Starting /dee2/code/volunteer_pipeline.sh SRR7168958 current disk space = 3058666721280 free memory = 1544246208 SRR7168958 SRAfilesize 0485d00b48f01e8ef142c09625b5a648 SRR7168958.sra SRR7168958.sra file validated SRR7168958 is paired end SRR7168958 is conventional basespace SRR7168958 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168958_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93025 34.0 33.0 34.0 32.0 34.0 2 33.13625 34.0 33.0 34.0 32.0 34.0 3 33.11925 34.0 33.0 34.0 32.0 34.0 4 32.96825 34.0 33.0 34.0 32.0 34.0 5 32.796 34.0 33.0 34.0 32.0 34.0 6 36.72075 38.0 37.0 38.0 34.0 38.0 7 37.08075 38.0 38.0 38.0 36.0 38.0 8 37.235 38.0 38.0 38.0 36.0 38.0 9 37.35525 38.0 38.0 38.0 37.0 38.0 10-14 37.3701 38.0 38.0 38.0 37.0 38.0 15-19 37.25235 38.0 38.0 38.0 36.8 38.0 20-24 37.19295 38.0 38.0 38.0 36.0 38.0 25-29 37.01625 38.0 38.0 38.0 36.0 38.0 30-34 36.942299999999996 38.0 38.0 38.0 35.6 38.0 35-39 36.881150000000005 38.0 38.0 38.0 35.4 38.0 40-44 36.63705 38.0 38.0 38.0 34.2 38.0 45-49 36.74905 38.0 38.0 38.0 34.4 38.0 50-54 36.752250000000004 38.0 38.0 38.0 34.6 38.0 55-59 36.457550000000005 38.0 38.0 38.0 34.0 38.0 60-64 36.50625 38.0 38.0 38.0 34.0 38.0 65-69 36.481849999999994 38.0 37.8 38.0 34.0 38.0 70-74 36.42185 38.0 37.6 38.0 34.0 38.0 75-79 36.18915 38.0 37.0 38.0 33.0 38.0 80-84 36.1016 38.0 37.0 38.0 32.6 38.0 85-89 35.6353 38.0 36.8 38.0 30.0 38.0 90-94 35.41445 38.0 36.2 38.0 29.0 38.0 95-99 35.6665 38.0 36.6 38.0 30.4 38.0 100-104 35.149950000000004 38.0 35.8 38.0 28.4 38.0 105-109 35.4216 38.0 36.0 38.0 29.8 38.0 110-114 35.02915 38.0 35.4 38.0 27.8 38.0 115-119 34.76365 38.0 35.0 38.0 26.8 38.0 120-124 34.512 38.0 34.8 38.0 25.2 38.0 125-129 33.5033 38.0 33.6 38.0 18.2 38.0 130-134 33.58385 38.0 34.0 38.0 20.6 38.0 135-139 32.8745 37.4 32.6 38.0 18.4 38.0 140-144 32.95365 38.0 33.2 38.0 19.4 38.0 145-149 31.299500000000002 36.6 31.0 38.0 10.8 38.0 150-151 26.3545 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 3.0 19 2.0 20 9.0 21 8.0 22 14.0 23 20.0 24 17.0 25 17.0 26 40.0 27 43.0 28 42.0 29 60.0 30 73.0 31 91.0 32 129.0 33 191.0 34 280.0 35 438.0 36 916.0 37 1600.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.675000000000004 14.325 8.725 33.275 2 22.125 15.6 32.800000000000004 29.475 3 19.7 20.325 25.75 34.225 4 20.95 27.400000000000002 25.0 26.650000000000002 5 20.604534005037785 31.863979848866496 24.307304785894207 23.224181360201513 6 20.45 34.050000000000004 25.324999999999996 20.175 7 15.4 27.3 39.7 17.599999999999998 8 17.075000000000003 28.000000000000004 30.3 24.625 9 18.525 26.125 31.374999999999996 23.974999999999998 10-14 19.75 30.064999999999998 26.889999999999997 23.294999999999998 15-19 20.03 29.45 26.855 23.665 20-24 20.415 28.535 27.55 23.5 25-29 20.080000000000002 28.865000000000002 27.115000000000002 23.94 30-34 19.885 29.45 26.845000000000002 23.82 35-39 20.119999999999997 29.060000000000002 26.584999999999997 24.235 40-44 20.195 28.82 27.425 23.56 45-49 20.61 28.4 27.255000000000003 23.735 50-54 19.895 29.2 27.02 23.885 55-59 20.26107832349705 28.698609582874862 27.17815344603381 23.862158647594278 60-64 20.385 28.955 27.175 23.485 65-69 20.66 28.599999999999998 26.83 23.91 70-74 19.744999999999997 28.96 27.07 24.224999999999998 75-79 20.497174010903816 28.775071274946228 26.75936577802231 23.968388936127642 80-84 20.43112933880164 28.3184955486646 26.903070921276385 24.347304191257376 85-89 20.164155948150743 28.24182973825134 27.391021470396876 24.20299284320104 90-94 20.33625289439243 28.48585523004128 27.32809825833082 23.84979361723548 95-99 20.49 28.46 27.33 23.72 100-104 20.44 27.665 27.76 24.135 105-109 20.558312033278202 28.54207387360297 26.727810354332682 24.171803738786146 110-114 20.794999999999998 27.834999999999997 27.089999999999996 24.279999999999998 115-119 20.674999999999997 28.01 27.639999999999997 23.674999999999997 120-124 20.9 27.965 27.245 23.89 125-129 20.505000000000003 28.305000000000003 27.21 23.98 130-134 21.039207841568313 27.885577115423082 26.920384076815363 24.154830966193238 135-139 21.785 27.750000000000004 26.735 23.73 140-144 21.14 27.85 26.979999999999997 24.03 145-149 21.06058316966309 28.04048949992446 26.937603867653724 23.961323462758724 150-151 21.711925916656238 26.99286697534727 26.304592666750093 24.990614441246404 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 2.5 25 2.5 26 3.5 27 6.5 28 9.0 29 11.5 30 20.0 31 30.5 32 35.5 33 43.0 34 53.0 35 64.5 36 79.0 37 107.5 38 133.0 39 156.5 40 185.5 41 221.5 42 244.0 43 248.0 44 251.0 45 249.5 46 252.5 47 246.0 48 228.0 49 210.0 50 180.0 51 149.5 52 118.5 53 101.5 54 89.5 55 64.5 56 48.0 57 37.0 58 32.0 59 24.0 60 15.0 61 8.0 62 6.0 63 4.5 64 3.0 65 3.0 66 3.0 67 2.5 68 2.0 69 2.5 70 3.0 71 2.5 72 1.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.75 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.03 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.034999999999999996 80-84 0.03 85-89 0.095 90-94 0.67 95-99 0.0 100-104 0.0 105-109 0.23500000000000001 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.0 140-144 0.0 145-149 0.715 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.8624999999999998 0.0 0.0 0.0 0.0 130-131 1.925 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168958 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168958_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.518 33.0 33.0 34.0 32.0 34.0 2 32.61275 34.0 33.0 34.0 32.0 34.0 3 32.56475 34.0 33.0 34.0 32.0 34.0 4 32.38 34.0 33.0 34.0 32.0 34.0 5 32.48825 34.0 33.0 34.0 32.0 34.0 6 36.54025 38.0 38.0 38.0 34.0 38.0 7 36.56925 38.0 38.0 38.0 35.0 38.0 8 36.155 38.0 38.0 38.0 34.0 38.0 9 36.3235 38.0 38.0 38.0 34.0 38.0 10-14 36.33794999999999 38.0 38.0 38.0 34.2 38.0 15-19 36.2745 38.0 38.0 38.0 34.6 38.0 20-24 36.5152 38.0 38.0 38.0 35.2 38.0 25-29 36.5477 38.0 38.0 38.0 35.4 38.0 30-34 36.35935 38.0 38.0 38.0 34.6 38.0 35-39 36.427099999999996 38.0 38.0 38.0 35.2 38.0 40-44 36.46985 38.0 38.0 38.0 35.0 38.0 45-49 36.37370000000001 38.0 38.0 38.0 34.8 38.0 50-54 36.173899999999996 38.0 38.0 38.0 34.0 38.0 55-59 35.6915 38.0 38.0 38.0 31.4 38.0 60-64 35.6303 38.0 38.0 38.0 31.0 38.0 65-69 35.6748 38.0 38.0 38.0 32.0 38.0 70-74 36.01585 38.0 38.0 38.0 33.6 38.0 75-79 35.8871 38.0 38.0 38.0 32.8 38.0 80-84 35.8541 38.0 38.0 38.0 32.6 38.0 85-89 35.8422 38.0 38.0 38.0 32.2 38.0 90-94 35.8765 38.0 38.0 38.0 33.0 38.0 95-99 35.6522 38.0 37.4 38.0 31.4 38.0 100-104 35.52195 38.0 37.4 38.0 30.8 38.0 105-109 35.05050000000001 38.0 37.0 38.0 28.2 38.0 110-114 34.947 38.0 37.0 38.0 27.8 38.0 115-119 34.828050000000005 38.0 36.6 38.0 27.2 38.0 120-124 34.82985 38.0 36.0 38.0 27.4 38.0 125-129 34.53285 38.0 36.0 38.0 25.0 38.0 130-134 34.439800000000005 38.0 35.6 38.0 25.0 38.0 135-139 34.1106 38.0 35.0 38.0 23.0 38.0 140-144 33.36675 38.0 34.4 38.0 18.4 38.0 145-149 32.07385000000001 38.0 33.4 38.0 11.0 38.0 150-151 28.271250000000002 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 4.0 4 0.0 5 5.0 6 4.0 7 6.0 8 1.0 9 6.0 10 1.0 11 3.0 12 1.0 13 3.0 14 6.0 15 5.0 16 8.0 17 6.0 18 5.0 19 12.0 20 11.0 21 13.0 22 11.0 23 21.0 24 21.0 25 31.0 26 32.0 27 39.0 28 25.0 29 55.0 30 54.0 31 72.0 32 74.0 33 140.0 34 157.0 35 253.0 36 504.0 37 2381.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.94406651549509 22.121441169060216 13.328294280675232 26.606198034769463 2 28.471177944862152 25.6140350877193 28.54636591478697 17.36842105263158 3 19.257950530035338 30.590610802624933 30.9439676930843 19.20747097425543 4 25.177304964539005 32.700101317122595 22.69503546099291 19.427558257345492 5 25.64423317488116 35.126344758568926 22.166624968726545 17.062797097823367 6 21.73043260815204 36.55913978494624 23.10577644411103 18.6046511627907 7 20.85427135678392 21.809045226130653 37.336683417085425 20.0 8 23.10615657461363 26.57714720040537 25.158348112490497 25.158348112490497 9 21.20070334086913 26.601356443104745 30.01758352172821 22.180356694297913 10-14 23.738035264483628 28.95214105793451 25.58690176322418 21.72292191435768 15-19 23.944657644920216 27.78731569379923 27.38840638254898 20.87962027873157 20-24 23.86746442757303 27.899844134948964 27.341746694152548 20.890944743325456 25-29 24.381324516581504 27.66255886183749 26.695721871555953 21.260394750025046 30-34 24.15490481691697 27.650811190918677 27.17364006228339 21.020643929880958 35-39 23.468463937229657 27.82416255909868 27.079770646816215 21.627602856855447 40-44 23.622955753988162 27.907093408247214 27.280024079462223 21.1899267583024 45-49 23.89309532166675 27.75409918267061 27.202527202527204 21.150278293135436 50-54 23.7925315374177 28.01929939186812 27.2402874805247 20.947881590189475 55-59 24.210526315789473 28.100686498855836 27.124332570556824 20.564454614797864 60-64 24.13582446673115 27.755434505930864 27.633253576337623 20.475487451000358 65-69 24.01793447801498 27.446884393947112 27.615020125337548 20.92016100270036 70-74 23.918959782280012 27.552666061888925 27.40147162584417 21.126902529986896 75-79 24.491444147190954 27.767401948412495 27.16167785573671 20.579476048659835 80-84 24.17943660547211 27.982602538815556 26.99135184342285 20.846609012289484 85-89 24.112056028014006 27.49374687343672 27.428714357178592 20.965482741370685 90-94 24.22316737553165 27.430572929697274 27.585689266950215 20.760570427820866 95-99 23.75194420751593 28.11198635291757 27.59018614219056 20.545883297375948 100-104 24.372200694479393 27.250767450052845 28.025766191938 20.351265663529766 105-109 24.22203106815767 27.349086677123918 27.450285887770075 20.978596366948338 110-114 23.60870892257605 27.703733848814732 27.56638518669244 21.12117204191678 115-119 24.411883999188806 27.758061245183534 27.398093692962888 20.431961062664776 120-124 24.374249098918703 27.60812975570685 27.187625150180217 20.829995995194235 125-129 24.086786591171016 27.664478629052464 27.584306258455683 20.66442852132084 130-134 24.8132738483132 27.424933580630608 27.429946363226225 20.33184620782997 135-139 24.207362885048838 27.302779864763338 27.563235662409213 20.926621587778612 140-144 24.483553951062976 27.51704773365423 27.76774969915764 20.23164861612515 145-149 24.899457068168108 27.629197667403982 26.804745626382463 20.666599638045447 150-151 24.219239934779882 26.79041765960115 28.17007399974915 20.82026840586981 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 2.0 17 2.0 18 1.0 19 1.0 20 2.0 21 2.0 22 1.5 23 2.5 24 4.5 25 6.0 26 7.5 27 6.5 28 5.0 29 7.5 30 8.5 31 10.0 32 19.5 33 25.0 34 27.5 35 34.0 36 59.0 37 96.5 38 125.0 39 148.5 40 188.5 41 229.5 42 238.5 43 258.5 44 302.0 45 305.5 46 285.0 47 259.5 48 227.5 49 202.5 50 170.0 51 144.0 52 127.5 53 117.5 54 100.0 55 62.5 56 39.5 57 33.5 58 23.0 59 17.5 60 12.0 61 8.0 62 8.5 63 9.0 64 8.5 65 6.0 66 3.0 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.25 3 0.95 4 1.3 5 0.075 6 0.025 7 0.5 8 1.325 9 0.475 10-14 0.75 15-19 0.98 20-24 0.555 25-29 0.19 30-34 0.455 35-39 0.59 40-44 0.33 45-49 0.28500000000000003 50-54 0.515 55-59 1.675 60-64 1.7850000000000001 65-69 1.865 70-74 0.79 75-79 0.9450000000000001 80-84 1.135 85-89 0.05 90-94 0.075 95-99 0.345 100-104 0.645 105-109 1.185 110-114 1.71 115-119 1.38 120-124 0.12 125-129 0.215 130-134 0.255 135-139 0.17500000000000002 140-144 0.27999999999999997 145-149 0.54 150-151 0.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.5875 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.525 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGGGAA 10 0.0072029857 142.45 145 >>END_MODULE Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832086 spots for SRR7168958.sra Written 832086 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra Read 832070 spots for SRR7168958.sra Written 832070 spots for SRR7168958.sra SRR ids: ['SRR7168958.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__p6itfmj SRR7168958.sra spots: 16641416 blocks: [[1, 832070], [832071, 1664140], [1664141, 2496210], [2496211, 3328280], [3328281, 4160350], [4160351, 4992420], [4992421, 5824490], [5824491, 6656560], [6656561, 7488630], [7488631, 8320700], [8320701, 9152770], [9152771, 9984840], [9984841, 10816910], [10816911, 11648980], [11648981, 12481050], [12481051, 13313120], [13313121, 14145190], [14145191, 14977260], [14977261, 15809330], [15809331, 16641416]] SRR7168958 file size 5617529 SRR7168958 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168958 SRR7168958_1.fastq SRR7168958_2.fastq Input file: SRR7168958_1.fastq Paired file: SRR7168958_2.fastq trimmed: SRR7168958-trimmed-pair1.fastq, SRR7168958-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:35:40 2025 >> started Mon Feb 10 12:36:01 2025 >> done (20.869s) 16641416 read pairs processed; of these: 28792 ( 0.17%) short read pairs filtered out after trimming by size control 33478 ( 0.20%) empty read pairs filtered out after trimming by size control 16579146 (99.63%) read pairs available; of these: 7683144 (46.34%) trimmed read pairs available after processing 8896002 (53.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 7 0.00% 21 4 0.00% 22 11 0.00% 23 5 0.00% 24 2 0.00% 25 5 0.00% 26 12 0.00% 27 8 0.00% 28 4 0.00% 29 9 0.00% 30 10 0.00% 31 12 0.00% 32 9 0.00% 33 8 0.00% 34 7 0.00% 35 7 0.00% 36 7 0.00% 37 7 0.00% 38 15 0.00% 39 7 0.00% 40 9 0.00% 41 10 0.00% 42 18 0.00% 43 7 0.00% 44 14 0.00% 45 18 0.00% 46 17 0.00% 47 14 0.00% 48 27 0.00% 49 25 0.00% 50 24 0.00% 51 32 0.00% 52 35 0.00% 53 32 0.00% 54 33 0.00% 55 51 0.00% 56 40 0.00% 57 54 0.00% 58 61 0.00% 59 65 0.00% 60 78 0.00% 61 83 0.00% 62 100 0.00% 63 103 0.00% 64 99 0.00% 65 145 0.00% 66 137 0.00% 67 198 0.00% 68 204 0.00% 69 201 0.00% 70 262 0.00% 71 289 0.00% 72 364 0.00% 73 407 0.00% 74 457 0.00% 75 470 0.00% 76 558 0.00% 77 624 0.00% 78 693 0.00% 79 810 0.00% 80 934 0.01% 81 1019 0.01% 82 1213 0.01% 83 1548 0.01% 84 2803 0.02% 85 3290 0.02% 86 3260 0.02% 87 3455 0.02% 88 3720 0.02% 89 3716 0.02% 90 3870 0.02% 91 4060 0.02% 92 4302 0.03% 93 4745 0.03% 94 4767 0.03% 95 5108 0.03% 96 5616 0.03% 97 5842 0.04% 98 6243 0.04% 99 6327 0.04% 100 6786 0.04% 101 7291 0.04% 102 7767 0.05% 103 8020 0.05% 104 9030 0.05% 105 9690 0.06% 106 10525 0.06% 107 10736 0.06% 108 11282 0.07% 109 12246 0.07% 110 12711 0.08% 111 13071 0.08% 112 14159 0.09% 113 14875 0.09% 114 15919 0.10% 115 17042 0.10% 116 17913 0.11% 117 18663 0.11% 118 19584 0.12% 119 20362 0.12% 120 21184 0.13% 121 22497 0.14% 122 23795 0.14% 123 25179 0.15% 124 27047 0.16% 125 28902 0.17% 126 30535 0.18% 127 32597 0.20% 128 33701 0.20% 129 35963 0.22% 130 38343 0.23% 131 40757 0.25% 132 43451 0.26% 133 46666 0.28% 134 50772 0.31% 135 54602 0.33% 136 58696 0.35% 137 63245 0.38% 138 68684 0.41% 139 75633 0.46% 140 82798 0.50% 141 91601 0.55% 142 103967 0.63% 143 119305 0.72% 144 141917 0.86% 145 173241 1.04% 146 218599 1.32% 147 298344 1.80% 148 449618 2.71% 149 847294 5.11% 150 3993670 24.09% 151 8896002 53.66% 16579146 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.0 sequence=GTTTATAAGGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=292.61 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=18.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.83 fanout-score-rank=23 prefix-density=0.27 prefix-fanout=3.6 sequence=TGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=151.38 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7168958 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:36:46 Started mapping on | Feb 10 12:36:46 Finished on | Feb 10 12:38:56 Mapping speed, Million of reads per hour | 459.11 Number of input reads | 16579146 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15400313 Uniquely mapped reads % | 92.89% Average mapped length | 295.92 Number of splices: Total | 14052407 Number of splices: Annotated (sjdb) | 13827849 Number of splices: GT/AG | 13850389 Number of splices: GC/AG | 160497 Number of splices: AT/AC | 12910 Number of splices: Non-canonical | 28611 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296307 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 68189 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.84% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 906829 906829 906829 N_multimapping 296307 296307 296307 N_noFeature 307405 15230133 376979 N_ambiguous 165085 1434 63306 UnstrandedReadsAssigned:14927823 PositiveStrandReadsAssigned:168746 NegativeStrandReadsAssigned:14960028 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168958 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168958-trimmed-pair1.fastq SRR7168958-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,579,146 reads, 14,946,406 reads pseudoaligned [quant] estimated average fragment length: 248.683 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7168958.ke.tsv 34699 SRR7168958.se.tsv 87100 total ==> SRR7168958.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.32 347 10.9621 Potri.005G024800.1.v4.1 1035 787.317 37 2.62825 Potri.004G059700.1.v4.1 961 713.344 5 0.391999 Potri.007G009000.2.v4.1 1416 1168.32 0 0 Potri.003G141000.2.v4.1 2943 2695.32 249 5.16659 Potri.016G087400.1.v4.1 270 70.5626 1665 1319.64 Potri.015G069301.1.v4.1 564 319.763 0 0 Potri.010G195200.1.v4.1 1773 1525.32 30 1.09996 Potri.012G127500.1.v4.1 977 729.334 13065 1001.84 ==> SRR7168958.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1655 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168958 completed mapping pipeline successfully