-64 35.4948 38.0 38.0 38.0 29.6 38.0 65-69 35.53595 38.0 38.0 38.0 30.2 38.0 70-74 35.8464 38.0 38.0 38.0 32.6 38.0 75-79 35.612199999999994 38.0 37.4 38.0 30.0 38.0 80-84 35.66385 38.0 38.0 38.0 31.6 38.0 85-89 35.66755 38.0 37.4 38.0 31.0 38.0 90-94 35.7371 38.0 37.8 38.0 32.0 38.0 95-99 35.48355 38.0 37.4 38.0 30.2 38.0 100-104 35.30275 38.0 37.0 38.0 29.4 38.0 105-109 34.83839999999999 38.0 36.8 38.0 26.8 38.0 110-114 34.63365 38.0 36.2 38.0 25.4 38.0 115-119 34.5522 38.0 36.0 38.0 25.0 38.0 120-124 34.553399999999996 38.0 35.8 38.0 25.0 38.0 125-129 34.295399999999994 38.0 35.0 38.0 23.4 38.0 130-134 34.15795 38.0 35.0 38.0 23.2 38.0 135-139 33.74995 38.0 34.8 38.0 21.8 38.0 140-144 32.97125 38.0 33.6 38.0 14.4 38.0 145-149 31.556649999999998 38.0 32.2 38.0 8.6 38.0 150-151 27.833624999999998 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 2.0 4 0.0 5 4.0 6 3.0 7 2.0 8 3.0 9 4.0 10 2.0 11 2.0 12 4.0 13 9.0 14 4.0 15 5.0 16 2.0 17 11.0 18 11.0 19 12.0 20 14.0 21 14.0 22 19.0 23 15.0 24 26.0 25 34.0 26 36.0 27 38.0 28 45.0 29 51.0 30 54.0 31 92.0 32 100.0 33 120.0 34 200.0 35 277.0 36 512.0 37 2243.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.03281171125694 19.409389197375063 15.118626956082787 30.439172135285208 2 27.446061214249873 25.163070747616658 31.033617661816358 16.357250376317108 3 19.989891331817034 29.97220116249684 28.78443265099823 21.253474854687894 4 23.95939086294416 34.213197969543145 22.106598984771576 19.720812182741117 5 25.118958176809414 35.53719008264463 23.441021788129227 15.902829952416731 6 19.664748561421067 38.779084313234925 23.767825869402053 17.788341255941955 7 19.99496981891348 21.051307847082494 39.285714285714285 19.66800804828974 8 21.506467156987068 24.067968551864062 28.709104742581793 25.716459548567084 9 21.65701334676404 24.099722991689752 30.52127927474188 23.721984386804333 10-14 22.846045197740114 29.040556900726394 26.54358353510896 21.569814366424538 15-19 22.74543523342269 27.975317384047344 28.036012341307977 21.243235041221993 20-24 22.386706948640484 28.86203423967774 27.43705941591138 21.31419939577039 25-29 22.866021753295573 28.39957896847276 27.527442233472005 21.206957044759662 30-34 22.74943453128927 28.655441065594374 27.358632822317162 21.236491580799196 35-39 22.967326184362886 28.364295423652013 27.322156773901224 21.346221618083874 40-44 23.20092401948476 27.866218048511023 28.112288454778284 20.820569477225934 45-49 22.432391751542823 27.213887913300887 29.235863729868043 21.117856605288242 50-54 23.214285714285715 28.526156941649898 27.50503018108652 20.75452716297787 55-59 23.643312101910826 27.23057324840764 28.264968152866242 20.861146496815287 60-64 23.799806132340187 27.768991377990922 27.687362889648487 20.743839600020408 65-69 22.919007251557552 27.995097538555818 28.40363599223777 20.68225921764886 70-74 23.22284445789819 28.247817970839005 27.556631855103177 20.972705716159627 75-79 23.21807703973309 27.833383884339298 28.384389849358005 20.564149226569608 80-84 23.862369514543428 27.683186378838553 27.708523360697274 20.745920745920746 85-89 24.08890668802563 27.32779335202243 28.203844613536244 20.379455346415696 90-94 23.496720572773246 27.782506383617882 27.817553697491615 20.903219346117258 95-99 23.033651431441488 27.679558011049725 28.437970868910096 20.848819688598695 100-104 23.972602739726025 28.228243352135372 27.503021756647865 20.296132151490735 105-109 23.703403565640194 27.046191247974065 28.484602917341977 20.76580226904376 110-114 24.67996123833325 27.250471770286122 27.627887999183965 20.441678992196664 115-119 24.108503505028956 27.36970435842731 27.989434115615158 20.53235802092858 120-124 23.89921354505836 27.47082101888494 28.532785653458898 20.097179782597806 125-129 23.723799017149734 27.99618894794905 27.88586902015846 20.394143014742756 130-134 24.011837881219904 27.658507223113965 28.315609951845904 20.014044943820224 135-139 23.736968724939857 27.29550922213312 27.826784282277465 21.140737770649558 140-144 24.086345381526105 27.53012048192771 27.399598393574298 20.983935742971887 145-149 24.14452495974235 27.943840579710145 27.6670692431562 20.244565217391305 150-151 24.51693851944793 27.741530740276033 27.264742785445424 20.476787954830613 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 2.5 17 6.5 18 5.5 19 4.0 20 5.0 21 6.0 22 4.5 23 2.5 24 3.0 25 4.0 26 5.5 27 9.0 28 7.5 29 4.0 30 11.5 31 17.5 32 21.0 33 40.0 34 50.5 35 53.5 36 76.0 37 107.0 38 141.0 39 167.5 40 191.0 41 236.5 42 264.5 43 284.0 44 284.0 45 271.5 46 268.0 47 257.5 48 236.5 49 200.5 50 171.5 51 140.0 52 114.5 53 90.0 54 67.5 55 45.5 56 26.5 57 25.5 58 22.0 59 11.5 60 5.5 61 3.5 62 6.0 63 4.5 64 1.5 65 1.0 66 1.0 67 2.5 68 3.5 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.35000000000000003 3 1.075 4 1.5 5 0.17500000000000002 6 0.075 7 0.6 8 1.425 9 0.7250000000000001 10-14 0.88 15-19 1.145 20-24 0.7000000000000001 25-29 0.245 30-34 0.525 35-39 0.685 40-44 0.43499999999999994 45-49 0.345 50-54 0.6 55-59 1.875 60-64 1.9949999999999999 65-69 2.09 70-74 0.895 75-79 1.09 80-84 1.3299999999999998 85-89 0.12 90-94 0.135 95-99 0.44999999999999996 100-104 0.72 105-109 1.28 110-114 1.965 115-119 1.5699999999999998 120-124 0.185 125-129 0.29 130-134 0.32 135-139 0.24 140-144 0.4 145-149 0.64 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.36250000000000004 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.6125 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138-139 1.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896205 spots for SRR7168953.sra Written 896205 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra Read 896190 spots for SRR7168953.sra Written 896190 spots for SRR7168953.sra SRR ids: ['SRR7168953.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4_r99prc SRR7168953.sra spots: 17923815 blocks: [[1, 896190], [896191, 1792380], [1792381, 2688570], [2688571, 3584760], [3584761, 4480950], [4480951, 5377140], [5377141, 6273330], [6273331, 7169520], [7169521, 8065710], [8065711, 8961900], [8961901, 9858090], [9858091, 10754280], [10754281, 11650470], [11650471, 12546660], [12546661, 13442850], [13442851, 14339040], [14339041, 15235230], [15235231, 16131420], [16131421, 17027610], [17027611, 17923815]] SRR7168953 file size 6052092 SRR7168953 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168953 SRR7168953_1.fastq SRR7168953_2.fastq Input file: SRR7168953_1.fastq Paired file: SRR7168953_2.fastq trimmed: SRR7168953-trimmed-pair1.fastq, SRR7168953-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:35:05 2025 >> started Mon Feb 10 12:35:29 2025 >> done (23.745s) 17923815 read pairs processed; of these: 18105 ( 0.10%) short read pairs filtered out after trimming by size control 29826 ( 0.17%) empty read pairs filtered out after trimming by size control 17875884 (99.73%) read pairs available; of these: 8130618 (45.48%) trimmed read pairs available after processing 9745266 (54.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 5 0.00% 21 4 0.00% 22 6 0.00% 23 3 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 9 0.00% 28 4 0.00% 29 3 0.00% 30 6 0.00% 31 8 0.00% 32 11 0.00% 33 3 0.00% 34 8 0.00% 35 4 0.00% 36 7 0.00% 37 6 0.00% 38 6 0.00% 39 5 0.00% 40 7 0.00% 41 8 0.00% 42 11 0.00% 43 14 0.00% 44 11 0.00% 45 15 0.00% 46 19 0.00% 47 14 0.00% 48 17 0.00% 49 18 0.00% 50 35 0.00% 51 26 0.00% 52 34 0.00% 53 39 0.00% 54 35 0.00% 55 28 0.00% 56 53 0.00% 57 46 0.00% 58 62 0.00% 59 66 0.00% 60 56 0.00% 61 82 0.00% 62 95 0.00% 63 88 0.00% 64 127 0.00% 65 113 0.00% 66 148 0.00% 67 117 0.00% 68 185 0.00% 69 202 0.00% 70 253 0.00% 71 260 0.00% 72 274 0.00% 73 278 0.00% 74 344 0.00% 75 420 0.00% 76 466 0.00% 77 496 0.00% 78 593 0.00% 79 648 0.00% 80 764 0.00% 81 845 0.00% 82 1001 0.01% 83 1187 0.01% 84 1995 0.01% 85 2144 0.01% 86 2256 0.01% 87 2492 0.01% 88 2756 0.02% 89 2838 0.02% 90 2885 0.02% 91 2965 0.02% 92 3293 0.02% 93 3523 0.02% 94 3579 0.02% 95 3839 0.02% 96 4234 0.02% 97 4390 0.02% 98 4848 0.03% 99 4980 0.03% 100 5175 0.03% 101 5719 0.03% 102 5849 0.03% 103 6060 0.03% 104 6444 0.04% 105 7150 0.04% 106 7907 0.04% 107 8033 0.04% 108 8546 0.05% 109 9332 0.05% 110 10011 0.06% 111 9954 0.06% 112 10782 0.06% 113 11415 0.06% 114 11918 0.07% 115 12803 0.07% 116 13589 0.08% 117 14646 0.08% 118 14981 0.08% 119 15756 0.09% 120 16685 0.09% 121 17884 0.10% 122 18872 0.11% 123 19977 0.11% 124 21323 0.12% 125 22905 0.13% 126 24321 0.14% 127 26048 0.15% 128 28018 0.16% 129 30014 0.17% 130 32581 0.18% 131 35177 0.20% 132 37863 0.21% 133 41397 0.23% 134 44776 0.25% 135 48794 0.27% 136 53698 0.30% 137 57913 0.32% 138 64032 0.36% 139 72884 0.41% 140 80919 0.45% 141 91054 0.51% 142 104554 0.58% 143 123232 0.69% 144 148029 0.83% 145 183551 1.03% 146 237522 1.33% 147 329082 1.84% 148 502307 2.81% 149 961762 5.38% 150 4394642 24.58% 151 9745266 54.52% 17875884 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=42 prefix-density=0.17 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=253.56 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=35 prefix-density=0.33 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=12 fanout-score=52.32 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=13.7 sequence=TGTTGGTGGTGG SRR7168953 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:36:26 Started mapping on | Feb 10 12:36:27 Finished on | Feb 10 12:38:12 Mapping speed, Million of reads per hour | 612.89 Number of input reads | 17875884 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16961129 Uniquely mapped reads % | 94.88% Average mapped length | 296.84 Number of splices: Total | 16351722 Number of splices: Annotated (sjdb) | 16098591 Number of splices: GT/AG | 16120887 Number of splices: GC/AG | 187153 Number of splices: AT/AC | 12300 Number of splices: Non-canonical | 31382 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322167 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 159860 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 611116 611116 611116 N_multimapping 322167 322167 322167 N_noFeature 407797 16775346 491949 N_ambiguous 178589 911 76346 UnstrandedReadsAssigned:16374743 PositiveStrandReadsAssigned:184872 NegativeStrandReadsAssigned:16392834 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168953 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168953-trimmed-pair1.fastq SRR7168953-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,875,884 reads, 16,367,766 reads pseudoaligned [quant] estimated average fragment length: 279.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7168953.ke.tsv 34699 SRR7168953.se.tsv 87100 total ==> SRR7168953.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.42 278 8.93702 Potri.005G024800.1.v4.1 1035 756.421 30 2.21774 Potri.004G059700.1.v4.1 961 682.488 4 0.327731 Potri.007G009000.2.v4.1 1416 1137.42 0 0 Potri.003G141000.2.v4.1 2943 2664.42 253.101 5.31182 Potri.016G087400.1.v4.1 270 60.4433 1564.02 1446.93 Potri.015G069301.1.v4.1 564 292.735 0 0 Potri.010G195200.1.v4.1 1773 1494.42 50 1.8709 Potri.012G127500.1.v4.1 977 698.448 5944 475.88 ==> SRR7168953.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1458 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168953 completed mapping pipeline successfully