Starting /dee2/code/volunteer_pipeline.sh SRR7168956 current disk space = 3058902925312 free memory = 1207518668 SRR7168956 SRAfilesize 368559bcc0c9d9c8c475b33e10d5101e SRR7168956.sra SRR7168956.sra file validated SRR7168956 is paired end SRR7168956 is conventional basespace SRR7168956 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168956_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91675 34.0 33.0 34.0 33.0 34.0 2 33.3755 34.0 34.0 34.0 33.0 34.0 3 33.48775 34.0 34.0 34.0 33.0 34.0 4 33.51175 34.0 34.0 34.0 33.0 34.0 5 33.50225 34.0 34.0 34.0 33.0 34.0 6 37.251 38.0 38.0 38.0 36.0 38.0 7 37.4185 38.0 38.0 38.0 37.0 38.0 8 37.55775 38.0 38.0 38.0 38.0 38.0 9 37.60775 38.0 38.0 38.0 38.0 38.0 10-14 37.59935 38.0 38.0 38.0 38.0 38.0 15-19 37.60455 38.0 38.0 38.0 38.0 38.0 20-24 37.56295 38.0 38.0 38.0 38.0 38.0 25-29 37.524899999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.48135 38.0 38.0 38.0 37.6 38.0 35-39 37.4228 38.0 38.0 38.0 37.4 38.0 40-44 37.312200000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.24825 38.0 38.0 38.0 37.0 38.0 50-54 37.21385 38.0 38.0 38.0 36.4 38.0 55-59 37.20595 38.0 38.0 38.0 36.4 38.0 60-64 37.130199999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.081500000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.12895 38.0 38.0 38.0 36.0 38.0 75-79 36.9883 38.0 38.0 38.0 36.0 38.0 80-84 36.99685 38.0 38.0 38.0 36.0 38.0 85-89 36.8955 38.0 38.0 38.0 35.6 38.0 90-94 36.771 38.0 38.0 38.0 35.2 38.0 95-99 36.686699999999995 38.0 38.0 38.0 34.6 38.0 100-104 36.556799999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.455600000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.19539999999999 38.0 37.6 38.0 33.6 38.0 115-119 36.05775 38.0 37.0 38.0 33.2 38.0 120-124 35.99485 38.0 37.0 38.0 33.0 38.0 125-129 35.811099999999996 38.0 37.0 38.0 31.8 38.0 130-134 35.59349999999999 38.0 36.0 38.0 31.0 38.0 135-139 35.3823 38.0 36.0 38.0 31.0 38.0 140-144 34.993500000000004 38.0 35.8 38.0 28.6 38.0 145-149 34.456849999999996 38.0 35.0 38.0 27.6 38.0 150-151 31.365624999999998 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 3.0 19 3.0 20 3.0 21 3.0 22 5.0 23 6.0 24 15.0 25 7.0 26 18.0 27 22.0 28 20.0 29 27.0 30 31.0 31 39.0 32 57.0 33 83.0 34 130.0 35 236.0 36 618.0 37 2669.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.74451810300867 12.468128505864355 9.663437021927589 37.12391636919939 2 22.675 14.575 33.900000000000006 28.849999999999998 3 19.950000000000003 18.925 26.375 34.75 4 22.225 29.5 22.5 25.775 5 22.5 31.25 24.8 21.45 6 19.825 34.849999999999994 24.775 20.549999999999997 7 14.975 27.175 40.2 17.65 8 19.05 25.025 30.45 25.474999999999998 9 17.7 24.45 33.425 24.425 10-14 19.685 30.42 26.340000000000003 23.555 15-19 19.415 29.654999999999998 27.089999999999996 23.84 20-24 19.439999999999998 29.049999999999997 27.12 24.39 25-29 19.78 28.884999999999998 27.275 24.060000000000002 30-34 19.790989549477477 29.076453822691136 27.156357817890896 23.976198809940495 35-39 20.061003050152507 29.33146657332867 26.756337816890845 23.851192559627982 40-44 20.615 28.804999999999996 27.089999999999996 23.49 45-49 20.44 28.62 27.05 23.89 50-54 20.665 28.7 27.005000000000003 23.630000000000003 55-59 20.205000000000002 28.444999999999997 27.33 24.02 60-64 20.68 27.785 27.47 24.065 65-69 20.185 28.9 26.87 24.044999999999998 70-74 20.369999999999997 28.055000000000003 27.310000000000002 24.265 75-79 20.31 28.494999999999997 26.72 24.474999999999998 80-84 20.945 27.794999999999998 27.67 23.59 85-89 20.84 27.889999999999997 27.700000000000003 23.57 90-94 19.715 27.725 27.779999999999998 24.779999999999998 95-99 20.04 27.994999999999997 27.689999999999998 24.275 100-104 20.89 28.34 26.565 24.205 105-109 20.715 27.87 27.250000000000004 24.165 110-114 20.385 28.255000000000003 27.295 24.065 115-119 20.94 27.705000000000002 27.22 24.135 120-124 20.8 27.735 27.51 23.955000000000002 125-129 20.72 28.395 27.41 23.474999999999998 130-134 21.14 27.93 26.950000000000003 23.98 135-139 20.925 27.82 27.395000000000003 23.86 140-144 21.135 27.975 27.37 23.52 145-149 20.849999999999998 28.53 26.76 23.86 150-151 20.974999999999998 28.275 26.5625 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 1.0 24 1.5 25 3.0 26 5.0 27 7.5 28 10.0 29 11.0 30 17.0 31 25.0 32 31.0 33 35.5 34 43.5 35 63.5 36 84.0 37 111.0 38 140.0 39 156.5 40 175.5 41 210.0 42 222.0 43 238.5 44 253.5 45 257.0 46 270.5 47 253.0 48 237.5 49 213.0 50 169.0 51 150.0 52 137.5 53 110.0 54 91.5 55 68.5 56 43.5 57 32.0 58 25.0 59 22.0 60 17.0 61 11.5 62 9.0 63 9.5 64 6.0 65 3.0 66 3.5 67 2.0 68 2.0 69 3.0 70 1.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.5875 0.0 0.0 0.0 0.0 138-139 1.7625 0.0125 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCTTT 10 0.006577216 146.82278 1 >>END_MODULE SRR7168956 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168956_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9805 33.0 33.0 34.0 32.0 34.0 2 33.08925 34.0 33.0 34.0 32.0 34.0 3 33.1175 34.0 33.0 34.0 33.0 34.0 4 33.12325 34.0 33.0 34.0 33.0 34.0 5 33.09925 34.0 33.0 34.0 33.0 34.0 6 37.25375 38.0 38.0 38.0 37.0 38.0 7 37.25925 38.0 38.0 38.0 37.0 38.0 8 37.31225 38.0 38.0 38.0 37.0 38.0 9 37.28475 38.0 38.0 38.0 37.0 38.0 10-14 37.25770000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.1652 38.0 38.0 38.0 37.0 38.0 20-24 37.1999 38.0 38.0 38.0 37.0 38.0 25-29 37.1442 38.0 38.0 38.0 37.0 38.0 30-34 37.172399999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.143150000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.131299999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.11525 38.0 38.0 38.0 37.0 38.0 50-54 37.067 38.0 38.0 38.0 36.6 38.0 55-59 37.036649999999995 38.0 38.0 38.0 36.2 38.0 60-64 36.977650000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.82955 38.0 38.0 38.0 35.8 38.0 70-74 36.78735 38.0 38.0 38.0 35.6 38.0 75-79 36.74305 38.0 38.0 38.0 35.4 38.0 80-84 36.671 38.0 38.0 38.0 35.2 38.0 85-89 36.532799999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.3967 38.0 38.0 38.0 34.2 38.0 95-99 36.31535 38.0 38.0 38.0 34.0 38.0 100-104 36.203050000000005 38.0 38.0 38.0 33.8 38.0 105-109 36.14025 38.0 38.0 38.0 33.6 38.0 110-114 35.89655 38.0 37.4 38.0 33.0 38.0 115-119 35.7034 38.0 37.0 38.0 31.6 38.0 120-124 35.37525 38.0 36.4 38.0 29.4 38.0 125-129 35.28335 38.0 36.2 38.0 29.4 38.0 130-134 34.911 38.0 36.0 38.0 28.4 38.0 135-139 34.558400000000006 38.0 35.0 38.0 26.2 38.0 140-144 34.1533 38.0 35.0 38.0 23.6 38.0 145-149 33.4327 38.0 34.4 38.0 19.0 38.0 150-151 29.17 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 1.0 14 1.0 15 5.0 16 4.0 17 6.0 18 11.0 19 6.0 20 6.0 21 3.0 22 8.0 23 9.0 24 9.0 25 15.0 26 22.0 27 25.0 28 40.0 29 36.0 30 37.0 31 46.0 32 79.0 33 76.0 34 137.0 35 245.0 36 602.0 37 2557.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.95 21.125 13.375 28.549999999999997 2 27.750000000000004 25.5 30.049999999999997 16.7 3 20.8 27.925 30.975 20.3 4 24.5 34.0 22.85 18.65 5 24.675 35.099999999999994 22.125 18.099999999999998 6 21.525 36.525 23.0 18.95 7 20.275000000000002 21.675 37.724999999999994 20.325 8 21.8 25.35 27.900000000000002 24.95 9 21.95 24.15 30.8 23.1 10-14 23.625 29.085 25.89 21.4 15-19 24.035 28.12 26.810000000000002 21.035 20-24 23.315 27.555000000000003 27.465 21.665 25-29 23.87 28.51 27.05 20.57 30-34 23.625 27.73 27.525 21.12 35-39 23.335 27.634999999999998 27.35 21.68 40-44 23.974999999999998 27.925 27.389999999999997 20.71 45-49 23.285 27.675 27.74 21.3 50-54 23.294999999999998 27.845 27.185 21.675 55-59 23.415 27.134999999999998 28.74 20.71 60-64 23.669999999999998 27.61 28.1 20.62 65-69 24.185000000000002 27.125 28.115000000000002 20.575 70-74 23.895 27.91 27.339999999999996 20.855 75-79 23.830000000000002 27.150000000000002 28.335 20.685000000000002 80-84 23.549999999999997 28.01 27.584999999999997 20.855 85-89 24.044999999999998 27.045 27.534999999999997 21.375 90-94 24.265 27.52 27.46 20.755000000000003 95-99 23.335 27.505000000000003 28.299999999999997 20.86 100-104 24.285 27.705000000000002 27.584999999999997 20.424999999999997 105-109 24.295 27.145000000000003 27.925 20.635 110-114 23.724999999999998 27.644999999999996 27.544999999999998 21.085 115-119 24.025 27.735 27.51 20.73 120-124 23.315 27.505000000000003 27.775 21.404999999999998 125-129 23.93 27.48 27.77 20.82 130-134 24.474999999999998 26.915 27.87 20.74 135-139 24.2 27.465 28.235 20.1 140-144 24.315 27.825 27.46 20.4 145-149 24.474999999999998 27.495000000000005 27.005000000000003 21.025 150-151 23.8125 28.125 27.925 20.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 2.5 26 1.5 27 1.0 28 1.0 29 4.5 30 7.5 31 9.5 32 17.0 33 29.5 34 37.5 35 49.5 36 78.0 37 99.0 38 104.5 39 128.0 40 185.5 41 238.0 42 269.5 43 279.0 44 282.5 45 286.5 46 285.0 47 271.5 48 247.0 49 220.5 50 173.0 51 147.5 52 135.0 53 105.5 54 75.5 55 48.5 56 37.5 57 33.5 58 26.0 59 20.5 60 12.0 61 7.0 62 10.0 63 8.5 64 5.5 65 4.0 66 1.5 67 1.5 68 3.0 69 1.5 70 1.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.5875 0.0 0.0 0.0 0.0 138-139 1.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728110 spots for SRR7168956.sra Written 728110 spots for SRR7168956.sra Read 728129 spots for SRR7168956.sra Written 728129 spots for SRR7168956.sra SRR ids: ['SRR7168956.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vms07f5q SRR7168956.sra spots: 14562219 blocks: [[1, 728110], [728111, 1456220], [1456221, 2184330], [2184331, 2912440], [2912441, 3640550], [3640551, 4368660], [4368661, 5096770], [5096771, 5824880], [5824881, 6552990], [6552991, 7281100], [7281101, 8009210], [8009211, 8737320], [8737321, 9465430], [9465431, 10193540], [10193541, 10921650], [10921651, 11649760], [11649761, 12377870], [12377871, 13105980], [13105981, 13834090], [13834091, 14562219]] SRR7168956 file size 4912957 SRR7168956 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168956 SRR7168956_1.fastq SRR7168956_2.fastq Input file: SRR7168956_1.fastq Paired file: SRR7168956_2.fastq trimmed: SRR7168956-trimmed-pair1.fastq, SRR7168956-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:57:31 2025 >> started Mon Feb 10 11:57:47 2025 >> done (15.212s) 14562219 read pairs processed; of these: 13138 ( 0.09%) short read pairs filtered out after trimming by size control 14552 ( 0.10%) empty read pairs filtered out after trimming by size control 14534529 (99.81%) read pairs available; of these: 5623688 (38.69%) trimmed read pairs available after processing 8910841 (61.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 3 0.00% 24 3 0.00% 25 3 0.00% 26 0 0.00% 27 9 0.00% 28 4 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 4 0.00% 33 0 0.00% 34 4 0.00% 35 5 0.00% 36 5 0.00% 37 4 0.00% 38 4 0.00% 39 5 0.00% 40 6 0.00% 41 6 0.00% 42 6 0.00% 43 3 0.00% 44 6 0.00% 45 8 0.00% 46 7 0.00% 47 10 0.00% 48 6 0.00% 49 15 0.00% 50 20 0.00% 51 16 0.00% 52 16 0.00% 53 20 0.00% 54 20 0.00% 55 19 0.00% 56 31 0.00% 57 28 0.00% 58 41 0.00% 59 37 0.00% 60 42 0.00% 61 45 0.00% 62 45 0.00% 63 51 0.00% 64 59 0.00% 65 61 0.00% 66 72 0.00% 67 85 0.00% 68 100 0.00% 69 103 0.00% 70 143 0.00% 71 144 0.00% 72 170 0.00% 73 172 0.00% 74 200 0.00% 75 229 0.00% 76 263 0.00% 77 312 0.00% 78 312 0.00% 79 375 0.00% 80 404 0.00% 81 484 0.00% 82 495 0.00% 83 648 0.00% 84 1254 0.01% 85 1689 0.01% 86 1764 0.01% 87 1897 0.01% 88 1937 0.01% 89 1995 0.01% 90 2109 0.01% 91 2236 0.02% 92 2306 0.02% 93 2540 0.02% 94 2701 0.02% 95 2905 0.02% 96 2979 0.02% 97 3326 0.02% 98 3505 0.02% 99 3620 0.02% 100 3960 0.03% 101 4254 0.03% 102 4498 0.03% 103 4934 0.03% 104 5213 0.04% 105 5637 0.04% 106 6026 0.04% 107 6261 0.04% 108 6863 0.05% 109 7174 0.05% 110 7603 0.05% 111 8248 0.06% 112 8686 0.06% 113 9069 0.06% 114 10055 0.07% 115 10793 0.07% 116 11464 0.08% 117 12215 0.08% 118 12936 0.09% 119 13680 0.09% 120 14228 0.10% 121 15017 0.10% 122 16035 0.11% 123 16877 0.12% 124 18379 0.13% 125 19657 0.14% 126 20967 0.14% 127 22021 0.15% 128 23738 0.16% 129 25152 0.17% 130 26709 0.18% 131 28481 0.20% 132 30887 0.21% 133 33254 0.23% 134 35397 0.24% 135 38689 0.27% 136 41326 0.28% 137 44786 0.31% 138 48680 0.33% 139 53179 0.37% 140 58799 0.40% 141 65632 0.45% 142 72637 0.50% 143 83724 0.58% 144 97139 0.67% 145 115245 0.79% 146 143666 0.99% 147 194240 1.34% 148 297244 2.05% 149 589005 4.05% 150 3129156 21.53% 151 8910841 61.31% 14534529 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=184.44 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.3 sequence=AAAAACAAAAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=10 fanout-score=56.51 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=13.7 sequence=TGTTGGTGGTGG SRR7168956 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:58:37 Started mapping on | Feb 10 11:58:37 Finished on | Feb 10 11:59:57 Mapping speed, Million of reads per hour | 654.05 Number of input reads | 14534529 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13558537 Uniquely mapped reads % | 93.29% Average mapped length | 297.24 Number of splices: Total | 12740425 Number of splices: Annotated (sjdb) | 12536225 Number of splices: GT/AG | 12557509 Number of splices: GC/AG | 146961 Number of splices: AT/AC | 9841 Number of splices: Non-canonical | 26114 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267053 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 219489 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 721194 721194 721194 N_multimapping 267053 267053 267053 N_noFeature 262534 13408143 320548 N_ambiguous 147948 949 54914 UnstrandedReadsAssigned:13148055 PositiveStrandReadsAssigned:149445 NegativeStrandReadsAssigned:13183075 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168956 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168956-trimmed-pair1.fastq SRR7168956-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,534,529 reads, 13,251,414 reads pseudoaligned [quant] estimated average fragment length: 262.394 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7168956.ke.tsv 34699 SRR7168956.se.tsv 87100 total ==> SRR7168956.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.61 256 9.38318 Potri.005G024800.1.v4.1 1035 773.606 28 2.33036 Potri.004G059700.1.v4.1 961 699.665 1 0.0920226 Potri.007G009000.2.v4.1 1416 1154.61 0 0 Potri.003G141000.2.v4.1 2943 2681.61 210.06 5.04351 Potri.016G087400.1.v4.1 270 65.3186 1370.12 1350.54 Potri.015G069301.1.v4.1 564 308.164 0 0 Potri.010G195200.1.v4.1 1773 1511.61 22 0.937062 Potri.012G127500.1.v4.1 977 715.613 7114 640.059 ==> SRR7168956.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1264 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168956 completed mapping pipeline successfully