Starting /dee2/code/volunteer_pipeline.sh SRR7168955 current disk space = 3058898894848 free memory = 1446178848 SRR7168955 SRAfilesize 8fce6dd266bb6e182e960682fd48ab42 SRR7168955.sra SRR7168955.sra file validated SRR7168955 is paired end SRR7168955 is conventional basespace SRR7168955 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168955_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.5755 34.0 34.0 34.0 33.0 34.0 2 33.65225 34.0 34.0 34.0 33.0 34.0 3 33.67275 34.0 34.0 34.0 33.0 34.0 4 33.68325 34.0 34.0 34.0 33.0 34.0 5 33.67775 34.0 34.0 34.0 33.0 34.0 6 37.4 38.0 38.0 38.0 37.0 38.0 7 37.59325 38.0 38.0 38.0 38.0 38.0 8 37.662 38.0 38.0 38.0 38.0 38.0 9 37.499 38.0 38.0 38.0 38.0 38.0 10-14 37.65195 38.0 38.0 38.0 38.0 38.0 15-19 37.695899999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.681 38.0 38.0 38.0 38.0 38.0 25-29 37.62564999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.61 38.0 38.0 38.0 38.0 38.0 35-39 37.5615 38.0 38.0 38.0 38.0 38.0 40-44 37.43635 38.0 38.0 38.0 37.0 38.0 45-49 37.36135 38.0 38.0 38.0 37.0 38.0 50-54 37.31179999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.29065 38.0 38.0 38.0 37.0 38.0 60-64 37.26065 38.0 38.0 38.0 37.0 38.0 65-69 37.199749999999995 38.0 38.0 38.0 36.6 38.0 70-74 37.1315 38.0 38.0 38.0 36.2 38.0 75-79 37.084199999999996 38.0 38.0 38.0 36.2 38.0 80-84 36.99165000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.93715 38.0 38.0 38.0 36.0 38.0 90-94 36.8366 38.0 38.0 38.0 35.4 38.0 95-99 36.842 38.0 38.0 38.0 35.8 38.0 100-104 36.622749999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.561 38.0 38.0 38.0 34.4 38.0 110-114 36.3976 38.0 38.0 38.0 34.0 38.0 115-119 36.25430000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.0991 38.0 37.8 38.0 34.0 38.0 125-129 35.8226 38.0 37.2 38.0 32.8 38.0 130-134 35.65975 38.0 37.0 38.0 31.4 38.0 135-139 35.551849999999995 38.0 36.2 38.0 31.4 38.0 140-144 35.26134999999999 38.0 36.0 38.0 31.0 38.0 145-149 34.85379999999999 38.0 35.8 38.0 29.8 38.0 150-151 31.69825 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 3.0 15 1.0 16 4.0 17 2.0 18 6.0 19 3.0 20 4.0 21 1.0 22 8.0 23 6.0 24 3.0 25 7.0 26 10.0 27 14.0 28 19.0 29 25.0 30 38.0 31 44.0 32 44.0 33 65.0 34 97.0 35 184.0 36 463.0 37 2944.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.132397191574725 15.220661985957873 10.932798395185557 29.714142427281846 2 22.57822277847309 15.569461827284107 31.314142678347935 30.538172715894866 3 19.675 21.45 26.650000000000002 32.225 4 21.95 29.325000000000003 22.5 26.224999999999998 5 21.9 31.275 25.05 21.775 6 20.625 33.375 25.424999999999997 20.575 7 15.625 27.075 39.825 17.474999999999998 8 17.925 25.8 30.85 25.424999999999997 9 18.025 26.450000000000003 31.75 23.775 10-14 19.705000000000002 30.275000000000002 27.02 23.0 15-19 20.06 29.34 26.900000000000002 23.7 20-24 19.48 29.075 27.284999999999997 24.16 25-29 19.86 29.759999999999998 27.339999999999996 23.04 30-34 19.869999999999997 28.915000000000003 27.205000000000002 24.01 35-39 19.91 29.635 26.44 24.015 40-44 20.115 29.044999999999998 27.3 23.54 45-49 20.455000000000002 29.21 26.875 23.46 50-54 19.775000000000002 29.975 26.575 23.674999999999997 55-59 19.865 28.895 27.115000000000002 24.125 60-64 19.905 28.83 27.275 23.990000000000002 65-69 20.0 29.020000000000003 26.915 24.065 70-74 20.505000000000003 29.42 25.869999999999997 24.205 75-79 20.175 28.694999999999997 26.924999999999997 24.205 80-84 20.49 28.605000000000004 26.735 24.169999999999998 85-89 20.535 28.939999999999998 26.83 23.695 90-94 20.16 28.910000000000004 27.029999999999998 23.9 95-99 20.630000000000003 28.754999999999995 27.029999999999998 23.585 100-104 21.0 28.345 27.255000000000003 23.400000000000002 105-109 20.89 27.815 26.705000000000002 24.59 110-114 20.655 28.42 26.555 24.37 115-119 20.985 28.59 26.900000000000002 23.525 120-124 20.810000000000002 28.055000000000003 27.105 24.03 125-129 20.65 27.345000000000002 27.455000000000002 24.55 130-134 20.87 28.585 26.8 23.745 135-139 20.82 28.115000000000002 26.82 24.245 140-144 20.73 27.589999999999996 27.04 24.64 145-149 20.599999999999998 27.92 26.790000000000003 24.69 150-151 20.849999999999998 27.737499999999997 26.674999999999997 24.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.5 22 4.0 23 5.0 24 4.5 25 3.5 26 6.5 27 11.5 28 17.5 29 27.5 30 28.5 31 33.0 32 44.5 33 57.5 34 70.5 35 78.0 36 97.5 37 118.0 38 137.5 39 146.0 40 155.0 41 188.0 42 195.5 43 208.0 44 242.0 45 251.0 46 228.5 47 230.5 48 235.5 49 192.0 50 158.5 51 149.5 52 140.5 53 122.5 54 97.0 55 72.0 56 52.5 57 39.0 58 33.0 59 23.0 60 19.0 61 20.5 62 13.5 63 6.5 64 3.5 65 2.0 66 3.5 67 3.5 68 3.0 69 4.5 70 3.0 71 1.0 72 1.0 73 2.0 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06565656565657 98.075 2 0.8838383838383838 1.7500000000000002 3 0.025252525252525252 0.075 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.225 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 3.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGATT 10 0.006830828 145.0 8 CATTGAG 10 0.006830828 145.0 5 TATGGCT 10 0.006830828 145.0 9 >>END_MODULE SRR7168955 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168955_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.114 34.0 33.0 34.0 33.0 34.0 2 33.156 34.0 33.0 34.0 33.0 34.0 3 33.16075 34.0 33.0 34.0 33.0 34.0 4 33.1655 34.0 33.0 34.0 33.0 34.0 5 33.1455 34.0 33.0 34.0 33.0 34.0 6 37.2825 38.0 38.0 38.0 38.0 38.0 7 37.318 38.0 38.0 38.0 38.0 38.0 8 37.39375 38.0 38.0 38.0 38.0 38.0 9 37.34175 38.0 38.0 38.0 38.0 38.0 10-14 37.24465 38.0 38.0 38.0 38.0 38.0 15-19 37.17235 38.0 38.0 38.0 37.6 38.0 20-24 37.20955 38.0 38.0 38.0 38.0 38.0 25-29 37.191199999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.155 38.0 38.0 38.0 37.8 38.0 35-39 37.0715 38.0 38.0 38.0 37.2 38.0 40-44 37.06305 38.0 38.0 38.0 37.4 38.0 45-49 37.0213 38.0 38.0 38.0 37.0 38.0 50-54 36.954750000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.930550000000004 38.0 38.0 38.0 37.0 38.0 60-64 36.8091 38.0 38.0 38.0 36.8 38.0 65-69 36.80335 38.0 38.0 38.0 36.2 38.0 70-74 36.766949999999994 38.0 38.0 38.0 36.4 38.0 75-79 36.65915 38.0 38.0 38.0 36.0 38.0 80-84 36.6107 38.0 38.0 38.0 35.8 38.0 85-89 36.51324999999999 38.0 38.0 38.0 35.6 38.0 90-94 36.4171 38.0 38.0 38.0 35.2 38.0 95-99 36.28245 38.0 38.0 38.0 34.2 38.0 100-104 36.1265 38.0 38.0 38.0 34.0 38.0 105-109 35.968450000000004 38.0 38.0 38.0 34.0 38.0 110-114 35.72685 38.0 38.0 38.0 32.6 38.0 115-119 35.68025 38.0 38.0 38.0 32.8 38.0 120-124 35.207950000000004 38.0 36.8 38.0 30.4 38.0 125-129 34.959450000000004 38.0 36.0 38.0 28.0 38.0 130-134 34.737049999999996 38.0 36.0 38.0 28.2 38.0 135-139 34.37955 38.0 35.8 38.0 24.8 38.0 140-144 33.75245 38.0 34.2 38.0 21.4 38.0 145-149 32.93865 38.0 33.0 38.0 16.2 38.0 150-151 28.883000000000003 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 7.0 4 1.0 5 0.0 6 5.0 7 5.0 8 3.0 9 3.0 10 1.0 11 2.0 12 2.0 13 4.0 14 3.0 15 2.0 16 4.0 17 1.0 18 10.0 19 2.0 20 7.0 21 12.0 22 12.0 23 10.0 24 11.0 25 16.0 26 18.0 27 19.0 28 31.0 29 40.0 30 27.0 31 37.0 32 59.0 33 80.0 34 117.0 35 207.0 36 468.0 37 2758.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.800000000000004 22.900000000000002 13.725000000000001 23.575 2 26.525 26.85 28.749999999999996 17.875 3 23.400000000000002 27.35 29.675 19.575 4 24.45 33.650000000000006 22.875 19.025 5 25.6 34.75 21.65 18.0 6 21.9 35.199999999999996 23.925 18.975 7 21.775 22.475 36.275 19.475 8 24.025 24.474999999999998 27.0 24.5 9 22.425 25.650000000000002 28.599999999999998 23.325000000000003 10-14 24.575 28.46 25.335 21.63 15-19 24.490000000000002 28.03 26.44 21.04 20-24 24.21 28.15 26.640000000000004 21.0 25-29 24.33 27.42 27.005000000000003 21.245 30-34 23.880000000000003 27.62 27.705000000000002 20.794999999999998 35-39 24.240000000000002 27.565 27.029999999999998 21.165 40-44 23.97 28.07 26.845000000000002 21.115000000000002 45-49 24.27 27.825 26.63 21.275 50-54 23.82 27.534999999999997 27.525 21.12 55-59 23.97 27.439999999999998 27.18 21.41 60-64 24.03 27.305 27.57 21.095 65-69 24.279999999999998 27.22 27.665 20.835 70-74 24.47 26.77 27.905 20.855 75-79 24.295 26.955000000000002 27.38 21.37 80-84 23.919999999999998 27.36 27.200000000000003 21.52 85-89 24.435000000000002 26.979999999999997 27.894999999999996 20.69 90-94 24.215 27.375 27.92 20.49 95-99 24.215 27.515 27.63 20.64 100-104 24.529999999999998 27.615000000000002 27.229999999999997 20.625 105-109 24.38 27.155 28.015 20.45 110-114 24.485 27.750000000000004 26.790000000000003 20.974999999999998 115-119 24.25 27.395000000000003 27.860000000000003 20.495 120-124 24.37 27.61 27.675 20.345 125-129 24.54 27.325 27.6 20.535 130-134 24.365000000000002 27.735 27.284999999999997 20.615 135-139 24.625 27.47 26.979999999999997 20.925 140-144 24.915000000000003 27.900000000000002 27.089999999999996 20.095 145-149 24.52 27.61 27.865000000000002 20.005 150-151 25.3 27.0 27.5875 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 3.0 28 6.0 29 8.5 30 8.5 31 10.5 32 14.0 33 22.5 34 31.5 35 50.0 36 65.5 37 78.5 38 117.5 39 146.5 40 164.5 41 198.5 42 232.0 43 246.5 44 269.5 45 299.5 46 292.0 47 263.0 48 239.5 49 216.0 50 196.0 51 159.0 52 129.5 53 118.5 54 94.0 55 72.0 56 55.5 57 37.0 58 25.0 59 22.0 60 19.5 61 15.5 62 12.0 63 10.0 64 4.5 65 3.0 66 3.5 67 1.5 68 2.5 69 4.0 70 3.5 71 3.5 72 2.5 73 0.5 74 0.5 75 1.5 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93778452200304 97.8 2 0.9863429438543246 1.95 3 0.05058168942842691 0.15 4 0.025290844714213456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.5499999999999998 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.225 0.0 0.0 0.0 0.0 136-137 3.3375 0.0 0.0 0.0 0.0 138-139 3.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATATT 10 0.006830828 145.0 4 TGAAAAC 10 0.006830828 145.0 2 >>END_MODULE Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra Read 644519 spots for SRR7168955.sra Written 644519 spots for SRR7168955.sra SRR ids: ['SRR7168955.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_izhxuwjc SRR7168955.sra spots: 12890380 blocks: [[1, 644519], [644520, 1289038], [1289039, 1933557], [1933558, 2578076], [2578077, 3222595], [3222596, 3867114], [3867115, 4511633], [4511634, 5156152], [5156153, 5800671], [5800672, 6445190], [6445191, 7089709], [7089710, 7734228], [7734229, 8378747], [8378748, 9023266], [9023267, 9667785], [9667786, 10312304], [10312305, 10956823], [10956824, 11601342], [11601343, 12245861], [12245862, 12890380]] SRR7168955 file size 4346426 SRR7168955 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168955 SRR7168955_1.fastq SRR7168955_2.fastq Input file: SRR7168955_1.fastq Paired file: SRR7168955_2.fastq trimmed: SRR7168955-trimmed-pair1.fastq, SRR7168955-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:03:43 2025 >> started Mon Feb 10 12:03:56 2025 >> done (13.838s) 12890380 read pairs processed; of these: 30852 ( 0.24%) short read pairs filtered out after trimming by size control 20928 ( 0.16%) empty read pairs filtered out after trimming by size control 12838600 (99.60%) read pairs available; of these: 5106690 (39.78%) trimmed read pairs available after processing 7731910 (60.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 8 0.00% 21 8 0.00% 22 5 0.00% 23 2 0.00% 24 5 0.00% 25 10 0.00% 26 5 0.00% 27 13 0.00% 28 5 0.00% 29 8 0.00% 30 11 0.00% 31 11 0.00% 32 17 0.00% 33 10 0.00% 34 12 0.00% 35 12 0.00% 36 10 0.00% 37 12 0.00% 38 11 0.00% 39 9 0.00% 40 12 0.00% 41 16 0.00% 42 15 0.00% 43 14 0.00% 44 13 0.00% 45 13 0.00% 46 25 0.00% 47 24 0.00% 48 24 0.00% 49 31 0.00% 50 29 0.00% 51 34 0.00% 52 25 0.00% 53 40 0.00% 54 44 0.00% 55 51 0.00% 56 52 0.00% 57 51 0.00% 58 59 0.00% 59 64 0.00% 60 65 0.00% 61 70 0.00% 62 107 0.00% 63 95 0.00% 64 95 0.00% 65 124 0.00% 66 136 0.00% 67 140 0.00% 68 171 0.00% 69 250 0.00% 70 342 0.00% 71 332 0.00% 72 293 0.00% 73 301 0.00% 74 368 0.00% 75 396 0.00% 76 404 0.00% 77 479 0.00% 78 537 0.00% 79 635 0.00% 80 694 0.01% 81 776 0.01% 82 931 0.01% 83 1051 0.01% 84 2327 0.02% 85 3199 0.02% 86 3405 0.03% 87 3558 0.03% 88 3690 0.03% 89 3848 0.03% 90 3846 0.03% 91 3857 0.03% 92 4003 0.03% 93 4375 0.03% 94 4624 0.04% 95 4735 0.04% 96 5060 0.04% 97 5241 0.04% 98 5636 0.04% 99 5734 0.04% 100 6156 0.05% 101 6558 0.05% 102 6886 0.05% 103 7413 0.06% 104 7863 0.06% 105 8444 0.07% 106 8841 0.07% 107 9458 0.07% 108 9754 0.08% 109 10318 0.08% 110 10883 0.08% 111 11433 0.09% 112 12157 0.09% 113 12874 0.10% 114 13595 0.11% 115 14142 0.11% 116 14932 0.12% 117 15649 0.12% 118 16338 0.13% 119 17003 0.13% 120 17430 0.14% 121 18185 0.14% 122 19384 0.15% 123 20446 0.16% 124 21760 0.17% 125 23182 0.18% 126 24280 0.19% 127 25110 0.20% 128 26437 0.21% 129 28120 0.22% 130 29546 0.23% 131 30647 0.24% 132 33176 0.26% 133 35143 0.27% 134 37741 0.29% 135 41277 0.32% 136 43681 0.34% 137 46863 0.37% 138 49781 0.39% 139 53260 0.41% 140 57034 0.44% 141 61261 0.48% 142 67434 0.53% 143 74734 0.58% 144 85864 0.67% 145 101163 0.79% 146 123083 0.96% 147 162139 1.26% 148 245350 1.91% 149 480652 3.74% 150 2725065 21.23% 151 7731910 60.22% 12838600 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=34 prefix-density=0.19 prefix-fanout=2.2 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=68.71 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.5 sequence=CTCTGCCACTTACAATACCCCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGCGGCTCTTTCACCGCGAGGGCTTGGCCAACGGCACGTGCCTCCGGGGCCAAGAGGCCCCTACTGCAGGTCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTAGAGGCGTTCAGTCATAATCCAACGCACGGTAGCTTCGCGCCACTGGCTTTTCAACCAAGCGCGATGACCAATTGTGCGAATCAACGGTTCCTCTCGTA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=15.65 fanout-score-rank=4 prefix-density=0.46 prefix-fanout=6.9 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCTTTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=47.83 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=11.2 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAGCGTGCCCAAAGCAGATGCCGTTTTCATGAAGTGGATATGCCATGATTGGAGCGACGCACACTGCTTAAAATTCTTGAAGAATTGCTATGACGC SRR7168955 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:04:45 Started mapping on | Feb 10 12:04:45 Finished on | Feb 10 12:07:02 Mapping speed, Million of reads per hour | 337.36 Number of input reads | 12838600 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11290606 Uniquely mapped reads % | 87.94% Average mapped length | 295.93 Number of splices: Total | 9372613 Number of splices: Annotated (sjdb) | 9205713 Number of splices: GT/AG | 9235773 Number of splices: GC/AG | 105342 Number of splices: AT/AC | 7482 Number of splices: Non-canonical | 24016 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230317 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 373474 % of reads mapped to too many loci | 2.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.97% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1343592 1343592 1343592 N_multimapping 230317 230317 230317 N_noFeature 248870 11139253 303803 N_ambiguous 145190 1021 47993 UnstrandedReadsAssigned:10896546 PositiveStrandReadsAssigned:150332 NegativeStrandReadsAssigned:10938810 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168955 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168955-trimmed-pair1.fastq SRR7168955-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,838,600 reads, 11,193,430 reads pseudoaligned [quant] estimated average fragment length: 240.79 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7168955.ke.tsv 34699 SRR7168955.se.tsv 87100 total ==> SRR7168955.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.21 182 7.80965 Potri.005G024800.1.v4.1 1035 795.21 25 2.39884 Potri.004G059700.1.v4.1 961 721.221 1 0.105797 Potri.007G009000.2.v4.1 1416 1176.21 0 0 Potri.003G141000.2.v4.1 2943 2703.21 181 5.10907 Potri.016G087400.1.v4.1 270 71.8001 1228.34 1305.38 Potri.015G069301.1.v4.1 564 326.894 0 0 Potri.010G195200.1.v4.1 1773 1533.21 27 1.34371 Potri.012G127500.1.v4.1 977 737.216 4657 482.009 ==> SRR7168955.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1236 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168955 completed mapping pipeline successfully