Starting /dee2/code/volunteer_pipeline.sh SRR7168954 current disk space = 3058910130176 free memory = 1206891672 SRR7168954 SRAfilesize 130cb151a7180e91464fef72751b53b3 SRR7168954.sra SRR7168954.sra file validated SRR7168954 is paired end SRR7168954 is conventional basespace SRR7168954 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168954_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62125 34.0 33.0 34.0 32.0 34.0 2 33.1035 34.0 33.0 34.0 32.0 34.0 3 33.1075 34.0 33.0 34.0 32.0 34.0 4 33.068 34.0 33.0 34.0 32.0 34.0 5 33.14225 34.0 33.0 34.0 32.0 34.0 6 36.876 38.0 37.0 38.0 35.0 38.0 7 37.168 38.0 38.0 38.0 36.0 38.0 8 37.29175 38.0 38.0 38.0 37.0 38.0 9 37.41325 38.0 38.0 38.0 37.0 38.0 10-14 37.379749999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.24655 38.0 38.0 38.0 36.6 38.0 20-24 37.117749999999994 38.0 38.0 38.0 36.0 38.0 25-29 37.0311 38.0 38.0 38.0 36.0 38.0 30-34 36.9313 38.0 38.0 38.0 35.6 38.0 35-39 36.86560000000001 38.0 38.0 38.0 35.2 38.0 40-44 36.700599999999994 38.0 38.0 38.0 34.4 38.0 45-49 36.7469 38.0 38.0 38.0 34.6 38.0 50-54 36.69495 38.0 38.0 38.0 34.6 38.0 55-59 36.41585 38.0 38.0 38.0 34.0 38.0 60-64 36.497949999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.4055 38.0 38.0 38.0 34.0 38.0 70-74 36.404250000000005 38.0 37.6 38.0 33.8 38.0 75-79 36.329750000000004 38.0 37.0 38.0 33.6 38.0 80-84 35.619299999999996 38.0 36.8 38.0 30.6 38.0 85-89 35.5527 38.0 36.6 38.0 29.0 38.0 90-94 35.3398 38.0 36.0 38.0 29.4 38.0 95-99 35.29975 38.0 36.2 38.0 28.8 38.0 100-104 35.0553 38.0 36.0 38.0 28.2 38.0 105-109 35.1678 38.0 36.0 38.0 28.8 38.0 110-114 34.6842 38.0 35.2 38.0 25.8 38.0 115-119 34.326550000000005 38.0 34.4 38.0 24.0 38.0 120-124 33.91495 37.8 33.6 38.0 22.4 38.0 125-129 33.0994 37.2 33.0 38.0 17.4 38.0 130-134 32.55365 37.2 31.8 38.0 16.0 38.0 135-139 33.15365 38.0 33.8 38.0 17.4 38.0 140-144 32.74225 38.0 33.0 38.0 14.4 38.0 145-149 31.600450000000002 36.8 31.8 38.0 11.2 38.0 150-151 26.994625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 3.0 13 1.0 14 1.0 15 2.0 16 2.0 17 2.0 18 6.0 19 12.0 20 8.0 21 7.0 22 16.0 23 9.0 24 11.0 25 21.0 26 38.0 27 57.0 28 35.0 29 66.0 30 100.0 31 101.0 32 125.0 33 186.0 34 250.0 35 424.0 36 960.0 37 1554.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.73868835790544 12.709710218607015 8.896797153024911 36.654804270462634 2 22.575 15.8 34.325 27.3 3 19.625 20.525 26.1 33.75 4 22.775000000000002 28.925 23.025000000000002 25.275 5 21.92192192192192 33.78378378378378 23.84884884884885 20.445445445445447 6 19.225 35.525 25.025 20.225 7 14.549999999999999 27.875 39.375 18.2 8 16.975 26.85 32.025 24.15 9 17.075000000000003 24.875 32.95 25.1 10-14 19.7 31.11 25.905 23.285 15-19 19.6 29.38 27.275 23.745 20-24 19.470000000000002 29.220000000000002 27.775 23.535 25-29 19.220000000000002 29.215000000000003 27.465 24.099999999999998 30-34 19.950000000000003 29.25 27.21 23.59 35-39 19.97299594939241 29.099364904735708 27.16407461119168 23.7635645346802 40-44 20.59 29.555 27.12 22.735 45-49 19.851985198519852 29.3979397939794 27.53775377537754 23.212321232123212 50-54 19.675 29.835 26.889999999999997 23.599999999999998 55-59 20.495 29.335 26.565 23.605 60-64 20.195 28.785 27.400000000000002 23.62 65-69 20.165 28.754999999999995 27.62 23.46 70-74 20.507050705070505 28.697869786978696 27.41774177417742 23.377337733773377 75-79 19.61 28.225 27.715 24.45 80-84 20.19578313253012 28.619477911646584 27.796184738955827 23.38855421686747 85-89 20.203794799718906 28.701937556470234 27.256299568316432 23.837968075494427 90-94 20.742226680040122 28.19458375125376 27.4172517552658 23.64593781344032 95-99 20.493740258434308 28.573583387802305 27.422193172105185 23.510483181658202 100-104 20.36721179893649 29.412059797331192 27.325173071134746 22.895555332597574 105-109 20.707831325301203 28.433734939759038 27.535140562248994 23.32329317269076 110-114 20.52349195206338 28.410971268114128 27.443213157498867 23.62232362232362 115-119 20.17860726469998 28.526991772024886 27.378085490668276 23.916315472606865 120-124 20.402040204020402 28.657865786578657 27.07270727072707 23.86738673867387 125-129 20.705905946054344 28.772686252882785 27.173368093853405 23.348039707209463 130-134 20.85183689947517 28.78986677432378 27.058942268873636 23.299354057327413 135-139 20.26918036092348 28.70249017038008 27.457404980340762 23.570924488355683 140-144 20.27670559927816 28.427490099754372 27.47004862399118 23.82575567697629 145-149 21.037260825780464 28.685800604229605 26.978851963746227 23.298086606243707 150-151 21.304893350062734 28.117942283563362 26.612296110414054 23.96486825595985 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 1.5 23 0.0 24 0.5 25 2.0 26 4.0 27 8.0 28 12.0 29 16.0 30 22.0 31 28.0 32 39.5 33 48.0 34 56.5 35 71.5 36 82.5 37 102.5 38 124.5 39 161.5 40 202.0 41 225.0 42 240.5 43 251.0 44 279.5 45 281.0 46 263.5 47 253.5 48 232.0 49 212.5 50 177.5 51 135.5 52 111.0 53 97.5 54 70.5 55 43.0 56 33.5 57 29.0 58 25.0 59 19.0 60 10.0 61 7.5 62 5.5 63 1.0 64 1.5 65 2.5 66 2.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.4 85-89 0.38999999999999996 90-94 0.3 95-99 0.555 100-104 0.33 105-109 0.4 110-114 0.28500000000000003 115-119 0.33999999999999997 120-124 0.01 125-129 0.27 130-134 0.9199999999999999 135-139 0.8099999999999999 140-144 0.255 145-149 0.7000000000000001 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0750000000000002 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168954 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168954_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87025 33.0 33.0 34.0 32.0 34.0 2 32.95125 34.0 33.0 34.0 32.0 34.0 3 32.95325 34.0 33.0 34.0 32.0 34.0 4 32.8745 34.0 33.0 34.0 32.0 34.0 5 32.86225 34.0 33.0 34.0 32.0 34.0 6 36.93875 38.0 38.0 38.0 36.0 38.0 7 36.8435 38.0 38.0 38.0 36.0 38.0 8 36.442 38.0 38.0 38.0 35.0 38.0 9 36.66275 38.0 38.0 38.0 35.0 38.0 10-14 35.98455 38.0 38.0 38.0 32.6 38.0 15-19 35.727850000000004 38.0 38.0 38.0 33.2 38.0 20-24 36.1453 38.0 38.0 38.0 34.2 38.0 25-29 36.400549999999996 38.0 38.0 38.0 34.8 38.0 30-34 36.39 38.0 38.0 38.0 35.2 38.0 35-39 36.45935 38.0 38.0 38.0 35.2 38.0 40-44 36.4339 38.0 38.0 38.0 35.2 38.0 45-49 36.4149 38.0 38.0 38.0 35.4 38.0 50-54 35.79755 38.0 38.0 38.0 32.8 38.0 55-59 34.85735 38.0 38.0 38.0 27.4 38.0 60-64 35.035199999999996 38.0 38.0 38.0 28.4 38.0 65-69 35.420500000000004 38.0 38.0 38.0 30.6 38.0 70-74 35.111599999999996 38.0 37.6 38.0 28.4 38.0 75-79 35.078199999999995 38.0 37.8 38.0 28.2 38.0 80-84 35.294399999999996 38.0 38.0 38.0 30.2 38.0 85-89 35.28275 38.0 38.0 38.0 29.8 38.0 90-94 35.076550000000005 38.0 37.6 38.0 29.4 38.0 95-99 35.046350000000004 38.0 37.2 38.0 28.8 38.0 100-104 34.555 38.0 37.0 38.0 25.8 38.0 105-109 34.49365 38.0 37.0 38.0 24.8 38.0 110-114 34.241150000000005 38.0 36.2 38.0 22.0 38.0 115-119 34.33355 38.0 36.2 38.0 24.8 38.0 120-124 34.2996 38.0 36.0 38.0 24.0 38.0 125-129 33.99455 38.0 35.6 38.0 21.0 38.0 130-134 33.6711 38.0 35.0 38.0 20.0 38.0 135-139 32.886300000000006 38.0 34.2 38.0 15.4 38.0 140-144 32.7245 38.0 34.0 38.0 14.0 38.0 145-149 31.881800000000005 38.0 33.4 38.0 8.6 38.0 150-151 28.488500000000002 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 26.0 4 6.0 5 1.0 6 2.0 7 7.0 8 18.0 9 5.0 10 15.0 11 30.0 12 15.0 13 2.0 14 1.0 15 5.0 16 6.0 17 12.0 18 8.0 19 8.0 20 10.0 21 9.0 22 20.0 23 12.0 24 29.0 25 23.0 26 39.0 27 33.0 28 29.0 29 42.0 30 55.0 31 75.0 32 105.0 33 87.0 34 165.0 35 247.0 36 500.0 37 2342.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.824999999999996 20.75 13.15 27.275 2 27.800000000000004 26.424999999999997 28.799999999999997 16.975 3 19.225 28.15 31.525 21.099999999999998 4 23.980995248812203 32.83320830207552 22.80570142535634 20.38009502375594 5 24.73736868434217 36.493246623311656 21.360680340170084 17.408704352176088 6 19.719368579303435 37.6096216487096 23.527937860185418 19.143071911801552 7 20.24108488196886 21.572074334505274 38.49824208940231 19.688598694123556 8 21.93761095612478 25.792543748414914 27.542480344915038 24.72736495054527 9 21.67376597344024 25.63267351540967 29.766975695314457 22.92658481583563 10-14 23.658325263748026 28.148412415269352 26.68569389939351 21.507568421589113 15-19 22.691931414448277 27.949127233407133 28.345605272643017 21.01333607950157 20-24 23.012170385395535 27.647058823529413 28.10344827586207 21.23732251521298 25-29 23.957706955301663 27.881338945680493 27.325115253557826 20.83583884546001 30-34 22.843869925267622 28.080185821046257 28.312462128862858 20.76348212482327 35-39 23.097443124622508 27.914233944030602 27.84880209381921 21.139520837527684 40-44 23.198753079591732 28.37246719292071 27.965206898285484 20.46357282920207 45-49 23.157365510306686 27.461035696329816 28.47159376571141 20.910005027652087 50-54 23.513803133132622 27.840996070827167 28.024697657804765 20.620503138235442 55-59 23.42764837684331 27.23151477254963 28.258037621801886 21.082799228805168 60-64 23.238887444762153 27.434364439823238 28.162204315050687 21.16454380036392 65-69 23.05612244897959 27.892857142857142 28.163265306122447 20.887755102040817 70-74 23.538176960230192 28.11119103894769 27.80289795498921 20.547734045832904 75-79 23.07100348861071 28.103837471783294 28.237225528421916 20.587933511184076 80-84 23.10021037508338 27.55913592282826 28.380111857971162 20.960541844117195 85-89 24.012266802964476 27.518527983644265 27.722974699718883 20.746230513672373 90-94 23.38597664488914 28.000411543803693 28.031277329080712 20.582334482226454 95-99 23.379334928960635 27.875948464633087 28.25278810408922 20.491928502317055 100-104 23.61754148676065 27.784424907662697 28.002913176923478 20.59512042865318 105-109 23.246853326483432 27.808887747238632 27.916773696378115 21.02748522989982 110-114 23.136220187283357 27.60101402038388 27.91142842361219 21.351337368720575 115-119 23.645269399329724 27.898943026553237 27.17195153390049 21.28383604021655 120-124 23.600812595226003 28.02437785678009 27.958354494667343 20.416455053326562 125-129 23.28217117300264 28.649115673917464 27.642813579995934 20.42589957308396 130-134 23.58853392133737 27.588328803651095 28.280600994820777 20.54253628019076 135-139 23.485816509072325 27.89164324048045 27.62586250958344 20.996677740863788 140-144 23.52051618106664 27.76489565480391 28.2437745740498 20.470813590079644 145-149 23.315800121383777 27.857576370625125 28.150920493627353 20.675703014363748 150-151 23.869731800766285 26.998722860791823 29.310344827586203 19.821200510855682 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 1.0 8 3.0 9 3.5 10 4.5 11 6.0 12 6.0 13 7.0 14 5.0 15 4.0 16 6.5 17 4.5 18 3.0 19 4.5 20 4.5 21 4.0 22 3.0 23 5.0 24 3.5 25 4.5 26 9.5 27 9.5 28 7.0 29 8.5 30 17.0 31 22.0 32 24.0 33 28.5 34 43.5 35 62.5 36 81.5 37 110.5 38 128.0 39 147.5 40 176.5 41 213.5 42 262.0 43 275.0 44 289.5 45 296.0 46 268.0 47 262.0 48 242.0 49 205.5 50 184.5 51 151.0 52 104.5 53 72.0 54 53.0 55 41.0 56 33.0 57 25.5 58 19.5 59 10.5 60 5.0 61 4.0 62 4.0 63 5.0 64 4.5 65 2.5 66 0.5 67 1.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.05 6 0.22499999999999998 7 0.44999999999999996 8 1.425 9 0.22499999999999998 10-14 1.8950000000000002 15-19 2.895 20-24 1.4000000000000001 25-29 0.22 30-34 0.98 35-39 0.66 40-44 0.555 45-49 0.5499999999999999 50-54 2.015 55-59 4.045 60-64 3.8249999999999997 65-69 2.0 70-74 2.69 75-79 2.54 80-84 2.555 85-89 2.175 90-94 2.8049999999999997 95-99 1.815 100-104 3.8850000000000002 105-109 2.675 110-114 3.3550000000000004 115-119 3.025 120-124 1.55 125-129 1.6199999999999999 130-134 2.495 135-139 2.175 140-144 0.8099999999999999 145-149 1.1400000000000001 150-151 2.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0750000000000002 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra Read 918628 spots for SRR7168954.sra Written 918628 spots for SRR7168954.sra SRR ids: ['SRR7168954.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_frfd82gf SRR7168954.sra spots: 18372560 blocks: [[1, 918628], [918629, 1837256], [1837257, 2755884], [2755885, 3674512], [3674513, 4593140], [4593141, 5511768], [5511769, 6430396], [6430397, 7349024], [7349025, 8267652], [8267653, 9186280], [9186281, 10104908], [10104909, 11023536], [11023537, 11942164], [11942165, 12860792], [12860793, 13779420], [13779421, 14698048], [14698049, 15616676], [15616677, 16535304], [16535305, 17453932], [17453933, 18372560]] SRR7168954 file size 6204157 SRR7168954 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168954 SRR7168954_1.fastq SRR7168954_2.fastq Input file: SRR7168954_1.fastq Paired file: SRR7168954_2.fastq trimmed: SRR7168954-trimmed-pair1.fastq, SRR7168954-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:49:01 2025 >> started Mon Feb 10 11:49:21 2025 >> done (20.016s) 18372560 read pairs processed; of these: 36621 ( 0.20%) short read pairs filtered out after trimming by size control 21973 ( 0.12%) empty read pairs filtered out after trimming by size control 18313966 (99.68%) read pairs available; of these: 8093759 (44.19%) trimmed read pairs available after processing 10220207 (55.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 8 0.00% 23 7 0.00% 24 5 0.00% 25 10 0.00% 26 4 0.00% 27 7 0.00% 28 6 0.00% 29 5 0.00% 30 6 0.00% 31 7 0.00% 32 8 0.00% 33 11 0.00% 34 10 0.00% 35 13 0.00% 36 10 0.00% 37 7 0.00% 38 12 0.00% 39 10 0.00% 40 12 0.00% 41 10 0.00% 42 18 0.00% 43 18 0.00% 44 15 0.00% 45 19 0.00% 46 11 0.00% 47 19 0.00% 48 21 0.00% 49 26 0.00% 50 30 0.00% 51 31 0.00% 52 34 0.00% 53 26 0.00% 54 46 0.00% 55 45 0.00% 56 36 0.00% 57 41 0.00% 58 62 0.00% 59 70 0.00% 60 54 0.00% 61 97 0.00% 62 85 0.00% 63 113 0.00% 64 124 0.00% 65 130 0.00% 66 151 0.00% 67 150 0.00% 68 198 0.00% 69 224 0.00% 70 225 0.00% 71 281 0.00% 72 345 0.00% 73 374 0.00% 74 384 0.00% 75 463 0.00% 76 512 0.00% 77 593 0.00% 78 634 0.00% 79 742 0.00% 80 878 0.00% 81 953 0.01% 82 1081 0.01% 83 1286 0.01% 84 2341 0.01% 85 2824 0.02% 86 2889 0.02% 87 3043 0.02% 88 3297 0.02% 89 3284 0.02% 90 3451 0.02% 91 3561 0.02% 92 4079 0.02% 93 3894 0.02% 94 4117 0.02% 95 4368 0.02% 96 4564 0.02% 97 4932 0.03% 98 5412 0.03% 99 5634 0.03% 100 6565 0.04% 101 6621 0.04% 102 6932 0.04% 103 7097 0.04% 104 7433 0.04% 105 8132 0.04% 106 8687 0.05% 107 8951 0.05% 108 9676 0.05% 109 9943 0.05% 110 10429 0.06% 111 11154 0.06% 112 11774 0.06% 113 12302 0.07% 114 13242 0.07% 115 13965 0.08% 116 14578 0.08% 117 15693 0.09% 118 16610 0.09% 119 17458 0.10% 120 18355 0.10% 121 19344 0.11% 122 20878 0.11% 123 22173 0.12% 124 23512 0.13% 125 25207 0.14% 126 27249 0.15% 127 28234 0.15% 128 30254 0.17% 129 32149 0.18% 130 34551 0.19% 131 36792 0.20% 132 40177 0.22% 133 43176 0.24% 134 46624 0.25% 135 50480 0.28% 136 55018 0.30% 137 59430 0.32% 138 65465 0.36% 139 72295 0.39% 140 79897 0.44% 141 90575 0.49% 142 102494 0.56% 143 120090 0.66% 144 142551 0.78% 145 173218 0.95% 146 221865 1.21% 147 308534 1.68% 148 468692 2.56% 149 922111 5.04% 150 4422614 24.15% 151 10220207 55.81% 18313966 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=31 prefix-density=0.20 prefix-fanout=2.6 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCAGGTGGTGCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=361.65 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=55.80 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=7.1 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7168954 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:50:12 Started mapping on | Feb 10 11:50:13 Finished on | Feb 10 11:52:01 Mapping speed, Million of reads per hour | 610.47 Number of input reads | 18313966 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17359427 Uniquely mapped reads % | 94.79% Average mapped length | 296.68 Number of splices: Total | 16485984 Number of splices: Annotated (sjdb) | 16229463 Number of splices: GT/AG | 16251237 Number of splices: GC/AG | 186777 Number of splices: AT/AC | 12872 Number of splices: Non-canonical | 35098 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320616 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 36828 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 659178 659178 659178 N_multimapping 320616 320616 320616 N_noFeature 405016 17156639 499766 N_ambiguous 183704 989 75021 UnstrandedReadsAssigned:16770707 PositiveStrandReadsAssigned:201799 NegativeStrandReadsAssigned:16784640 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168954 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168954-trimmed-pair1.fastq SRR7168954-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,313,966 reads, 16,681,783 reads pseudoaligned [quant] estimated average fragment length: 273.635 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR7168954.ke.tsv 34699 SRR7168954.se.tsv 87100 total ==> SRR7168954.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.37 290 9.40796 Potri.005G024800.1.v4.1 1035 762.365 35 2.59949 Potri.004G059700.1.v4.1 961 688.411 3 0.24675 Potri.007G009000.2.v4.1 1416 1143.37 0 0 Potri.003G141000.2.v4.1 2943 2670.37 294.058 6.23514 Potri.016G087400.1.v4.1 270 64.3909 1495 1314.62 Potri.015G069301.1.v4.1 564 299.139 0 0 Potri.010G195200.1.v4.1 1773 1500.37 22 0.830251 Potri.012G127500.1.v4.1 977 704.394 5438 437.127 ==> SRR7168954.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1607 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168954 completed mapping pipeline successfully