Starting /dee2/code/volunteer_pipeline.sh SRR7168959 current disk space = 3058674114560 free memory = 1185099492 SRR7168959 SRAfilesize 4387d43bd3b688c24481c6a6295e903d SRR7168959.sra SRR7168959.sra file validated SRR7168959 is paired end SRR7168959 is conventional basespace SRR7168959 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168959_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85025 34.0 33.0 34.0 32.0 34.0 2 32.987 34.0 33.0 34.0 32.0 34.0 3 33.06625 34.0 33.0 34.0 32.0 34.0 4 32.8815 34.0 33.0 34.0 32.0 34.0 5 32.5945 34.0 33.0 34.0 32.0 34.0 6 36.54075 38.0 37.0 38.0 34.0 38.0 7 36.87875 38.0 38.0 38.0 35.0 38.0 8 37.0995 38.0 38.0 38.0 36.0 38.0 9 37.29475 38.0 38.0 38.0 36.0 38.0 10-14 37.2792 38.0 38.0 38.0 36.8 38.0 15-19 37.15365 38.0 38.0 38.0 36.0 38.0 20-24 37.06505000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.916399999999996 38.0 38.0 38.0 35.4 38.0 30-34 36.84035 38.0 38.0 38.0 34.8 38.0 35-39 36.662850000000006 38.0 38.0 38.0 34.4 38.0 40-44 36.35485 38.0 37.8 38.0 33.4 38.0 45-49 36.53000000000001 38.0 38.0 38.0 34.0 38.0 50-54 36.4962 38.0 37.8 38.0 33.8 38.0 55-59 36.172799999999995 38.0 37.0 38.0 33.0 38.0 60-64 36.28715 38.0 37.0 38.0 33.2 38.0 65-69 36.2303 38.0 37.0 38.0 33.0 38.0 70-74 36.18455 38.0 37.0 38.0 33.2 38.0 75-79 35.929899999999996 38.0 36.8 38.0 32.4 38.0 80-84 35.74595 38.0 37.0 38.0 30.6 38.0 85-89 35.184200000000004 38.0 35.8 38.0 28.0 38.0 90-94 34.9229 38.0 35.8 38.0 27.8 38.0 95-99 35.222500000000004 38.0 36.0 38.0 28.4 38.0 100-104 34.5715 38.0 34.8 38.0 25.6 38.0 105-109 34.81195 38.0 35.0 38.0 26.8 38.0 110-114 34.2274 38.0 34.2 38.0 23.8 38.0 115-119 33.757850000000005 38.0 34.0 38.0 19.8 38.0 120-124 33.7033 38.0 34.0 38.0 21.0 38.0 125-129 32.27905 36.4 31.2 38.0 15.0 38.0 130-134 32.21925 36.2 31.4 38.0 15.0 38.0 135-139 31.334600000000002 35.6 28.8 38.0 14.6 38.0 140-144 31.3029 36.0 31.0 38.0 13.2 38.0 145-149 29.1844 34.2 26.0 38.0 4.2 38.0 150-151 23.783250000000002 29.5 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 1.0 11 0.0 12 3.0 13 4.0 14 2.0 15 1.0 16 2.0 17 3.0 18 2.0 19 7.0 20 8.0 21 8.0 22 17.0 23 16.0 24 20.0 25 32.0 26 35.0 27 47.0 28 65.0 29 87.0 30 112.0 31 133.0 32 162.0 33 236.0 34 322.0 35 549.0 36 1025.0 37 1099.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.375 11.875 8.924999999999999 39.825 2 20.45 17.45 36.275 25.825 3 18.85 22.025 26.075 33.050000000000004 4 21.725 29.599999999999998 24.25 24.425 5 22.516389309127586 33.13161875945537 24.00403429147756 20.347957639939484 6 19.25 35.199999999999996 25.674999999999997 19.875 7 15.174999999999999 27.175 39.050000000000004 18.6 8 18.45 25.95 31.05 24.55 9 17.474999999999998 24.2 33.7 24.625 10-14 20.135 29.26 26.950000000000003 23.655 15-19 19.64 28.58 27.689999999999998 24.09 20-24 19.384999999999998 29.65 26.605 24.36 25-29 20.345 29.455 26.44 23.76 30-34 20.11 28.955 26.955000000000002 23.98 35-39 20.369999999999997 28.860000000000003 26.729999999999997 24.04 40-44 20.205000000000002 29.025000000000002 27.67 23.1 45-49 19.805 28.96 27.495000000000005 23.74 50-54 19.495 28.694999999999997 27.54 24.27 55-59 20.82561921441081 28.42131598699024 26.720040030022517 24.033024768576432 60-64 19.685 28.075 27.355 24.884999999999998 65-69 20.695 28.21 27.405 23.69 70-74 20.715 28.725 27.235 23.325000000000003 75-79 20.153137824041636 27.719947953157842 28.115303773396054 24.011610449404465 80-84 20.507431316619126 28.579292398538758 26.582595205925035 24.33068107891708 85-89 20.418795711852518 28.308786694719966 27.34695922252279 23.92545837090472 90-94 20.15237903022352 28.7400978858671 26.83788283969928 24.269640244210102 95-99 20.605 28.410000000000004 27.029999999999998 23.955000000000002 100-104 20.22 28.57 27.694999999999997 23.515 105-109 20.8074222668004 28.084252758274825 27.442326980942827 23.665997993981946 110-114 20.24 28.21 27.37 24.18 115-119 20.810000000000002 28.455000000000002 27.11 23.625 120-124 20.345 28.860000000000003 27.16 23.635 125-129 21.15 28.255000000000003 26.915 23.68 130-134 21.21773063838303 28.146888132879727 27.22633580148089 23.409045427256352 135-139 20.615 28.360000000000003 26.834999999999997 24.19 140-144 20.96 28.494999999999997 26.455000000000002 24.09 145-149 20.870749672081526 28.473413379073758 26.81868630814247 23.83715064070225 150-151 20.787992495309567 28.2801751094434 26.691682301438398 24.24015009380863 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 3.0 25 4.5 26 5.0 27 8.5 28 13.0 29 15.5 30 14.0 31 19.0 32 29.0 33 34.5 34 49.0 35 60.5 36 78.0 37 103.0 38 127.0 39 160.0 40 178.5 41 212.5 42 240.5 43 240.0 44 260.5 45 273.0 46 273.5 47 263.0 48 248.0 49 225.0 50 173.0 51 137.5 52 118.0 53 102.0 54 86.0 55 60.5 56 44.0 57 33.5 58 22.5 59 21.0 60 20.0 61 11.0 62 5.5 63 3.5 64 1.5 65 2.0 66 2.5 67 2.5 68 1.5 69 1.5 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.8500000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.075 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.09 80-84 0.08499999999999999 85-89 0.19 90-94 0.905 95-99 0.0 100-104 0.0 105-109 0.3 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.06 135-139 0.0 140-144 0.0 145-149 0.89 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.7250000000000001 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.4125 0.0 0.0 0.0 0.0 134-135 1.5875 0.0 0.0 0.0 0.0 136-137 1.8125 0.0 0.0 0.0 0.0 138-139 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGTAC 10 0.0068573058 144.8125 5 >>END_MODULE SRR7168959 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168959_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.274 33.0 33.0 34.0 32.0 34.0 2 32.447 33.0 33.0 34.0 32.0 34.0 3 32.3225 34.0 33.0 34.0 31.0 34.0 4 32.02075 34.0 33.0 34.0 31.0 34.0 5 32.20375 34.0 33.0 34.0 31.0 34.0 6 36.2 38.0 38.0 38.0 33.0 38.0 7 36.36075 38.0 38.0 38.0 34.0 38.0 8 35.74325 38.0 38.0 38.0 33.0 38.0 9 36.0985 38.0 38.0 38.0 33.0 38.0 10-14 36.0007 38.0 38.0 38.0 32.6 38.0 15-19 35.85645 38.0 38.0 38.0 32.0 38.0 20-24 36.22175 38.0 38.0 38.0 34.0 38.0 25-29 36.1237 38.0 38.0 38.0 33.8 38.0 30-34 36.050850000000004 38.0 38.0 38.0 33.6 38.0 35-39 36.10015 38.0 38.0 38.0 34.2 38.0 40-44 36.176300000000005 38.0 38.0 38.0 34.0 38.0 45-49 36.0822 38.0 38.0 38.0 33.8 38.0 50-54 35.799249999999994 38.0 38.0 38.0 32.2 38.0 55-59 35.082 38.0 37.2 38.0 28.4 38.0 60-64 35.05205 38.0 37.2 38.0 28.0 38.0 65-69 35.109950000000005 38.0 37.8 38.0 28.2 38.0 70-74 35.59355 38.0 37.8 38.0 30.6 38.0 75-79 35.3006 38.0 37.0 38.0 28.4 38.0 80-84 35.3492 38.0 37.6 38.0 29.6 38.0 85-89 35.3696 38.0 37.2 38.0 29.6 38.0 90-94 35.521100000000004 38.0 38.0 38.0 31.0 38.0 95-99 35.198150000000005 38.0 37.2 38.0 29.0 38.0 100-104 35.01425 38.0 36.8 38.0 27.6 38.0 105-109 34.5326 38.0 36.0 38.0 24.8 38.0 110-114 34.3183 38.0 36.0 38.0 23.6 38.0 115-119 34.21255 38.0 36.0 38.0 23.2 38.0 120-124 34.30895 38.0 35.6 38.0 23.6 38.0 125-129 34.036500000000004 38.0 35.0 38.0 22.6 38.0 130-134 33.84705 38.0 35.0 38.0 22.2 38.0 135-139 33.464600000000004 38.0 34.8 38.0 18.4 38.0 140-144 32.41525 38.0 33.6 38.0 13.6 38.0 145-149 31.069200000000002 38.0 31.2 38.0 6.4 38.0 150-151 27.20225 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 40.0 3 5.0 4 4.0 5 5.0 6 3.0 7 5.0 8 6.0 9 2.0 10 1.0 11 3.0 12 5.0 13 2.0 14 4.0 15 2.0 16 5.0 17 10.0 18 16.0 19 13.0 20 16.0 21 14.0 22 22.0 23 23.0 24 22.0 25 35.0 26 37.0 27 50.0 28 51.0 29 40.0 30 93.0 31 85.0 32 108.0 33 136.0 34 163.0 35 254.0 36 536.0 37 2184.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.035353535353536 21.515151515151516 14.570707070707071 27.878787878787882 2 27.334337349397593 25.65261044176707 30.622489959839356 16.390562248995984 3 20.17721518987342 29.11392405063291 30.658227848101266 20.050632911392405 4 22.941626306398163 33.877134845781285 24.24165179709406 18.939587050726484 5 24.2728184553661 36.033099297893685 21.81544633901705 17.87863590772317 6 19.739478957915832 37.70040080160321 24.09819639278557 18.46192384769539 7 20.48374905517763 22.39858906525573 38.196019148400104 18.92164273116654 8 21.193573068094874 24.611068604947718 27.799030859474623 26.396327467482784 9 21.61957618567104 25.126135216952573 29.969727547931384 23.284561049445003 10-14 23.076923076923077 28.43930051551602 26.907914687152534 21.57586172040837 15-19 23.446771821270985 28.036719582086523 27.83384896282396 20.68265963381853 20-24 22.781363453005245 28.222065348931018 28.075837031060914 20.920734167002824 25-29 23.300386332848326 28.08188249460639 27.449701470071748 21.168029702473532 30-34 23.311678501284185 27.894445283779017 27.748401067633583 21.045475147303218 35-39 23.14408276558163 28.215997981327277 27.448902346707037 21.191016906384053 40-44 23.078470824949697 27.997987927565394 28.063380281690144 20.86016096579477 45-49 23.702326516255464 27.82272247625747 27.440832118988993 21.034118888498064 50-54 23.059096176129778 28.58582296337347 27.558063378507736 20.797017481989016 55-59 23.207247786251727 28.2131340533347 27.967446383784615 20.61217177662896 60-64 23.333675143560296 27.93273174733388 28.142945036915506 20.59064807219032 65-69 23.296883823604908 27.92237794547975 27.655423789722267 21.12531444119308 70-74 23.470522803114573 28.369905956112852 27.52047729800789 20.63909394276469 75-79 23.891787831197124 27.660975733319827 27.853488018643297 20.59374841683976 80-84 24.051018852583972 27.821535647136542 27.57253925504345 20.554906245236037 85-89 23.973735652348253 27.903363239937846 27.46729487243747 20.655606235276426 90-94 23.656506917986768 27.867455383998397 28.05795067174654 20.418087026268296 95-99 24.242729193921704 26.93972023749623 27.98128207708564 20.836268491496426 100-104 23.70878982178018 27.560963295804513 28.22234563538143 20.507901247033878 105-109 23.443930694578526 27.16325389970022 28.555459580305882 20.837355825415376 110-114 23.755122950819672 27.325819672131146 27.78176229508197 21.137295081967213 115-119 23.505711954304363 27.840677274581804 28.29967360261118 20.353937168502654 120-124 23.127852736118772 27.306013943923357 28.434568892009832 21.131564427948035 125-129 23.934113393260684 27.725606387786872 27.655300557424802 20.684979661527645 130-134 24.371985530546624 27.527130225080388 27.351286173633437 20.74959807073955 135-139 24.154371173341364 27.792833483890394 27.46662651811703 20.58616882465121 140-144 24.64307259199678 27.488437562839334 27.116428715061332 20.752061130102554 145-149 23.917754371818777 27.692385224008465 27.828453358867105 20.56140704530565 150-151 23.851368315340196 27.303540045192065 28.25759477780567 20.587496861662064 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.5 15 2.0 16 2.5 17 2.5 18 3.5 19 6.0 20 7.0 21 5.5 22 3.5 23 2.0 24 4.0 25 6.0 26 5.5 27 6.0 28 9.5 29 12.5 30 12.0 31 15.0 32 20.0 33 33.0 34 41.5 35 50.5 36 79.0 37 100.5 38 135.0 39 163.0 40 196.0 41 241.0 42 257.0 43 274.5 44 296.5 45 293.5 46 274.5 47 257.0 48 234.0 49 212.0 50 171.0 51 123.5 52 102.0 53 83.5 54 69.0 55 56.0 56 41.5 57 27.0 58 16.5 59 11.5 60 6.5 61 6.5 62 5.5 63 5.0 64 3.0 65 1.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.4 3 1.25 4 1.925 5 0.3 6 0.2 7 0.775 8 1.975 9 0.8999999999999999 10-14 1.0699999999999998 15-19 1.415 20-24 0.84 25-29 0.345 30-34 0.715 35-39 0.9249999999999999 40-44 0.6 45-49 0.49500000000000005 50-54 0.755 55-59 2.315 60-64 2.48 65-69 2.605 70-74 1.11 75-79 1.3050000000000002 80-84 1.6049999999999998 85-89 0.245 90-94 0.26 95-99 0.63 100-104 0.9650000000000001 105-109 1.595 110-114 2.4 115-119 1.96 120-124 0.315 125-129 0.43499999999999994 130-134 0.48 135-139 0.37 140-144 0.54 145-149 0.7849999999999999 150-151 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.8500000000000001 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.4125 0.0 0.0 0.0 0.0 134-135 1.5875 0.0 0.0 0.0 0.0 136-137 1.7875 0.0 0.0 0.0 0.0 138-139 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036609 spots for SRR7168959.sra Written 1036609 spots for SRR7168959.sra Read 1036612 spots for SRR7168959.sra Written 1036612 spots for SRR7168959.sra SRR ids: ['SRR7168959.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lqk3h5wa SRR7168959.sra spots: 20732183 blocks: [[1, 1036609], [1036610, 2073218], [2073219, 3109827], [3109828, 4146436], [4146437, 5183045], [5183046, 6219654], [6219655, 7256263], [7256264, 8292872], [8292873, 9329481], [9329482, 10366090], [10366091, 11402699], [11402700, 12439308], [12439309, 13475917], [13475918, 14512526], [14512527, 15549135], [15549136, 16585744], [16585745, 17622353], [17622354, 18658962], [18658963, 19695571], [19695572, 20732183]] SRR7168959 file size 7003756 SRR7168959 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168959 SRR7168959_1.fastq SRR7168959_2.fastq Input file: SRR7168959_1.fastq Paired file: SRR7168959_2.fastq trimmed: SRR7168959-trimmed-pair1.fastq, SRR7168959-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:35:53 2025 >> started Mon Feb 10 12:36:15 2025 >> done (22.248s) 20732183 read pairs processed; of these: 28742 ( 0.14%) short read pairs filtered out after trimming by size control 41863 ( 0.20%) empty read pairs filtered out after trimming by size control 20661578 (99.66%) read pairs available; of these: 10763417 (52.09%) trimmed read pairs available after processing 9898161 (47.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 3 0.00% 21 0 0.00% 22 5 0.00% 23 3 0.00% 24 5 0.00% 25 7 0.00% 26 5 0.00% 27 7 0.00% 28 7 0.00% 29 3 0.00% 30 14 0.00% 31 13 0.00% 32 6 0.00% 33 7 0.00% 34 5 0.00% 35 5 0.00% 36 11 0.00% 37 7 0.00% 38 13 0.00% 39 8 0.00% 40 21 0.00% 41 22 0.00% 42 16 0.00% 43 21 0.00% 44 10 0.00% 45 21 0.00% 46 15 0.00% 47 34 0.00% 48 20 0.00% 49 28 0.00% 50 36 0.00% 51 28 0.00% 52 43 0.00% 53 49 0.00% 54 56 0.00% 55 49 0.00% 56 54 0.00% 57 55 0.00% 58 73 0.00% 59 96 0.00% 60 93 0.00% 61 112 0.00% 62 113 0.00% 63 122 0.00% 64 149 0.00% 65 167 0.00% 66 184 0.00% 67 191 0.00% 68 245 0.00% 69 285 0.00% 70 314 0.00% 71 330 0.00% 72 400 0.00% 73 470 0.00% 74 540 0.00% 75 620 0.00% 76 687 0.00% 77 697 0.00% 78 816 0.00% 79 890 0.00% 80 1098 0.01% 81 1278 0.01% 82 1475 0.01% 83 1715 0.01% 84 2831 0.01% 85 3099 0.01% 86 3372 0.02% 87 3513 0.02% 88 3669 0.02% 89 3749 0.02% 90 4161 0.02% 91 4260 0.02% 92 4609 0.02% 93 4852 0.02% 94 5120 0.02% 95 5529 0.03% 96 5995 0.03% 97 6109 0.03% 98 6664 0.03% 99 6991 0.03% 100 7249 0.04% 101 7766 0.04% 102 8124 0.04% 103 8774 0.04% 104 9442 0.05% 105 10125 0.05% 106 10959 0.05% 107 11248 0.05% 108 11854 0.06% 109 12751 0.06% 110 13557 0.07% 111 13883 0.07% 112 14884 0.07% 113 15894 0.08% 114 16717 0.08% 115 17551 0.08% 116 19306 0.09% 117 20169 0.10% 118 21424 0.10% 119 22003 0.11% 120 23451 0.11% 121 25068 0.12% 122 25962 0.13% 123 28319 0.14% 124 30243 0.15% 125 32727 0.16% 126 35355 0.17% 127 37254 0.18% 128 40049 0.19% 129 42513 0.21% 130 45901 0.22% 131 50002 0.24% 132 53321 0.26% 133 57955 0.28% 134 63872 0.31% 135 69850 0.34% 136 76823 0.37% 137 84508 0.41% 138 93466 0.45% 139 105521 0.51% 140 116501 0.56% 141 133236 0.64% 142 154151 0.75% 143 182146 0.88% 144 219447 1.06% 145 274056 1.33% 146 355145 1.72% 147 491277 2.38% 148 744257 3.60% 149 1352726 6.55% 150 5356232 25.92% 151 9898161 47.91% 20661578 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=44 prefix-density=0.20 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=259.51 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=130.41 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.0 sequence=AAAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7168959 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:37:06 Started mapping on | Feb 10 12:37:06 Finished on | Feb 10 12:39:01 Mapping speed, Million of reads per hour | 646.80 Number of input reads | 20661578 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19647875 Uniquely mapped reads % | 95.09% Average mapped length | 295.93 Number of splices: Total | 18764231 Number of splices: Annotated (sjdb) | 18459847 Number of splices: GT/AG | 18498600 Number of splices: GC/AG | 213138 Number of splices: AT/AC | 14270 Number of splices: Non-canonical | 38223 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367911 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 87362 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671522 671522 671522 N_multimapping 367911 367911 367911 N_noFeature 393678 19431447 490788 N_ambiguous 205052 1161 84907 UnstrandedReadsAssigned:19049145 PositiveStrandReadsAssigned:215267 NegativeStrandReadsAssigned:19072180 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168959 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168959-trimmed-pair1.fastq SRR7168959-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,661,578 reads, 18,944,281 reads pseudoaligned [quant] estimated average fragment length: 261.71 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7168959.ke.tsv 34699 SRR7168959.se.tsv 87100 total ==> SRR7168959.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.29 359 9.9798 Potri.005G024800.1.v4.1 1035 774.29 39 2.46055 Potri.004G059700.1.v4.1 961 700.375 1 0.0697494 Potri.007G009000.2.v4.1 1416 1155.29 0 0 Potri.003G141000.2.v4.1 2943 2682.29 346.099 6.30327 Potri.016G087400.1.v4.1 270 65.9148 1184.46 877.823 Potri.015G069301.1.v4.1 564 309.041 0 0 Potri.010G195200.1.v4.1 1773 1512.29 59 1.90584 Potri.012G127500.1.v4.1 977 716.353 5091 347.174 ==> SRR7168959.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1523 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 333 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168959 completed mapping pipeline successfully