Starting /dee2/code/volunteer_pipeline.sh SRR7168961 current disk space = 3058768842752 free memory = 1210136908 SRR7168961 SRAfilesize 0c716787156b359f15eb24bedcfa650f SRR7168961.sra SRR7168961.sra file validated SRR7168961 is paired end SRR7168961 is conventional basespace SRR7168961 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168961_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28975 34.0 34.0 34.0 33.0 34.0 2 33.50025 34.0 34.0 34.0 33.0 34.0 3 33.53375 34.0 34.0 34.0 33.0 34.0 4 33.57 34.0 34.0 34.0 33.0 34.0 5 33.5435 34.0 34.0 34.0 33.0 34.0 6 37.167 38.0 37.0 38.0 36.0 38.0 7 37.41775 38.0 38.0 38.0 37.0 38.0 8 37.55875 38.0 38.0 38.0 37.0 38.0 9 37.60275 38.0 38.0 38.0 38.0 38.0 10-14 37.5499 38.0 38.0 38.0 38.0 38.0 15-19 37.5464 38.0 38.0 38.0 37.6 38.0 20-24 37.53175 38.0 38.0 38.0 37.8 38.0 25-29 37.498900000000006 38.0 38.0 38.0 37.8 38.0 30-34 37.44970000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.367650000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.27675000000001 38.0 38.0 38.0 36.8 38.0 45-49 37.2385 38.0 38.0 38.0 36.4 38.0 50-54 37.1879 38.0 38.0 38.0 36.2 38.0 55-59 37.16875 38.0 38.0 38.0 36.0 38.0 60-64 37.139599999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.0886 38.0 38.0 38.0 36.0 38.0 70-74 37.09285 38.0 38.0 38.0 36.0 38.0 75-79 37.0303 38.0 38.0 38.0 36.0 38.0 80-84 36.9264 38.0 38.0 38.0 35.8 38.0 85-89 36.850199999999994 38.0 38.0 38.0 35.2 38.0 90-94 36.80145 38.0 38.0 38.0 34.8 38.0 95-99 36.748949999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.592549999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.4679 38.0 38.0 38.0 34.0 38.0 110-114 36.2402 38.0 37.6 38.0 33.6 38.0 115-119 36.122049999999994 38.0 37.4 38.0 33.4 38.0 120-124 36.0447 38.0 37.2 38.0 33.2 38.0 125-129 35.8702 38.0 36.8 38.0 32.4 38.0 130-134 35.611599999999996 38.0 36.0 38.0 31.2 38.0 135-139 35.35045 38.0 36.0 38.0 30.6 38.0 140-144 35.0394 38.0 35.8 38.0 29.8 38.0 145-149 34.603899999999996 38.0 35.2 38.0 28.0 38.0 150-151 31.5195 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 0.0 17 2.0 18 1.0 19 1.0 20 7.0 21 7.0 22 7.0 23 3.0 24 5.0 25 6.0 26 20.0 27 13.0 28 28.0 29 24.0 30 31.0 31 42.0 32 66.0 33 75.0 34 137.0 35 246.0 36 592.0 37 2682.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.49043303121853 13.846928499496475 10.120845921450151 34.541792547834845 2 20.974999999999998 14.975 34.225 29.825000000000003 3 19.400000000000002 21.425 27.125 32.05 4 24.525 25.900000000000002 22.75 26.825 5 22.400000000000002 31.6 25.025 20.974999999999998 6 20.4 33.975 24.375 21.25 7 15.225 27.474999999999998 39.2 18.099999999999998 8 16.55 27.55 30.975 24.925 9 16.325 26.474999999999998 33.324999999999996 23.875 10-14 19.91 30.580000000000002 26.35 23.16 15-19 19.63 30.145 26.840000000000003 23.385 20-24 20.169999999999998 29.099999999999998 27.279999999999998 23.45 25-29 19.685 29.015 27.224999999999998 24.075 30-34 19.77 29.494999999999997 27.474999999999998 23.26 35-39 20.43 28.715000000000003 27.029999999999998 23.825 40-44 20.005 29.275000000000002 27.22 23.5 45-49 20.19 28.939999999999998 27.450000000000003 23.419999999999998 50-54 20.345 29.409999999999997 26.875 23.369999999999997 55-59 20.305 28.744999999999997 26.474999999999998 24.474999999999998 60-64 20.46 28.955 27.245 23.34 65-69 20.9 28.244999999999997 27.075 23.78 70-74 20.395 28.425 26.87 24.310000000000002 75-79 20.77 28.52 27.075 23.635 80-84 20.035 29.14 27.24 23.585 85-89 20.73 28.634999999999998 26.924999999999997 23.71 90-94 20.565 28.465 27.01 23.96 95-99 20.71 28.23 27.279999999999998 23.78 100-104 20.96 28.28 26.815 23.945 105-109 20.674999999999997 27.865000000000002 27.21 24.25 110-114 20.669999999999998 28.125 27.295 23.91 115-119 20.44 28.499999999999996 27.055 24.005000000000003 120-124 20.735 27.615000000000002 27.025 24.625 125-129 20.805 28.52 26.939999999999998 23.735 130-134 21.055 28.294999999999998 26.235000000000003 24.415 135-139 20.53 28.535 26.355 24.58 140-144 21.39 28.060000000000002 26.655 23.895 145-149 20.880000000000003 27.839999999999996 26.815 24.465 150-151 20.7125 28.299999999999997 27.1375 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 1.0 17 1.0 18 0.5 19 1.0 20 2.0 21 2.0 22 1.0 23 1.5 24 3.5 25 4.0 26 4.0 27 9.5 28 13.5 29 17.0 30 20.5 31 30.0 32 43.0 33 52.0 34 58.5 35 64.0 36 78.0 37 103.0 38 131.0 39 153.0 40 174.0 41 201.5 42 214.0 43 236.5 44 262.0 45 264.0 46 259.5 47 234.5 48 216.0 49 216.5 50 185.5 51 138.5 52 126.0 53 125.5 54 97.5 55 63.5 56 48.0 57 34.5 58 26.0 59 21.0 60 13.0 61 10.0 62 11.5 63 7.5 64 3.5 65 3.5 66 3.0 67 1.5 68 1.0 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.6000000000000001 0.0 0.0 0.0 0.0 118-119 0.7875 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.7000000000000002 0.0 0.0 0.0 0.0 130-131 1.9125 0.0 0.0 0.0 0.0 132-133 2.1875 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.5375 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGACT 10 0.006577216 146.82278 1 >>END_MODULE SRR7168961 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168961_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.993 33.0 33.0 34.0 32.0 34.0 2 33.10725 34.0 33.0 34.0 32.0 34.0 3 33.1285 34.0 33.0 34.0 33.0 34.0 4 33.04325 34.0 33.0 34.0 33.0 34.0 5 33.033 34.0 33.0 34.0 33.0 34.0 6 37.331 38.0 38.0 38.0 37.0 38.0 7 37.362 38.0 38.0 38.0 37.0 38.0 8 37.32 38.0 38.0 38.0 37.0 38.0 9 37.29475 38.0 38.0 38.0 37.0 38.0 10-14 37.229499999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.2346 38.0 38.0 38.0 37.0 38.0 20-24 37.136199999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.177499999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.1981 38.0 38.0 38.0 37.0 38.0 35-39 37.1725 38.0 38.0 38.0 37.0 38.0 40-44 37.15304999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.1038 38.0 38.0 38.0 37.0 38.0 50-54 37.040800000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.03855 38.0 38.0 38.0 36.4 38.0 60-64 36.9972 38.0 38.0 38.0 36.4 38.0 65-69 36.95775 38.0 38.0 38.0 36.0 38.0 70-74 36.820550000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.783699999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.74205 38.0 38.0 38.0 35.8 38.0 85-89 36.7019 38.0 38.0 38.0 35.0 38.0 90-94 36.60255 38.0 38.0 38.0 35.0 38.0 95-99 36.46939999999999 38.0 38.0 38.0 34.2 38.0 100-104 36.39685 38.0 38.0 38.0 34.0 38.0 105-109 36.23605 38.0 38.0 38.0 34.0 38.0 110-114 36.053549999999994 38.0 38.0 38.0 33.2 38.0 115-119 35.88325 38.0 37.2 38.0 33.0 38.0 120-124 35.7245 38.0 37.0 38.0 32.2 38.0 125-129 35.40689999999999 38.0 36.4 38.0 31.0 38.0 130-134 35.162400000000005 38.0 36.0 38.0 29.6 38.0 135-139 34.7838 38.0 35.0 38.0 27.8 38.0 140-144 34.39535000000001 38.0 35.0 38.0 25.8 38.0 145-149 33.89104999999999 38.0 35.0 38.0 23.0 38.0 150-151 30.359750000000002 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 1.0 5 0.0 6 0.0 7 2.0 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 2.0 14 3.0 15 4.0 16 0.0 17 1.0 18 5.0 19 3.0 20 4.0 21 4.0 22 9.0 23 11.0 24 15.0 25 12.0 26 18.0 27 19.0 28 25.0 29 26.0 30 32.0 31 46.0 32 65.0 33 81.0 34 144.0 35 245.0 36 560.0 37 2646.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 20.875 14.649999999999999 25.6 2 26.881720430107524 27.431857964491122 28.657164291072768 17.029257314328582 3 21.4160620465349 27.87090317738304 30.79809857393045 19.914936202151615 4 24.074074074074073 33.05805805805806 23.523523523523522 19.344344344344343 5 24.418313735301474 36.12709532149112 21.441080810607957 18.01351013259945 6 21.775 36.65 23.724999999999998 17.849999999999998 7 21.15 21.45 37.6 19.8 8 22.5 25.674999999999997 26.025 25.8 9 22.400000000000002 25.525 29.45 22.625 10-14 24.435000000000002 28.84 25.395 21.33 15-19 24.45366805020753 27.70915637345602 26.88903335500325 20.9481422213332 20-24 23.515 27.634999999999998 27.655 21.195 25-29 24.36 27.97 27.13 20.54 30-34 23.395 28.29 27.36 20.955 35-39 23.91 28.28 26.634999999999998 21.175 40-44 23.52 27.744999999999997 27.125 21.61 45-49 24.154999999999998 27.675 27.24 20.93 50-54 24.305 27.644999999999996 27.11 20.94 55-59 24.18 28.060000000000002 26.724999999999998 21.035 60-64 23.990000000000002 27.565 27.71 20.735 65-69 24.32 28.08 27.095000000000002 20.505000000000003 70-74 24.154999999999998 27.589999999999996 27.465 20.79 75-79 23.880000000000003 27.279999999999998 27.525 21.315 80-84 24.26 27.16 27.339999999999996 21.240000000000002 85-89 24.279999999999998 27.57 27.435 20.715 90-94 23.685000000000002 27.605 27.905 20.805 95-99 24.22 26.85 27.700000000000003 21.23 100-104 24.38 27.51 27.495000000000005 20.615 105-109 23.895 27.810000000000002 27.6 20.695 110-114 23.425 27.605 28.125 20.845 115-119 24.51 27.015 27.67 20.805 120-124 24.395 27.034999999999997 27.775 20.794999999999998 125-129 24.349999999999998 27.634999999999998 27.235 20.78 130-134 23.76 27.62 27.625 20.995 135-139 24.37 27.075 28.065 20.49 140-144 24.990000000000002 27.169999999999998 27.445000000000004 20.395 145-149 24.525 26.945000000000004 27.975 20.555 150-151 25.4 27.375 27.3875 19.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.0 26 0.5 27 4.0 28 4.0 29 2.5 30 6.5 31 12.0 32 15.5 33 20.0 34 31.5 35 38.5 36 52.0 37 84.0 38 121.0 39 152.0 40 185.5 41 206.5 42 235.0 43 281.0 44 279.5 45 281.5 46 287.0 47 274.5 48 263.0 49 228.0 50 185.5 51 158.0 52 140.0 53 108.5 54 79.5 55 64.5 56 51.0 57 36.0 58 29.5 59 24.0 60 17.5 61 14.0 62 7.5 63 6.0 64 5.0 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.075 4 0.1 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.015 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.38749999999999996 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.1124999999999998 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.8250000000000002 0.0 0.0 0.0 0.0 130-131 2.0375 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 3.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGAAG 10 0.006830828 145.0 6 >>END_MODULE Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711523 spots for SRR7168961.sra Written 711523 spots for SRR7168961.sra Read 711527 spots for SRR7168961.sra Written 711527 spots for SRR7168961.sra SRR ids: ['SRR7168961.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b6hw66ll SRR7168961.sra spots: 14230464 blocks: [[1, 711523], [711524, 1423046], [1423047, 2134569], [2134570, 2846092], [2846093, 3557615], [3557616, 4269138], [4269139, 4980661], [4980662, 5692184], [5692185, 6403707], [6403708, 7115230], [7115231, 7826753], [7826754, 8538276], [8538277, 9249799], [9249800, 9961322], [9961323, 10672845], [10672846, 11384368], [11384369, 12095891], [12095892, 12807414], [12807415, 13518937], [13518938, 14230464]] SRR7168961 file size 4800536 SRR7168961 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168961 SRR7168961_1.fastq SRR7168961_2.fastq Input file: SRR7168961_1.fastq Paired file: SRR7168961_2.fastq trimmed: SRR7168961-trimmed-pair1.fastq, SRR7168961-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:19:30 2025 >> started Mon Feb 10 12:19:47 2025 >> done (16.433s) 14230464 read pairs processed; of these: 26363 ( 0.19%) short read pairs filtered out after trimming by size control 20363 ( 0.14%) empty read pairs filtered out after trimming by size control 14183738 (99.67%) read pairs available; of these: 5727956 (40.38%) trimmed read pairs available after processing 8455782 (59.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 4 0.00% 22 8 0.00% 23 3 0.00% 24 6 0.00% 25 5 0.00% 26 6 0.00% 27 1 0.00% 28 5 0.00% 29 4 0.00% 30 8 0.00% 31 6 0.00% 32 6 0.00% 33 5 0.00% 34 9 0.00% 35 6 0.00% 36 6 0.00% 37 5 0.00% 38 3 0.00% 39 8 0.00% 40 7 0.00% 41 10 0.00% 42 9 0.00% 43 8 0.00% 44 14 0.00% 45 15 0.00% 46 15 0.00% 47 16 0.00% 48 25 0.00% 49 21 0.00% 50 29 0.00% 51 26 0.00% 52 34 0.00% 53 42 0.00% 54 29 0.00% 55 27 0.00% 56 40 0.00% 57 40 0.00% 58 60 0.00% 59 49 0.00% 60 55 0.00% 61 71 0.00% 62 74 0.00% 63 73 0.00% 64 85 0.00% 65 118 0.00% 66 124 0.00% 67 123 0.00% 68 128 0.00% 69 180 0.00% 70 216 0.00% 71 229 0.00% 72 247 0.00% 73 267 0.00% 74 257 0.00% 75 348 0.00% 76 340 0.00% 77 429 0.00% 78 449 0.00% 79 542 0.00% 80 619 0.00% 81 706 0.00% 82 795 0.01% 83 993 0.01% 84 1926 0.01% 85 2696 0.02% 86 2765 0.02% 87 2947 0.02% 88 3073 0.02% 89 3094 0.02% 90 3143 0.02% 91 3313 0.02% 92 3511 0.02% 93 3678 0.03% 94 3890 0.03% 95 4168 0.03% 96 4524 0.03% 97 4913 0.03% 98 5002 0.04% 99 5443 0.04% 100 5695 0.04% 101 6280 0.04% 102 6641 0.05% 103 7183 0.05% 104 7652 0.05% 105 8170 0.06% 106 8706 0.06% 107 9247 0.07% 108 9598 0.07% 109 10237 0.07% 110 10895 0.08% 111 11437 0.08% 112 12288 0.09% 113 13146 0.09% 114 13884 0.10% 115 14972 0.11% 116 15848 0.11% 117 16623 0.12% 118 17918 0.13% 119 18607 0.13% 120 19421 0.14% 121 20203 0.14% 122 21408 0.15% 123 22937 0.16% 124 24266 0.17% 125 25955 0.18% 126 27591 0.19% 127 28924 0.20% 128 30365 0.21% 129 31914 0.23% 130 33601 0.24% 131 35423 0.25% 132 37993 0.27% 133 40635 0.29% 134 43015 0.30% 135 46204 0.33% 136 50152 0.35% 137 53717 0.38% 138 57984 0.41% 139 62410 0.44% 140 66829 0.47% 141 74059 0.52% 142 80914 0.57% 143 90783 0.64% 144 104751 0.74% 145 125097 0.88% 146 151584 1.07% 147 201566 1.42% 148 300098 2.12% 149 580724 4.09% 150 2946216 20.77% 151 8455782 59.62% 14183738 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=38 prefix-density=0.27 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=220.53 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=159.66 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=13.7 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7168961 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:21:13 Started mapping on | Feb 10 12:21:14 Finished on | Feb 10 12:22:56 Mapping speed, Million of reads per hour | 500.60 Number of input reads | 14183738 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13202709 Uniquely mapped reads % | 93.08% Average mapped length | 296.10 Number of splices: Total | 11785675 Number of splices: Annotated (sjdb) | 11590277 Number of splices: GT/AG | 11616061 Number of splices: GC/AG | 133529 Number of splices: AT/AC | 10128 Number of splices: Non-canonical | 25957 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 243414 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 51619 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.77% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 756320 756320 756320 N_multimapping 243414 243414 243414 N_noFeature 296904 13040779 361555 N_ambiguous 149295 1216 51032 UnstrandedReadsAssigned:12756510 PositiveStrandReadsAssigned:160714 NegativeStrandReadsAssigned:12790122 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168961 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168961-trimmed-pair1.fastq SRR7168961-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,183,738 reads, 12,744,255 reads pseudoaligned [quant] estimated average fragment length: 241.954 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,006 rounds 52401 SRR7168961.ke.tsv 34699 SRR7168961.se.tsv 87100 total ==> SRR7168961.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.05 224 8.51196 Potri.005G024800.1.v4.1 1035 794.046 21 1.78589 Potri.004G059700.1.v4.1 961 720.095 1 0.0937756 Potri.007G009000.2.v4.1 1416 1175.05 0 0 Potri.003G141000.2.v4.1 2943 2702.05 185.059 4.62484 Potri.016G087400.1.v4.1 270 71.6774 1384.02 1303.89 Potri.015G069301.1.v4.1 564 325.996 0 0 Potri.010G195200.1.v4.1 1773 1532.05 6 0.26446 Potri.012G127500.1.v4.1 977 736.077 5353 491.082 ==> SRR7168961.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 898 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168961 completed mapping pipeline successfully