Starting /dee2/code/volunteer_pipeline.sh SRR7168962 current disk space = 3058687381504 free memory = 1468833356 SRR7168962 SRAfilesize 52606fa818f4d1ca44c01ac5dccc83cb SRR7168962.sra SRR7168962.sra file validated SRR7168962 is paired end SRR7168962 is conventional basespace SRR7168962 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168962_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7385 34.0 33.0 34.0 32.0 34.0 2 33.2135 34.0 33.0 34.0 32.0 34.0 3 33.22975 34.0 33.0 34.0 32.0 34.0 4 33.18075 34.0 33.0 34.0 32.0 34.0 5 33.2545 34.0 33.0 34.0 32.0 34.0 6 36.964 38.0 37.0 38.0 36.0 38.0 7 37.31625 38.0 38.0 38.0 37.0 38.0 8 37.41725 38.0 38.0 38.0 37.0 38.0 9 37.433 38.0 38.0 38.0 37.0 38.0 10-14 37.5274 38.0 38.0 38.0 37.8 38.0 15-19 37.431349999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.31075 38.0 38.0 38.0 37.0 38.0 25-29 37.20185 38.0 38.0 38.0 36.2 38.0 30-34 37.14685 38.0 38.0 38.0 36.2 38.0 35-39 37.08395 38.0 38.0 38.0 36.0 38.0 40-44 36.90845 38.0 38.0 38.0 35.4 38.0 45-49 36.95555 38.0 38.0 38.0 35.8 38.0 50-54 36.904900000000005 38.0 38.0 38.0 35.4 38.0 55-59 36.6731 38.0 38.0 38.0 34.2 38.0 60-64 36.705600000000004 38.0 38.0 38.0 34.8 38.0 65-69 36.650150000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.660450000000004 38.0 38.0 38.0 34.4 38.0 75-79 36.52905 38.0 38.0 38.0 34.0 38.0 80-84 35.96939999999999 38.0 37.0 38.0 32.2 38.0 85-89 35.885949999999994 38.0 37.0 38.0 31.8 38.0 90-94 35.668099999999995 38.0 36.6 38.0 30.8 38.0 95-99 35.5803 38.0 36.8 38.0 30.4 38.0 100-104 35.34905 38.0 36.0 38.0 29.0 38.0 105-109 35.4057 38.0 36.2 38.0 29.8 38.0 110-114 34.92829999999999 38.0 35.4 38.0 27.6 38.0 115-119 34.71055 38.0 35.0 38.0 26.6 38.0 120-124 34.34595 38.0 34.6 38.0 24.6 38.0 125-129 33.42255 38.0 34.0 38.0 19.4 38.0 130-134 32.895050000000005 37.6 33.0 38.0 18.6 38.0 135-139 33.53795 38.0 34.0 38.0 20.6 38.0 140-144 33.2447 38.0 33.8 38.0 18.6 38.0 145-149 32.219049999999996 38.0 32.0 38.0 14.8 38.0 150-151 27.6295 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 3.0 13 1.0 14 0.0 15 1.0 16 3.0 17 3.0 18 6.0 19 12.0 20 13.0 21 5.0 22 6.0 23 13.0 24 15.0 25 19.0 26 21.0 27 31.0 28 40.0 29 54.0 30 61.0 31 93.0 32 128.0 33 155.0 34 239.0 35 371.0 36 992.0 37 1713.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.624014245739 14.958025947596031 12.922920376494531 34.495039430170436 2 23.225 17.175 30.575000000000003 29.025000000000002 3 19.3 22.0 25.874999999999996 32.824999999999996 4 21.95 29.15 21.925 26.974999999999998 5 21.310655327663834 32.491245622811405 24.262131065532767 21.935967983991997 6 21.0 33.575 24.575 20.849999999999998 7 15.975 27.175 38.4 18.45 8 18.224999999999998 27.325 29.625 24.825 9 17.349999999999998 24.65 33.650000000000006 24.349999999999998 10-14 19.690984549227462 29.756487824391222 27.146357317865892 23.406170308515424 15-19 19.56 29.4 27.01 24.03 20-24 20.035 28.970000000000002 27.205000000000002 23.79 25-29 20.25 29.275000000000002 26.855 23.62 30-34 20.294999999999998 29.609999999999996 26.790000000000003 23.305 35-39 19.794948737184296 29.232308077019255 27.261815453863463 23.710927731932983 40-44 20.200000000000003 29.160000000000004 26.745 23.895 45-49 20.16302445366805 28.59928989348402 26.974046106916038 24.263639545931888 50-54 20.275000000000002 29.185 27.0 23.54 55-59 20.06 28.985 27.175 23.78 60-64 19.88 29.21 27.46 23.45 65-69 19.866986698669866 28.637863786378638 27.26772677267727 24.227422742274225 70-74 20.475118779694924 28.507126781695426 26.996749187296825 24.021005251312825 75-79 20.51 28.499999999999996 27.04 23.95 80-84 20.022107220017084 28.22187609908054 27.62900065316786 24.127016027734513 85-89 20.339493772599436 27.998192044997992 27.254921655283248 24.407392527119327 90-94 20.482713633398564 28.591499824376537 27.35209995483968 23.573686587385218 95-99 20.801046593539297 27.925933380295863 27.337224514440976 23.93579551172386 100-104 20.163556090708408 27.874774232390127 27.829620710415416 24.132048966486053 105-109 20.526474429820155 27.775545061790414 27.790615894705113 23.90736461368432 110-114 20.633089194341323 27.55091802949734 27.42048760911006 24.39550516705127 115-119 20.654191541664577 28.06903125470326 27.05061957557819 24.226157628053983 120-124 21.195298824706178 27.881970492623154 27.516879219804952 23.40585146286572 125-129 20.974533787848408 28.198315620613595 26.513936234208945 24.313214357329056 130-134 21.79681194511703 27.194309927360777 27.385996771589994 23.622881355932204 135-139 20.999294141373397 28.188968438035694 26.903297368155695 23.90844005243521 140-144 20.969763826906686 27.82931354359926 26.891641177355464 24.309281452138595 145-149 20.74958440380837 27.479723943378165 27.051533927761827 24.719157725051634 150-151 20.864213038562994 27.760331616631078 26.843361386760456 24.532093958045472 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 1.0 23 1.5 24 2.5 25 3.5 26 5.0 27 8.5 28 13.0 29 21.0 30 28.5 31 36.0 32 41.0 33 44.0 34 56.5 35 71.0 36 85.5 37 109.0 38 127.0 39 142.5 40 176.5 41 206.5 42 232.0 43 241.5 44 243.0 45 246.5 46 249.5 47 253.5 48 235.5 49 204.0 50 181.5 51 155.5 52 122.0 53 101.5 54 84.0 55 59.5 56 46.5 57 36.0 58 21.5 59 23.0 60 22.5 61 18.0 62 11.5 63 4.5 64 5.0 65 4.0 66 2.0 67 2.0 68 1.0 69 2.0 70 2.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.0 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.025 75-79 0.0 80-84 0.485 85-89 0.44 90-94 0.35500000000000004 95-99 0.63 100-104 0.33999999999999997 105-109 0.47000000000000003 110-114 0.33 115-119 0.335 120-124 0.025 125-129 0.26 130-134 0.88 135-139 0.83 140-144 0.28500000000000003 145-149 0.745 150-151 0.4875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.8625 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCGCC 10 0.0070337174 143.5875 9 AAAAAAA 35 0.00322919 21.038462 90-94 >>END_MODULE SRR7168962 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168962_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97025 33.0 33.0 34.0 32.0 34.0 2 32.96025 34.0 33.0 34.0 32.0 34.0 3 33.02075 34.0 33.0 34.0 32.0 34.0 4 32.9165 34.0 33.0 34.0 32.0 34.0 5 32.84775 34.0 33.0 34.0 32.0 34.0 6 36.93975 38.0 38.0 38.0 37.0 38.0 7 36.7265 38.0 38.0 38.0 36.0 38.0 8 36.4015 38.0 38.0 38.0 36.0 38.0 9 36.75425 38.0 38.0 38.0 36.0 38.0 10-14 36.0793 38.0 38.0 38.0 34.0 38.0 15-19 35.81145 38.0 38.0 38.0 34.0 38.0 20-24 36.18555 38.0 38.0 38.0 35.0 38.0 25-29 36.3679 38.0 38.0 38.0 35.2 38.0 30-34 36.3297 38.0 38.0 38.0 36.0 38.0 35-39 36.4617 38.0 38.0 38.0 36.0 38.0 40-44 36.40465 38.0 38.0 38.0 36.0 38.0 45-49 36.465999999999994 38.0 38.0 38.0 36.2 38.0 50-54 35.88420000000001 38.0 38.0 38.0 34.4 38.0 55-59 35.079150000000006 38.0 38.0 38.0 29.0 38.0 60-64 35.30409999999999 38.0 38.0 38.0 31.2 38.0 65-69 35.544399999999996 38.0 38.0 38.0 33.0 38.0 70-74 35.31314999999999 38.0 38.0 38.0 31.2 38.0 75-79 35.21175 38.0 38.0 38.0 29.8 38.0 80-84 35.40695 38.0 38.0 38.0 32.4 38.0 85-89 35.43555 38.0 38.0 38.0 32.6 38.0 90-94 35.31685 38.0 38.0 38.0 32.0 38.0 95-99 35.21419999999999 38.0 38.0 38.0 31.4 38.0 100-104 34.7926 38.0 37.6 38.0 27.6 38.0 105-109 34.7457 38.0 37.4 38.0 27.2 38.0 110-114 34.50600000000001 38.0 37.0 38.0 24.8 38.0 115-119 34.43985 38.0 37.0 38.0 25.0 38.0 120-124 34.485949999999995 38.0 36.6 38.0 25.6 38.0 125-129 34.245999999999995 38.0 36.0 38.0 23.2 38.0 130-134 33.891200000000005 38.0 35.8 38.0 21.4 38.0 135-139 33.2601 38.0 34.8 38.0 16.2 38.0 140-144 33.12895 38.0 35.0 38.0 14.2 38.0 145-149 32.16655 38.0 33.8 38.0 8.6 38.0 150-151 28.82775 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 37.0 4 8.0 5 6.0 6 1.0 7 7.0 8 16.0 9 8.0 10 16.0 11 23.0 12 14.0 13 6.0 14 2.0 15 4.0 16 3.0 17 5.0 18 4.0 19 7.0 20 9.0 21 8.0 22 9.0 23 14.0 24 14.0 25 26.0 26 36.0 27 21.0 28 26.0 29 40.0 30 48.0 31 51.0 32 80.0 33 76.0 34 121.0 35 241.0 36 442.0 37 2551.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.0 21.349999999999998 17.525 25.124999999999996 2 27.474999999999998 26.700000000000003 28.175 17.65 3 21.230307576894223 30.732683170792697 28.632158039509875 19.4048512128032 4 23.836918459229615 33.41670835417709 23.23661830915458 19.50975487743872 5 24.768576432324245 34.72604453340005 21.816362271703778 18.689016762571928 6 21.9188376753507 37.80060120240481 23.22144288577154 17.059118236472944 7 21.595771457337026 22.45154794865341 36.093632016108735 19.859048577900833 8 22.731880385200203 26.862645717181955 24.987328940699445 25.418144956918397 9 22.751190177900277 25.90829366073666 27.662240040090204 23.678276121272866 10-14 23.939717936968584 29.244946794969707 25.16674303752355 21.64859223053816 15-19 24.6005240713148 28.19709191799825 26.373118224323072 20.82926578636387 20-24 23.798905331441315 28.425907155888915 26.46969389823637 21.305493614433406 25-29 23.702144718380435 29.08398476648627 26.097414311485267 21.116456203648028 30-34 23.58347641652358 28.365821634178367 27.350772649227352 20.6999293000707 35-39 23.97101740968099 27.578746100432728 27.065512730200265 21.384723759686022 40-44 23.88855361094347 28.213639106819556 26.64956749145041 21.248239790786563 45-49 23.98351510277931 27.431271045886312 27.250339247122678 21.33487460421169 50-54 23.8304168154686 28.340390796387936 26.692515687975103 21.13667670016836 55-59 23.595854922279795 27.83419689119171 27.19689119170984 21.373056994818654 60-64 23.893027105317607 27.524312021518725 27.570866956341817 21.01179391682185 65-69 23.563599286260516 27.78485852663778 27.412694366556206 21.2388478205455 70-74 24.424034070501307 27.056288162553233 27.743855508235416 20.775822258710043 75-79 24.590247900020486 27.837533292358124 27.079491907396026 20.492726900225364 80-84 24.542706358559204 27.837270072244706 26.833017369472767 20.78700619972332 85-89 24.176497625248967 27.52668403043767 27.14365967008835 21.153158674225015 90-94 24.16324435318275 27.351129363449694 27.32546201232033 21.160164271047226 95-99 23.333503080918675 27.412537556653255 28.390283648215103 20.863675714212963 100-104 24.28305207578424 27.047313386478933 27.54943575939538 21.120198778341443 105-109 24.650304862427628 27.21217400215197 27.248040170108112 20.889480965312295 110-114 24.09489427539969 27.46260959257349 27.663744198040224 20.77875193398659 115-119 24.912659268392932 27.24517057131114 27.29654747225647 20.545622688039458 120-124 24.21458661117596 27.640460843526366 27.46789828960057 20.6770542556971 125-129 24.353700035552848 27.705825587891713 27.335060185890597 20.60541419066484 130-134 24.979516591560834 27.140516181892664 27.92912740680049 19.950839819746005 135-139 25.310376539109996 27.267153732182088 27.425535176007763 19.99693455270015 140-144 24.565206432424258 27.287392246811514 27.594898422140446 20.552502898623786 145-149 24.462433594738172 27.923096382494307 27.371616493802176 20.242853528965345 150-151 24.356031624585565 27.646008671257334 27.352716143840855 20.645243560316246 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 1.5 6 1.5 7 1.0 8 1.5 9 1.0 10 3.0 11 5.5 12 5.0 13 5.5 14 5.5 15 6.0 16 4.0 17 3.0 18 7.0 19 5.5 20 1.5 21 1.0 22 3.5 23 5.5 24 4.0 25 5.5 26 7.0 27 8.5 28 9.5 29 11.0 30 15.0 31 16.0 32 18.5 33 30.0 34 35.5 35 43.5 36 61.0 37 71.0 38 97.0 39 128.5 40 170.0 41 218.0 42 247.5 43 271.5 44 276.0 45 276.0 46 279.0 47 269.5 48 245.5 49 213.0 50 182.0 51 155.0 52 137.5 53 110.0 54 75.0 55 53.0 56 43.5 57 38.5 58 30.0 59 22.0 60 13.5 61 7.0 62 5.0 63 5.5 64 6.5 65 5.0 66 4.0 67 3.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.05 5 0.075 6 0.2 7 0.675 8 1.35 9 0.22499999999999998 10-14 1.7950000000000002 15-19 2.685 20-24 1.34 25-29 0.22 30-34 0.9900000000000001 35-39 0.63 40-44 0.58 45-49 0.515 50-54 1.9949999999999999 55-59 3.5000000000000004 60-64 3.34 65-69 1.925 70-74 2.555 75-79 2.3800000000000003 80-84 2.415 85-89 2.095 90-94 2.6 95-99 1.815 100-104 3.4099999999999997 105-109 2.415 110-114 3.05 115-119 2.68 120-124 1.485 125-129 1.555 130-134 2.36 135-139 2.1350000000000002 140-144 0.815 145-149 1.175 150-151 1.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.4249999999999998 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7000000000000002 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1624999999999996 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.0875 0.0 0.0 0.0 0.0 134-135 3.25 0.0 0.0 0.0 0.0 136-137 3.5250000000000004 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTGA 10 0.007141598 142.83545 3 >>END_MODULE Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra Read 810968 spots for SRR7168962.sra Written 810968 spots for SRR7168962.sra Read 810954 spots for SRR7168962.sra Written 810954 spots for SRR7168962.sra SRR ids: ['SRR7168962.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qa8k5a2y SRR7168962.sra spots: 16219094 blocks: [[1, 810954], [810955, 1621908], [1621909, 2432862], [2432863, 3243816], [3243817, 4054770], [4054771, 4865724], [4865725, 5676678], [5676679, 6487632], [6487633, 7298586], [7298587, 8109540], [8109541, 8920494], [8920495, 9731448], [9731449, 10542402], [10542403, 11353356], [11353357, 12164310], [12164311, 12975264], [12975265, 13786218], [13786219, 14597172], [14597173, 15408126], [15408127, 16219094]] SRR7168962 file size 5474418 SRR7168962 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168962 SRR7168962_1.fastq SRR7168962_2.fastq Input file: SRR7168962_1.fastq Paired file: SRR7168962_2.fastq trimmed: SRR7168962-trimmed-pair1.fastq, SRR7168962-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:30:58 2025 >> started Mon Feb 10 12:31:16 2025 >> done (18.454s) 16219094 read pairs processed; of these: 53758 ( 0.33%) short read pairs filtered out after trimming by size control 40441 ( 0.25%) empty read pairs filtered out after trimming by size control 16124895 (99.42%) read pairs available; of these: 7329102 (45.45%) trimmed read pairs available after processing 8795793 (54.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 1 0.00% 21 13 0.00% 22 8 0.00% 23 9 0.00% 24 7 0.00% 25 6 0.00% 26 11 0.00% 27 8 0.00% 28 16 0.00% 29 9 0.00% 30 13 0.00% 31 10 0.00% 32 6 0.00% 33 20 0.00% 34 15 0.00% 35 8 0.00% 36 15 0.00% 37 18 0.00% 38 12 0.00% 39 12 0.00% 40 16 0.00% 41 16 0.00% 42 13 0.00% 43 16 0.00% 44 28 0.00% 45 23 0.00% 46 25 0.00% 47 20 0.00% 48 19 0.00% 49 25 0.00% 50 31 0.00% 51 25 0.00% 52 34 0.00% 53 32 0.00% 54 49 0.00% 55 48 0.00% 56 55 0.00% 57 71 0.00% 58 79 0.00% 59 80 0.00% 60 86 0.00% 61 104 0.00% 62 128 0.00% 63 107 0.00% 64 153 0.00% 65 140 0.00% 66 175 0.00% 67 199 0.00% 68 225 0.00% 69 282 0.00% 70 289 0.00% 71 389 0.00% 72 374 0.00% 73 446 0.00% 74 504 0.00% 75 611 0.00% 76 636 0.00% 77 752 0.00% 78 864 0.01% 79 928 0.01% 80 1106 0.01% 81 1272 0.01% 82 1543 0.01% 83 1827 0.01% 84 3567 0.02% 85 4508 0.03% 86 4714 0.03% 87 4812 0.03% 88 4963 0.03% 89 4935 0.03% 90 5149 0.03% 91 5416 0.03% 92 5955 0.04% 93 5960 0.04% 94 6270 0.04% 95 6842 0.04% 96 7110 0.04% 97 7643 0.05% 98 8294 0.05% 99 8468 0.05% 100 9675 0.06% 101 9769 0.06% 102 10420 0.06% 103 10833 0.07% 104 11597 0.07% 105 12411 0.08% 106 13373 0.08% 107 13882 0.09% 108 14775 0.09% 109 15556 0.10% 110 16048 0.10% 111 17284 0.11% 112 17914 0.11% 113 19345 0.12% 114 20362 0.13% 115 21775 0.14% 116 22866 0.14% 117 24134 0.15% 118 24541 0.15% 119 25674 0.16% 120 26711 0.17% 121 27860 0.17% 122 29667 0.18% 123 31133 0.19% 124 33007 0.20% 125 35221 0.22% 126 37109 0.23% 127 38426 0.24% 128 40043 0.25% 129 42180 0.26% 130 44257 0.27% 131 46103 0.29% 132 48976 0.30% 133 52139 0.32% 134 55261 0.34% 135 59357 0.37% 136 62612 0.39% 137 66350 0.41% 138 72165 0.45% 139 77017 0.48% 140 82762 0.51% 141 90572 0.56% 142 100874 0.63% 143 114437 0.71% 144 132071 0.82% 145 155780 0.97% 146 192030 1.19% 147 260438 1.62% 148 384349 2.38% 149 741885 4.60% 150 3707401 22.99% 151 8795793 54.55% 16124895 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=40 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=235.43 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=16.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=44 prefix-density=0.23 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=42 fanout-score=79.16 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.6 sequence=CACCACCACTGGTAACAAGGACATCATCATGGTTGATCACATGAGGAAGATGAAGAACAATGCCATTGTCTGCAACATCGGTCACTTCGATAATGAAATCGACATGCTTGGACTTGAGACCTTCCCTGGCGTGAAGCGCATCACCATCAAGCCCCAAACTGACAGGTGGGTCTTCCCTGACACCAACTCCGGCATCATTGTCCTGGCTGAGGGACGTCTCATGAACCTGGGATGTGCCACCGGTCACCCC SRR7168962 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:32:11 Started mapping on | Feb 10 12:32:11 Finished on | Feb 10 12:33:56 Mapping speed, Million of reads per hour | 552.85 Number of input reads | 16124895 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15025589 Uniquely mapped reads % | 93.18% Average mapped length | 295.00 Number of splices: Total | 13635056 Number of splices: Annotated (sjdb) | 13409431 Number of splices: GT/AG | 13438116 Number of splices: GC/AG | 155105 Number of splices: AT/AC | 11487 Number of splices: Non-canonical | 30348 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280566 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 27300 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.85% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 852929 852929 852929 N_multimapping 280566 280566 280566 N_noFeature 328313 14847551 400123 N_ambiguous 166822 1008 59941 UnstrandedReadsAssigned:14530454 PositiveStrandReadsAssigned:177030 NegativeStrandReadsAssigned:14565525 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168962 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168962-trimmed-pair1.fastq SRR7168962-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,124,895 reads, 14,512,747 reads pseudoaligned [quant] estimated average fragment length: 240.787 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR7168962.ke.tsv 34699 SRR7168962.se.tsv 87100 total ==> SRR7168962.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.21 230 7.63657 Potri.005G024800.1.v4.1 1035 795.213 36 2.67284 Potri.004G059700.1.v4.1 961 721.246 1 0.0818598 Potri.007G009000.2.v4.1 1416 1176.21 0 0 Potri.003G141000.2.v4.1 2943 2703.21 207 4.5211 Potri.016G087400.1.v4.1 270 75.8368 1580 1230.07 Potri.015G069301.1.v4.1 564 327.258 0 0 Potri.010G195200.1.v4.1 1773 1533.21 9 0.346573 Potri.012G127500.1.v4.1 977 737.233 4021 322.021 ==> SRR7168962.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1064 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168962 completed mapping pipeline successfully