Starting /dee2/code/volunteer_pipeline.sh SRR7168960 current disk space = 3058808713216 free memory = 1339102688 SRR7168960 SRAfilesize b6316c71761a5d103624b9292535d218 SRR7168960.sra SRR7168960.sra file validated SRR7168960 is paired end SRR7168960 is conventional basespace SRR7168960 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168960_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.939 34.0 33.0 34.0 33.0 34.0 2 33.383 34.0 34.0 34.0 33.0 34.0 3 33.50925 34.0 34.0 34.0 33.0 34.0 4 33.5165 34.0 34.0 34.0 33.0 34.0 5 33.54825 34.0 34.0 34.0 33.0 34.0 6 37.1665 38.0 38.0 38.0 36.0 38.0 7 37.37775 38.0 38.0 38.0 37.0 38.0 8 37.533 38.0 38.0 38.0 38.0 38.0 9 37.6385 38.0 38.0 38.0 38.0 38.0 10-14 37.5802 38.0 38.0 38.0 38.0 38.0 15-19 37.5779 38.0 38.0 38.0 38.0 38.0 20-24 37.5986 38.0 38.0 38.0 38.0 38.0 25-29 37.5378 38.0 38.0 38.0 38.0 38.0 30-34 37.5256 38.0 38.0 38.0 37.6 38.0 35-39 37.4159 38.0 38.0 38.0 37.2 38.0 40-44 37.32905 38.0 38.0 38.0 37.0 38.0 45-49 37.29559999999999 38.0 38.0 38.0 36.8 38.0 50-54 37.2278 38.0 38.0 38.0 36.6 38.0 55-59 37.20055 38.0 38.0 38.0 36.0 38.0 60-64 37.133449999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.0819 38.0 38.0 38.0 36.0 38.0 70-74 37.0675 38.0 38.0 38.0 36.0 38.0 75-79 36.99485 38.0 38.0 38.0 36.0 38.0 80-84 36.9097 38.0 38.0 38.0 35.8 38.0 85-89 36.8642 38.0 38.0 38.0 35.2 38.0 90-94 36.733999999999995 38.0 38.0 38.0 34.8 38.0 95-99 36.675050000000006 38.0 38.0 38.0 34.6 38.0 100-104 36.5049 38.0 38.0 38.0 34.0 38.0 105-109 36.3807 38.0 37.8 38.0 34.0 38.0 110-114 36.13995 38.0 37.0 38.0 33.4 38.0 115-119 35.9956 38.0 37.0 38.0 32.6 38.0 120-124 35.912850000000006 38.0 37.0 38.0 33.0 38.0 125-129 35.758849999999995 38.0 36.6 38.0 31.6 38.0 130-134 35.514799999999994 38.0 36.0 38.0 31.2 38.0 135-139 35.16825 38.0 36.0 38.0 29.6 38.0 140-144 34.76015 38.0 35.2 38.0 27.8 38.0 145-149 34.2644 38.0 35.0 38.0 25.8 38.0 150-151 31.16825 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 0.0 14 2.0 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 3.0 21 4.0 22 8.0 23 7.0 24 10.0 25 10.0 26 10.0 27 20.0 28 13.0 29 27.0 30 40.0 31 55.0 32 67.0 33 84.0 34 130.0 35 234.0 36 629.0 37 2637.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.977585328578705 13.015792154865002 11.20733571064697 37.79928680590932 2 21.725 16.975 34.975 26.325 3 19.35 21.75 27.200000000000003 31.7 4 22.075 29.975 22.75 25.2 5 22.075 33.650000000000006 23.7 20.575 6 19.6 36.475 24.3 19.625 7 14.35 25.924999999999997 40.125 19.6 8 18.6 25.624999999999996 30.425 25.35 9 16.675 25.2 34.949999999999996 23.175 10-14 20.145 29.215000000000003 26.700000000000003 23.94 15-19 19.66 29.03 27.245 24.065 20-24 20.200000000000003 28.849999999999998 27.060000000000002 23.89 25-29 20.255000000000003 28.485 27.27 23.990000000000002 30-34 19.43 29.134999999999998 27.175 24.26 35-39 19.895 28.515 27.88 23.71 40-44 20.215 28.975 27.275 23.535 45-49 20.535 28.694999999999997 26.974999999999998 23.794999999999998 50-54 19.925 28.105000000000004 27.54 24.43 55-59 20.575 27.900000000000002 27.245 24.279999999999998 60-64 20.395 28.925 26.955000000000002 23.724999999999998 65-69 20.52 28.96 26.625 23.895 70-74 20.349999999999998 28.71 27.265 23.674999999999997 75-79 21.065 28.125 27.005000000000003 23.805 80-84 20.89 28.375 27.125 23.61 85-89 20.605 28.810000000000002 27.150000000000002 23.435 90-94 20.09 28.449999999999996 27.515 23.945 95-99 20.599999999999998 28.189999999999998 27.765 23.445 100-104 20.94 28.275 27.365000000000002 23.419999999999998 105-109 20.435 27.93 27.435 24.2 110-114 20.380000000000003 28.560000000000002 27.0 24.060000000000002 115-119 20.365 28.38 27.065 24.19 120-124 20.86 27.715 27.355 24.07 125-129 20.705000000000002 27.98 27.29 24.025 130-134 20.979999999999997 28.04 27.095000000000002 23.885 135-139 21.19 28.044999999999998 26.895000000000003 23.87 140-144 20.560000000000002 28.199999999999996 27.22 24.02 145-149 20.669999999999998 27.839999999999996 27.74 23.75 150-151 21.05 28.037499999999998 27.0125 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.5 25 3.5 26 5.0 27 8.5 28 14.0 29 17.0 30 17.5 31 22.0 32 29.5 33 39.0 34 49.5 35 66.0 36 79.5 37 94.5 38 118.5 39 137.5 40 174.5 41 214.0 42 233.5 43 257.5 44 279.0 45 272.5 46 273.0 47 270.5 48 256.0 49 210.5 50 170.5 51 156.5 52 124.5 53 103.0 54 77.0 55 54.0 56 39.5 57 28.5 58 25.5 59 22.0 60 14.0 61 8.0 62 7.0 63 5.0 64 4.5 65 4.0 66 2.5 67 2.0 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.7875000000000001 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.9874999999999999 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.3250000000000002 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.6375000000000002 0.0 0.0 0.0 0.0 138-139 1.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGAT 10 0.0068343505 144.975 145 >>END_MODULE SRR7168960 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168960_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.908 33.0 33.0 34.0 32.0 34.0 2 33.02425 34.0 33.0 34.0 32.0 34.0 3 33.05425 34.0 33.0 34.0 32.0 34.0 4 33.04925 34.0 33.0 34.0 33.0 34.0 5 32.987 34.0 33.0 34.0 32.0 34.0 6 37.15275 38.0 38.0 38.0 37.0 38.0 7 37.2 38.0 38.0 38.0 37.0 38.0 8 37.17 38.0 38.0 38.0 37.0 38.0 9 37.198 38.0 38.0 38.0 37.0 38.0 10-14 37.169050000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.0966 38.0 38.0 38.0 37.0 38.0 20-24 37.07035 38.0 38.0 38.0 36.8 38.0 25-29 37.03525 38.0 38.0 38.0 36.4 38.0 30-34 37.01835 38.0 38.0 38.0 36.4 38.0 35-39 36.9658 38.0 38.0 38.0 36.2 38.0 40-44 36.97330000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.9668 38.0 38.0 38.0 36.0 38.0 50-54 36.937200000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.8404 38.0 38.0 38.0 36.0 38.0 60-64 36.779700000000005 38.0 38.0 38.0 35.8 38.0 65-69 36.639149999999994 38.0 38.0 38.0 34.8 38.0 70-74 36.624050000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.62155 38.0 38.0 38.0 35.0 38.0 80-84 36.4713 38.0 38.0 38.0 34.4 38.0 85-89 36.423 38.0 38.0 38.0 34.0 38.0 90-94 36.24895 38.0 38.0 38.0 33.8 38.0 95-99 36.1485 38.0 38.0 38.0 33.4 38.0 100-104 35.89874999999999 38.0 37.0 38.0 32.8 38.0 105-109 35.8537 38.0 37.2 38.0 32.0 38.0 110-114 35.62605 38.0 37.0 38.0 31.0 38.0 115-119 35.441500000000005 38.0 36.8 38.0 29.6 38.0 120-124 35.0791 38.0 36.0 38.0 27.8 38.0 125-129 34.94015 38.0 36.0 38.0 28.0 38.0 130-134 34.496249999999996 38.0 35.2 38.0 25.4 38.0 135-139 34.035000000000004 38.0 34.8 38.0 23.0 38.0 140-144 33.6303 38.0 34.4 38.0 21.4 38.0 145-149 32.89555 38.0 33.8 38.0 15.4 38.0 150-151 28.55875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 3.0 5 1.0 6 3.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 4.0 14 4.0 15 1.0 16 5.0 17 3.0 18 3.0 19 4.0 20 13.0 21 12.0 22 9.0 23 9.0 24 19.0 25 22.0 26 19.0 27 30.0 28 35.0 29 34.0 30 68.0 31 52.0 32 83.0 33 93.0 34 154.0 35 269.0 36 643.0 37 2395.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.975 20.575 14.499999999999998 27.950000000000003 2 27.1 25.474999999999998 30.425 17.0 3 19.275000000000002 29.375 32.1 19.25 4 23.65 33.25 23.599999999999998 19.5 5 23.7 36.925000000000004 21.7 17.675 6 20.5 36.975 22.975 19.55 7 20.05 22.025 38.1 19.825 8 22.725 24.85 25.674999999999997 26.75 9 21.0 26.674999999999997 28.749999999999996 23.575 10-14 23.155 28.549999999999997 26.224999999999998 22.07 15-19 23.06 28.005000000000003 26.775 22.16 20-24 23.200000000000003 28.225 27.145000000000003 21.43 25-29 23.165 28.355000000000004 27.200000000000003 21.279999999999998 30-34 22.85 28.595 27.725 20.830000000000002 35-39 23.7 27.72 27.725 20.855 40-44 23.465 27.63 27.794999999999998 21.11 45-49 23.785 27.650000000000002 27.500000000000004 21.065 50-54 23.32 28.485 27.205000000000002 20.990000000000002 55-59 23.735 27.800000000000004 27.529999999999998 20.935000000000002 60-64 23.285 27.92 27.950000000000003 20.845 65-69 23.395 27.465 27.655 21.485000000000003 70-74 23.385 27.63 28.000000000000004 20.985 75-79 23.35 27.785 27.900000000000002 20.965 80-84 23.599999999999998 27.744999999999997 27.634999999999998 21.02 85-89 23.54 27.245 28.335 20.880000000000003 90-94 23.755000000000003 27.134999999999998 28.075 21.035 95-99 24.005000000000003 27.49 27.565 20.94 100-104 24.45 27.855 27.029999999999998 20.665 105-109 23.36 28.105000000000004 26.995 21.54 110-114 23.59 27.529999999999998 27.775 21.105 115-119 24.665 27.48 27.045 20.810000000000002 120-124 23.51 27.92 27.505000000000003 21.065 125-129 23.695 27.47 28.050000000000004 20.785 130-134 23.919999999999998 28.21 27.125 20.745 135-139 24.02 27.555000000000003 28.194999999999997 20.23 140-144 23.765 28.410000000000004 27.215 20.61 145-149 23.599999999999998 27.169999999999998 28.194999999999997 21.035 150-151 24.337500000000002 27.875 27.6375 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 1.0 25 2.0 26 3.0 27 2.0 28 2.0 29 5.0 30 7.0 31 9.0 32 16.0 33 23.5 34 33.0 35 41.5 36 64.5 37 94.5 38 119.5 39 147.5 40 195.5 41 249.0 42 269.0 43 269.0 44 277.5 45 299.0 46 297.5 47 272.5 48 249.0 49 210.0 50 173.5 51 156.0 52 134.0 53 103.5 54 75.0 55 55.5 56 36.5 57 29.5 58 25.0 59 14.0 60 8.5 61 7.5 62 6.0 63 3.0 64 2.0 65 1.0 66 1.0 67 1.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.0625 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.5125000000000002 0.0 0.0 0.0 0.0 136-137 1.7125 0.0 0.0 0.0 0.0 138-139 1.8875000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751635 spots for SRR7168960.sra Written 751635 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra Read 751620 spots for SRR7168960.sra Written 751620 spots for SRR7168960.sra SRR ids: ['SRR7168960.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qmbng8bx SRR7168960.sra spots: 15032415 blocks: [[1, 751620], [751621, 1503240], [1503241, 2254860], [2254861, 3006480], [3006481, 3758100], [3758101, 4509720], [4509721, 5261340], [5261341, 6012960], [6012961, 6764580], [6764581, 7516200], [7516201, 8267820], [8267821, 9019440], [9019441, 9771060], [9771061, 10522680], [10522681, 11274300], [11274301, 12025920], [12025921, 12777540], [12777541, 13529160], [13529161, 14280780], [14280781, 15032415]] SRR7168960 file size 5072291 SRR7168960 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168960 SRR7168960_1.fastq SRR7168960_2.fastq Input file: SRR7168960_1.fastq Paired file: SRR7168960_2.fastq trimmed: SRR7168960-trimmed-pair1.fastq, SRR7168960-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:12:42 2025 >> started Mon Feb 10 12:13:00 2025 >> done (17.264s) 15032415 read pairs processed; of these: 14513 ( 0.10%) short read pairs filtered out after trimming by size control 18663 ( 0.12%) empty read pairs filtered out after trimming by size control 14999239 (99.78%) read pairs available; of these: 6051168 (40.34%) trimmed read pairs available after processing 8948071 (59.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 2 0.00% 23 2 0.00% 24 6 0.00% 25 5 0.00% 26 1 0.00% 27 4 0.00% 28 2 0.00% 29 7 0.00% 30 5 0.00% 31 5 0.00% 32 5 0.00% 33 4 0.00% 34 3 0.00% 35 5 0.00% 36 6 0.00% 37 5 0.00% 38 6 0.00% 39 4 0.00% 40 14 0.00% 41 9 0.00% 42 4 0.00% 43 10 0.00% 44 8 0.00% 45 13 0.00% 46 10 0.00% 47 8 0.00% 48 21 0.00% 49 14 0.00% 50 11 0.00% 51 23 0.00% 52 25 0.00% 53 21 0.00% 54 29 0.00% 55 34 0.00% 56 36 0.00% 57 33 0.00% 58 37 0.00% 59 44 0.00% 60 54 0.00% 61 58 0.00% 62 65 0.00% 63 72 0.00% 64 85 0.00% 65 93 0.00% 66 83 0.00% 67 106 0.00% 68 126 0.00% 69 156 0.00% 70 193 0.00% 71 212 0.00% 72 223 0.00% 73 234 0.00% 74 249 0.00% 75 317 0.00% 76 364 0.00% 77 377 0.00% 78 449 0.00% 79 484 0.00% 80 534 0.00% 81 588 0.00% 82 749 0.00% 83 848 0.01% 84 1452 0.01% 85 1934 0.01% 86 2104 0.01% 87 2113 0.01% 88 2348 0.02% 89 2280 0.02% 90 2541 0.02% 91 2742 0.02% 92 2840 0.02% 93 3119 0.02% 94 3241 0.02% 95 3530 0.02% 96 3653 0.02% 97 3920 0.03% 98 4039 0.03% 99 4213 0.03% 100 4643 0.03% 101 4971 0.03% 102 5395 0.04% 103 5671 0.04% 104 6024 0.04% 105 6471 0.04% 106 7106 0.05% 107 7544 0.05% 108 7818 0.05% 109 8160 0.05% 110 8681 0.06% 111 9321 0.06% 112 9983 0.07% 113 10757 0.07% 114 11354 0.08% 115 12169 0.08% 116 13184 0.09% 117 13630 0.09% 118 14560 0.10% 119 15248 0.10% 120 15927 0.11% 121 16852 0.11% 122 17878 0.12% 123 19241 0.13% 124 20674 0.14% 125 21646 0.14% 126 23608 0.16% 127 24673 0.16% 128 26278 0.18% 129 27814 0.19% 130 29745 0.20% 131 31504 0.21% 132 34167 0.23% 133 36760 0.25% 134 40010 0.27% 135 43078 0.29% 136 46394 0.31% 137 49806 0.33% 138 54704 0.36% 139 59659 0.40% 140 64909 0.43% 141 72303 0.48% 142 81598 0.54% 143 91638 0.61% 144 107733 0.72% 145 128796 0.86% 146 158938 1.06% 147 215769 1.44% 148 327744 2.19% 149 641589 4.28% 150 3283763 21.89% 151 8948071 59.66% 14999239 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=41 prefix-density=0.25 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=45 fanout-score=255.55 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.81 fanout-score-rank=19 prefix-density=0.34 prefix-fanout=3.8 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=12 fanout-score=39.47 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=10.6 sequence=TGTTGGTGGTGG SRR7168960 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:13:50 Started mapping on | Feb 10 12:13:53 Finished on | Feb 10 12:15:30 Mapping speed, Million of reads per hour | 556.67 Number of input reads | 14999239 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14153565 Uniquely mapped reads % | 94.36% Average mapped length | 296.93 Number of splices: Total | 13169383 Number of splices: Annotated (sjdb) | 12952166 Number of splices: GT/AG | 12989523 Number of splices: GC/AG | 143384 Number of splices: AT/AC | 10235 Number of splices: Non-canonical | 26241 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263978 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 46380 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 594672 594672 594672 N_multimapping 263978 263978 263978 N_noFeature 293761 13984177 361668 N_ambiguous 158435 804 56382 UnstrandedReadsAssigned:13701369 PositiveStrandReadsAssigned:168584 NegativeStrandReadsAssigned:13735515 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168960 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168960-trimmed-pair1.fastq SRR7168960-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,999,239 reads, 13,645,382 reads pseudoaligned [quant] estimated average fragment length: 267.034 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7168960.ke.tsv 34699 SRR7168960.se.tsv 87100 total ==> SRR7168960.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.97 227 8.67513 Potri.005G024800.1.v4.1 1035 768.966 23 2.00261 Potri.004G059700.1.v4.1 961 695.022 1 0.0963335 Potri.007G009000.2.v4.1 1416 1149.97 0 0 Potri.003G141000.2.v4.1 2943 2676.97 217.058 5.42885 Potri.016G087400.1.v4.1 270 66.4407 1133.61 1142.36 Potri.015G069301.1.v4.1 564 305.884 0 0 Potri.010G195200.1.v4.1 1773 1506.97 13 0.577585 Potri.012G127500.1.v4.1 977 711.005 4036 380.062 ==> SRR7168960.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1384 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168960 completed mapping pipeline successfully