Starting /dee2/code/volunteer_pipeline.sh SRR7168957 current disk space = 3058701729792 free memory = 1305372852 SRR7168957 SRAfilesize 0a85a01842d6442d96b330b8478ed0a1 SRR7168957.sra SRR7168957.sra file validated SRR7168957 is paired end SRR7168957 is conventional basespace SRR7168957 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168957_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13675 34.0 34.0 34.0 33.0 34.0 2 33.4975 34.0 34.0 34.0 33.0 34.0 3 33.54375 34.0 34.0 34.0 33.0 34.0 4 33.5635 34.0 34.0 34.0 33.0 34.0 5 33.53625 34.0 34.0 34.0 33.0 34.0 6 37.226 38.0 38.0 38.0 36.0 38.0 7 37.48725 38.0 38.0 38.0 37.0 38.0 8 37.49675 38.0 38.0 38.0 37.0 38.0 9 37.526 38.0 38.0 38.0 37.0 38.0 10-14 37.6021 38.0 38.0 38.0 38.0 38.0 15-19 37.6156 38.0 38.0 38.0 38.0 38.0 20-24 37.589349999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.5889 38.0 38.0 38.0 38.0 38.0 30-34 37.5312 38.0 38.0 38.0 38.0 38.0 35-39 37.46805 38.0 38.0 38.0 37.2 38.0 40-44 37.3626 38.0 38.0 38.0 37.0 38.0 45-49 37.32639999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.31635000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.296800000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.2641 38.0 38.0 38.0 36.8 38.0 65-69 37.17235000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.15435 38.0 38.0 38.0 36.0 38.0 75-79 37.10699999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.031349999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.9828 38.0 38.0 38.0 36.0 38.0 90-94 36.90045 38.0 38.0 38.0 35.8 38.0 95-99 36.7813 38.0 38.0 38.0 35.2 38.0 100-104 36.6828 38.0 38.0 38.0 34.8 38.0 105-109 36.608700000000006 38.0 38.0 38.0 34.6 38.0 110-114 36.4573 38.0 38.0 38.0 34.0 38.0 115-119 36.3292 38.0 38.0 38.0 34.0 38.0 120-124 36.12405 38.0 37.6 38.0 33.6 38.0 125-129 36.025200000000005 38.0 37.4 38.0 33.2 38.0 130-134 35.750099999999996 38.0 36.4 38.0 32.0 38.0 135-139 35.5764 38.0 36.0 38.0 31.0 38.0 140-144 35.1649 38.0 36.0 38.0 29.8 38.0 145-149 34.58235 38.0 35.0 38.0 27.8 38.0 150-151 31.741125 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 2.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 2.0 19 1.0 20 3.0 21 6.0 22 0.0 23 3.0 24 5.0 25 7.0 26 9.0 27 15.0 28 21.0 29 31.0 30 47.0 31 36.0 32 54.0 33 93.0 34 111.0 35 208.0 36 523.0 37 2816.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.139240506329116 13.822784810126581 9.620253164556962 35.41772151898734 2 20.674999999999997 16.950000000000003 35.75 26.625 3 20.575 22.225 25.85 31.35 4 22.225 30.599999999999998 22.900000000000002 24.275 5 21.25 34.0 24.3 20.45 6 19.325 35.625 24.075 20.974999999999998 7 14.475 26.724999999999998 39.4 19.400000000000002 8 19.125 24.75 29.925 26.200000000000003 9 18.099999999999998 23.549999999999997 31.8 26.55 10-14 20.145 29.475 26.224999999999998 24.154999999999998 15-19 19.67 28.655 27.794999999999998 23.880000000000003 20-24 20.599999999999998 27.96 27.675 23.765 25-29 20.27 28.499999999999996 27.355 23.875 30-34 19.900000000000002 28.199999999999996 27.57 24.33 35-39 20.385 28.34 27.205000000000002 24.07 40-44 20.175 28.63 27.650000000000002 23.544999999999998 45-49 20.424999999999997 27.845 27.800000000000004 23.93 50-54 20.855 27.955000000000002 27.205000000000002 23.985 55-59 20.635 28.505000000000003 26.72 24.14 60-64 19.97 28.715000000000003 27.029999999999998 24.285 65-69 21.325 27.73 27.295 23.65 70-74 20.580000000000002 28.634999999999998 27.195000000000004 23.59 75-79 20.25 28.28 27.279999999999998 24.19 80-84 20.46 27.915 27.71 23.915 85-89 20.625 28.415000000000003 26.619999999999997 24.34 90-94 20.855 28.499999999999996 26.650000000000002 23.995 95-99 20.535 27.750000000000004 27.61 24.104999999999997 100-104 21.07 27.55 27.27 24.11 105-109 20.72 28.194999999999997 27.155 23.93 110-114 20.7 27.615000000000002 27.425 24.26 115-119 21.055 28.095 26.935 23.915 120-124 21.18 28.125 26.895000000000003 23.799999999999997 125-129 20.965 28.18 27.355 23.5 130-134 21.94 27.35 27.275 23.435 135-139 21.135 27.889999999999997 27.145000000000003 23.830000000000002 140-144 21.21 27.905 27.18 23.705000000000002 145-149 20.474999999999998 28.1 27.195000000000004 24.23 150-151 20.7375 27.3625 27.250000000000004 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.5 25 2.0 26 3.0 27 5.5 28 5.5 29 8.0 30 15.5 31 19.0 32 25.0 33 36.0 34 43.0 35 49.0 36 68.0 37 87.0 38 102.5 39 137.0 40 180.0 41 215.0 42 233.0 43 260.0 44 282.0 45 287.0 46 301.5 47 273.5 48 234.0 49 225.0 50 198.0 51 163.0 52 129.5 53 104.0 54 82.0 55 57.0 56 42.5 57 31.5 58 23.0 59 15.0 60 7.5 61 6.0 62 7.5 63 8.0 64 9.0 65 5.5 66 2.0 67 2.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6625 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.1875 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168957 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168957_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06675 33.0 33.0 34.0 32.0 34.0 2 33.15775 34.0 33.0 34.0 33.0 34.0 3 33.2155 34.0 33.0 34.0 33.0 34.0 4 33.186 34.0 33.0 34.0 33.0 34.0 5 33.193 34.0 33.0 34.0 33.0 34.0 6 37.35825 38.0 38.0 38.0 37.0 38.0 7 37.42325 38.0 38.0 38.0 37.0 38.0 8 37.432 38.0 38.0 38.0 38.0 38.0 9 37.4235 38.0 38.0 38.0 37.0 38.0 10-14 37.34065 38.0 38.0 38.0 37.2 38.0 15-19 37.325849999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.290800000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.2923 38.0 38.0 38.0 37.0 38.0 30-34 37.2724 38.0 38.0 38.0 37.0 38.0 35-39 37.2505 38.0 38.0 38.0 37.0 38.0 40-44 37.21745 38.0 38.0 38.0 37.0 38.0 45-49 37.2262 38.0 38.0 38.0 37.0 38.0 50-54 37.137150000000005 38.0 38.0 38.0 36.8 38.0 55-59 37.12425 38.0 38.0 38.0 37.0 38.0 60-64 37.0897 38.0 38.0 38.0 36.4 38.0 65-69 37.0058 38.0 38.0 38.0 36.0 38.0 70-74 36.947 38.0 38.0 38.0 36.0 38.0 75-79 36.90145 38.0 38.0 38.0 36.0 38.0 80-84 36.8135 38.0 38.0 38.0 35.6 38.0 85-89 36.767700000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.65625 38.0 38.0 38.0 35.0 38.0 95-99 36.597950000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.432199999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.20155 38.0 38.0 38.0 33.6 38.0 110-114 36.13245 38.0 38.0 38.0 33.2 38.0 115-119 36.01755 38.0 37.4 38.0 33.2 38.0 120-124 35.78005 38.0 37.0 38.0 32.0 38.0 125-129 35.58735 38.0 36.6 38.0 31.8 38.0 130-134 35.20545 38.0 36.0 38.0 29.4 38.0 135-139 34.714150000000004 38.0 35.4 38.0 27.2 38.0 140-144 34.548500000000004 38.0 35.0 38.0 27.2 38.0 145-149 33.8596 38.0 34.2 38.0 23.8 38.0 150-151 29.77075 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 2.0 5 2.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 2.0 15 1.0 16 1.0 17 0.0 18 2.0 19 2.0 20 7.0 21 6.0 22 6.0 23 13.0 24 11.0 25 16.0 26 22.0 27 18.0 28 28.0 29 27.0 30 34.0 31 52.0 32 64.0 33 97.0 34 119.0 35 224.0 36 563.0 37 2670.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.225 21.2 14.05 25.525 2 25.99449587190393 26.56992744558419 30.2727045283963 17.162872154115586 3 20.665499124343256 29.622216662496875 30.122591943957964 19.5896922692019 4 23.042281711283465 34.801100825619216 23.46760070052539 18.689016762571928 5 22.992244183137352 36.97773329997498 21.46609957468101 18.563922942206652 6 22.075 35.8 24.55 17.575 7 20.7 21.349999999999998 37.9 20.05 8 21.875 25.650000000000002 26.525 25.95 9 21.3 25.825 29.875 23.0 10-14 23.518527779166874 29.039355903385506 25.553833074961247 21.888283242486374 15-19 23.665382498624105 27.277730524841147 28.238354930704958 20.81853204582979 20-24 23.16079019754939 28.252063015753937 26.87671917979495 21.710427606901725 25-29 23.301650825412707 28.129064532266135 27.158579289644823 21.410705352676338 30-34 23.279655931186237 28.050610122024406 27.165433086617323 21.504300860172034 35-39 23.180431194037318 28.167675453954278 26.97713971287079 21.674753639137613 40-44 23.265816454113526 27.35683920980245 27.70692673168292 21.670417604401102 45-49 23.600900225056265 27.506876719179797 27.461865466366593 21.43035758939735 50-54 23.59117955897795 27.426371318565927 27.771388569428474 21.211060553027654 55-59 23.3485022753413 27.044056608491275 27.619142871430714 21.988298244736708 60-64 23.968388936127642 27.694693142599906 27.149502325814034 21.18741559545841 65-69 23.218126344220476 27.81473515730506 27.279547841744613 21.687590656729856 70-74 23.770696813566104 27.97758991546196 27.22225001250563 21.02946325846631 75-79 23.406703351675837 27.25862931465733 27.648824412206103 21.68584292146073 80-84 23.957187156146844 27.54326297889367 27.673301990597178 20.82624787436231 85-89 23.819763952790556 26.865373074614922 28.290658131626323 21.024204840968196 90-94 23.903585537830672 27.804170625593837 27.124068610291545 21.168175226283942 95-99 23.416170808540425 27.771388569428474 27.86639331966598 20.946047302365116 100-104 23.785 27.38 27.215 21.62 105-109 24.111205560278016 27.701385069253465 27.78138906945347 20.40602030101505 110-114 24.42 27.224999999999998 27.655 20.7 115-119 23.994597839135654 28.021208483393355 27.200880352140857 20.783313325330134 120-124 24.040626407164655 28.013208585580628 27.17766548256367 20.76849952469105 125-129 24.52839629722292 28.016012009006758 26.95021265949462 20.505379034275705 130-134 24.12603150787697 27.571892973243312 27.561890472618156 20.740185046261566 135-139 24.4748949789958 27.190438087617526 27.660532106421282 20.674134826965393 140-144 24.420989445250363 27.76749537291781 27.492371567205243 20.31914361462658 145-149 24.58360426149152 27.259540839293756 27.544640624218474 20.612214274996248 150-151 24.374687343671837 27.151075537768882 27.52626313156578 20.947973986993496 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 0.5 25 1.0 26 1.0 27 2.5 28 3.5 29 4.0 30 8.5 31 11.5 32 16.0 33 20.5 34 27.0 35 50.5 36 64.5 37 81.5 38 109.0 39 136.5 40 188.5 41 225.5 42 238.0 43 274.5 44 286.5 45 277.0 46 294.5 47 295.0 48 267.0 49 230.0 50 184.5 51 158.0 52 136.5 53 104.5 54 82.0 55 59.5 56 44.5 57 34.5 58 22.0 59 13.0 60 12.5 61 10.0 62 5.0 63 3.5 64 2.5 65 1.0 66 1.0 67 2.5 68 1.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.065 20-24 0.025 25-29 0.05 30-34 0.02 35-39 0.045 40-44 0.025 45-49 0.025 50-54 0.005 55-59 0.015 60-64 0.034999999999999996 65-69 0.034999999999999996 70-74 0.045 75-79 0.05 80-84 0.03 85-89 0.02 90-94 0.015 95-99 0.005 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.04 120-124 0.065 125-129 0.075 130-134 0.025 135-139 0.02 140-144 0.045 145-149 0.034999999999999996 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5875 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.3250000000000002 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.7000000000000002 0.0 0.0 0.0 0.0 138-139 1.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAGCC 10 0.006830828 145.0 6 >>END_MODULE Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769404 spots for SRR7168957.sra Written 769404 spots for SRR7168957.sra Read 769413 spots for SRR7168957.sra Written 769413 spots for SRR7168957.sra SRR ids: ['SRR7168957.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xhr5_l0b SRR7168957.sra spots: 15388089 blocks: [[1, 769404], [769405, 1538808], [1538809, 2308212], [2308213, 3077616], [3077617, 3847020], [3847021, 4616424], [4616425, 5385828], [5385829, 6155232], [6155233, 6924636], [6924637, 7694040], [7694041, 8463444], [8463445, 9232848], [9232849, 10002252], [10002253, 10771656], [10771657, 11541060], [11541061, 12310464], [12310465, 13079868], [13079869, 13849272], [13849273, 14618676], [14618677, 15388089]] SRR7168957 file size 5192818 SRR7168957 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168957 SRR7168957_1.fastq SRR7168957_2.fastq Input file: SRR7168957_1.fastq Paired file: SRR7168957_2.fastq trimmed: SRR7168957-trimmed-pair1.fastq, SRR7168957-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:30:09 2025 >> started Mon Feb 10 12:30:25 2025 >> done (15.794s) 15388089 read pairs processed; of these: 17303 ( 0.11%) short read pairs filtered out after trimming by size control 12461 ( 0.08%) empty read pairs filtered out after trimming by size control 15358325 (99.81%) read pairs available; of these: 6279423 (40.89%) trimmed read pairs available after processing 9078902 (59.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 10 0.00% 20 2 0.00% 21 8 0.00% 22 3 0.00% 23 9 0.00% 24 5 0.00% 25 8 0.00% 26 6 0.00% 27 0 0.00% 28 5 0.00% 29 4 0.00% 30 8 0.00% 31 5 0.00% 32 4 0.00% 33 7 0.00% 34 9 0.00% 35 6 0.00% 36 7 0.00% 37 8 0.00% 38 8 0.00% 39 6 0.00% 40 10 0.00% 41 9 0.00% 42 5 0.00% 43 7 0.00% 44 6 0.00% 45 5 0.00% 46 8 0.00% 47 14 0.00% 48 7 0.00% 49 15 0.00% 50 16 0.00% 51 13 0.00% 52 15 0.00% 53 22 0.00% 54 31 0.00% 55 23 0.00% 56 30 0.00% 57 34 0.00% 58 30 0.00% 59 38 0.00% 60 59 0.00% 61 40 0.00% 62 56 0.00% 63 48 0.00% 64 76 0.00% 65 70 0.00% 66 85 0.00% 67 122 0.00% 68 137 0.00% 69 170 0.00% 70 187 0.00% 71 191 0.00% 72 182 0.00% 73 248 0.00% 74 255 0.00% 75 260 0.00% 76 325 0.00% 77 344 0.00% 78 403 0.00% 79 408 0.00% 80 491 0.00% 81 589 0.00% 82 660 0.00% 83 780 0.01% 84 1490 0.01% 85 2019 0.01% 86 2083 0.01% 87 2073 0.01% 88 2246 0.01% 89 2310 0.02% 90 2517 0.02% 91 2508 0.02% 92 2763 0.02% 93 2929 0.02% 94 3188 0.02% 95 3254 0.02% 96 3580 0.02% 97 3596 0.02% 98 3884 0.03% 99 4154 0.03% 100 4439 0.03% 101 4749 0.03% 102 5125 0.03% 103 5403 0.04% 104 5870 0.04% 105 6246 0.04% 106 6591 0.04% 107 7120 0.05% 108 7480 0.05% 109 7916 0.05% 110 8322 0.05% 111 9046 0.06% 112 9685 0.06% 113 10582 0.07% 114 11004 0.07% 115 11856 0.08% 116 12724 0.08% 117 13667 0.09% 118 14079 0.09% 119 14764 0.10% 120 15723 0.10% 121 16611 0.11% 122 17566 0.11% 123 18801 0.12% 124 20237 0.13% 125 22024 0.14% 126 23211 0.15% 127 24940 0.16% 128 26275 0.17% 129 27780 0.18% 130 29897 0.19% 131 31894 0.21% 132 34045 0.22% 133 37243 0.24% 134 39606 0.26% 135 43668 0.28% 136 47632 0.31% 137 51195 0.33% 138 55616 0.36% 139 59977 0.39% 140 65651 0.43% 141 73392 0.48% 142 82609 0.54% 143 94699 0.62% 144 111415 0.73% 145 134756 0.88% 146 166431 1.08% 147 227198 1.48% 148 342261 2.23% 149 680916 4.43% 150 3428237 22.32% 151 9078902 59.11% 15358325 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=40 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=383.32 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=18.7 sequence=TGCTTTCTTTTCCGTTACATAAGTCTTTACTGTTTGAAGCATAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.24 fanout-score-rank=21 prefix-density=0.33 prefix-fanout=3.8 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.17 sequence-density-rank=5 fanout-score=38.75 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=11.2 sequence=TGTTGGTGGTGG SRR7168957 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:31:11 Started mapping on | Feb 10 12:31:11 Finished on | Feb 10 12:32:43 Mapping speed, Million of reads per hour | 600.98 Number of input reads | 15358325 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14482087 Uniquely mapped reads % | 94.29% Average mapped length | 297.05 Number of splices: Total | 13737179 Number of splices: Annotated (sjdb) | 13531214 Number of splices: GT/AG | 13547015 Number of splices: GC/AG | 153841 Number of splices: AT/AC | 10139 Number of splices: Non-canonical | 26184 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249903 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 35352 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.81% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 640849 640849 640849 N_multimapping 249903 249903 249903 N_noFeature 269117 14322681 328674 N_ambiguous 160219 1008 59592 UnstrandedReadsAssigned:14052751 PositiveStrandReadsAssigned:158398 NegativeStrandReadsAssigned:14093821 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168957 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168957-trimmed-pair1.fastq SRR7168957-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,358,325 reads, 14,013,535 reads pseudoaligned [quant] estimated average fragment length: 263.312 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,281 rounds 52401 SRR7168957.ke.tsv 34699 SRR7168957.se.tsv 87100 total ==> SRR7168957.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.69 218 8.93698 Potri.005G024800.1.v4.1 1035 772.688 23 2.14242 Potri.004G059700.1.v4.1 961 698.708 3 0.309034 Potri.007G009000.2.v4.1 1416 1153.69 0 0 Potri.003G141000.2.v4.1 2943 2680.69 267.062 7.17045 Potri.016G087400.1.v4.1 270 66.3852 883.513 957.907 Potri.015G069301.1.v4.1 564 307.617 0 0 Potri.010G195200.1.v4.1 1773 1510.69 28 1.33403 Potri.012G127500.1.v4.1 977 714.702 4440 447.136 ==> SRR7168957.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1771 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168957 completed mapping pipeline successfully