Starting /dee2/code/volunteer_pipeline.sh SRR7168963 current disk space = 3058728267776 free memory = 1574429660 SRR7168963 SRAfilesize f932c36ac55f00337a1fb2a7ab03edb8 SRR7168963.sra SRR7168963.sra file validated SRR7168963 is paired end SRR7168963 is conventional basespace SRR7168963 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168963_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.286 34.0 34.0 34.0 33.0 34.0 2 33.54375 34.0 34.0 34.0 33.0 34.0 3 33.50425 34.0 34.0 34.0 33.0 34.0 4 33.57175 34.0 34.0 34.0 33.0 34.0 5 33.5575 34.0 34.0 34.0 33.0 34.0 6 37.2615 38.0 38.0 38.0 36.0 38.0 7 37.5135 38.0 38.0 38.0 37.0 38.0 8 37.56 38.0 38.0 38.0 37.0 38.0 9 37.571 38.0 38.0 38.0 38.0 38.0 10-14 37.5686 38.0 38.0 38.0 38.0 38.0 15-19 37.54905000000001 38.0 38.0 38.0 37.8 38.0 20-24 37.5743 38.0 38.0 38.0 38.0 38.0 25-29 37.534 38.0 38.0 38.0 38.0 38.0 30-34 37.4807 38.0 38.0 38.0 37.6 38.0 35-39 37.42745 38.0 38.0 38.0 37.2 38.0 40-44 37.3215 38.0 38.0 38.0 37.0 38.0 45-49 37.2804 38.0 38.0 38.0 36.8 38.0 50-54 37.2544 38.0 38.0 38.0 36.8 38.0 55-59 37.1794 38.0 38.0 38.0 36.2 38.0 60-64 37.158750000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.137299999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.0874 38.0 38.0 38.0 36.0 38.0 75-79 37.0861 38.0 38.0 38.0 36.0 38.0 80-84 37.0003 38.0 38.0 38.0 36.0 38.0 85-89 36.876850000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.83434999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.69285 38.0 38.0 38.0 35.0 38.0 100-104 36.586600000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.5539 38.0 38.0 38.0 34.0 38.0 110-114 36.376 38.0 38.0 38.0 34.0 38.0 115-119 36.26825 38.0 37.6 38.0 34.0 38.0 120-124 36.1058 38.0 37.0 38.0 33.4 38.0 125-129 35.87865 38.0 36.8 38.0 32.6 38.0 130-134 35.6379 38.0 36.0 38.0 31.0 38.0 135-139 35.460249999999995 38.0 36.0 38.0 31.0 38.0 140-144 35.0938 38.0 35.8 38.0 29.6 38.0 145-149 34.66225 38.0 35.4 38.0 28.0 38.0 150-151 32.09125 36.5 33.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 2.0 19 4.0 20 3.0 21 2.0 22 4.0 23 9.0 24 4.0 25 6.0 26 13.0 27 17.0 28 30.0 29 29.0 30 33.0 31 45.0 32 51.0 33 84.0 34 107.0 35 221.0 36 581.0 37 2749.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.656912209889 14.505549949545912 9.58627648839556 36.25126135216953 2 22.8 16.6 34.949999999999996 25.650000000000002 3 19.85 22.025 27.400000000000002 30.725 4 21.975 31.05 23.225 23.75 5 22.325 34.25 24.0 19.425 6 18.9 35.55 24.9 20.65 7 13.55 26.575 41.425 18.45 8 17.825 25.900000000000002 30.85 25.424999999999997 9 17.125 23.575 33.5 25.8 10-14 20.075000000000003 29.054999999999996 27.245 23.625 15-19 19.805 29.09 27.77 23.335 20-24 19.75 28.73 28.02 23.5 25-29 19.695 29.025000000000002 27.584999999999997 23.695 30-34 19.615 29.654999999999998 27.229999999999997 23.5 35-39 20.59 28.665000000000003 27.310000000000002 23.435 40-44 20.0 29.945 27.125 22.93 45-49 20.21 28.794999999999998 26.810000000000002 24.185000000000002 50-54 19.939999999999998 29.375 27.02 23.665 55-59 19.775000000000002 28.43 27.529999999999998 24.265 60-64 19.634999999999998 28.575 27.965 23.825 65-69 20.369999999999997 28.705000000000002 27.134999999999998 23.79 70-74 20.025000000000002 28.875 27.450000000000003 23.65 75-79 19.78 29.53 27.189999999999998 23.5 80-84 19.925 28.910000000000004 26.979999999999997 24.185000000000002 85-89 20.44 28.93 26.75 23.880000000000003 90-94 20.71 29.049999999999997 26.724999999999998 23.515 95-99 20.65 28.605000000000004 27.750000000000004 22.994999999999997 100-104 20.8 28.810000000000002 27.125 23.265 105-109 20.135 28.29 27.195000000000004 24.38 110-114 20.18 28.560000000000002 27.644999999999996 23.615 115-119 20.835 28.610000000000003 27.205000000000002 23.35 120-124 20.71 28.53 27.29 23.47 125-129 20.395 28.310000000000002 27.42 23.875 130-134 20.86 28.28 27.705000000000002 23.155 135-139 20.405 28.935 26.995 23.665 140-144 20.73 27.74 27.73 23.799999999999997 145-149 20.59 28.15 27.57 23.69 150-151 20.424999999999997 28.9375 26.35 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.5 20 1.0 21 2.0 22 2.0 23 1.0 24 1.5 25 3.0 26 4.0 27 6.5 28 9.5 29 13.5 30 19.5 31 29.0 32 38.5 33 42.0 34 52.5 35 78.0 36 95.5 37 111.0 38 131.5 39 142.5 40 167.0 41 215.0 42 249.5 43 265.0 44 275.5 45 288.0 46 282.5 47 255.0 48 230.0 49 198.5 50 164.5 51 142.0 52 127.0 53 107.5 54 80.5 55 48.5 56 26.0 57 19.5 58 17.0 59 15.0 60 12.0 61 6.5 62 3.0 63 2.5 64 4.5 65 3.5 66 1.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.0750000000000002 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTAGG 10 0.0068343505 144.975 7 AGGATCA 10 0.0068343505 144.975 4 CCCATTC 10 0.0068343505 144.975 2 TACAAAT 10 0.0068343505 144.975 7 CCATTCA 10 0.0068343505 144.975 3 >>END_MODULE SRR7168963 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168963_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02275 33.0 33.0 34.0 32.0 34.0 2 33.12925 34.0 33.0 34.0 32.0 34.0 3 33.1865 34.0 33.0 34.0 33.0 34.0 4 33.169 34.0 33.0 34.0 33.0 34.0 5 33.1105 34.0 33.0 34.0 33.0 34.0 6 37.3675 38.0 38.0 38.0 37.0 38.0 7 37.37925 38.0 38.0 38.0 37.0 38.0 8 37.4065 38.0 38.0 38.0 37.0 38.0 9 37.37725 38.0 38.0 38.0 37.0 38.0 10-14 37.35145 38.0 38.0 38.0 37.0 38.0 15-19 37.3634 38.0 38.0 38.0 37.0 38.0 20-24 37.274950000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.3105 38.0 38.0 38.0 37.0 38.0 30-34 37.30550000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.28995 38.0 38.0 38.0 37.0 38.0 40-44 37.221799999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.1841 38.0 38.0 38.0 36.6 38.0 50-54 37.1749 38.0 38.0 38.0 36.8 38.0 55-59 37.110749999999996 38.0 38.0 38.0 36.2 38.0 60-64 37.052949999999996 38.0 38.0 38.0 36.4 38.0 65-69 37.04285 38.0 38.0 38.0 36.0 38.0 70-74 36.9056 38.0 38.0 38.0 36.0 38.0 75-79 36.8697 38.0 38.0 38.0 35.8 38.0 80-84 36.755100000000006 38.0 38.0 38.0 35.0 38.0 85-89 36.653949999999995 38.0 38.0 38.0 34.8 38.0 90-94 36.5971 38.0 38.0 38.0 34.4 38.0 95-99 36.46035 38.0 38.0 38.0 34.0 38.0 100-104 36.40310000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.34755 38.0 38.0 38.0 34.0 38.0 110-114 36.08305 38.0 37.4 38.0 33.2 38.0 115-119 35.936449999999994 38.0 37.2 38.0 32.6 38.0 120-124 35.784000000000006 38.0 37.0 38.0 31.8 38.0 125-129 35.42055 38.0 36.2 38.0 30.6 38.0 130-134 35.2444 38.0 36.0 38.0 29.2 38.0 135-139 34.76540000000001 38.0 35.4 38.0 27.4 38.0 140-144 34.349450000000004 38.0 35.0 38.0 25.2 38.0 145-149 33.85575 38.0 35.0 38.0 23.0 38.0 150-151 30.392 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 3.0 16 2.0 17 2.0 18 2.0 19 4.0 20 6.0 21 3.0 22 6.0 23 7.0 24 17.0 25 10.0 26 23.0 27 22.0 28 25.0 29 45.0 30 32.0 31 43.0 32 87.0 33 95.0 34 129.0 35 255.0 36 559.0 37 2614.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.85 21.525 14.6 28.025 2 26.538269134567283 26.138069034517258 31.51575787893947 15.807903951975987 3 19.989992494370778 27.47060295221416 32.324243182386795 20.21516137102827 4 23.24824824824825 34.55955955955956 24.04904904904905 18.143143143143142 5 24.562281140570285 35.51775887943972 22.461230615307652 17.45872936468234 6 20.474999999999998 38.125 22.900000000000002 18.5 7 19.825 19.525000000000002 40.300000000000004 20.349999999999998 8 22.15 25.124999999999996 26.625 26.1 9 21.7 26.375 27.925 24.0 10-14 23.150000000000002 28.835 26.205000000000002 21.81 15-19 23.111933580074023 27.72331699509853 27.9183755126538 21.246373912173652 20-24 22.55112755637782 27.906395319765988 27.996399819990998 21.546077303865193 25-29 23.43617180859043 27.60638031901595 27.821391069553474 21.13605680284014 30-34 23.435 28.299999999999997 27.779999999999998 20.485 35-39 22.97 28.605000000000004 27.395000000000003 21.029999999999998 40-44 23.26 28.725 27.279999999999998 20.735 45-49 23.78 28.04 27.345000000000002 20.835 50-54 23.13 27.725 27.755000000000003 21.39 55-59 23.34 27.74 28.235 20.685000000000002 60-64 23.119999999999997 28.12 28.185 20.575 65-69 23.865 27.62 27.6 20.915 70-74 23.36 27.16 28.645 20.835 75-79 23.68 27.415 28.7 20.205000000000002 80-84 24.16 27.725 27.634999999999998 20.48 85-89 23.974999999999998 27.315 28.275 20.435 90-94 23.294999999999998 27.01 28.410000000000004 21.285 95-99 23.765 27.650000000000002 28.044999999999998 20.54 100-104 23.78 27.334999999999997 28.325 20.560000000000002 105-109 23.325000000000003 27.87 27.994999999999997 20.810000000000002 110-114 23.74 27.32 28.225 20.715 115-119 23.75 27.450000000000003 28.73 20.07 120-124 23.965 27.375 28.415000000000003 20.244999999999997 125-129 23.685000000000002 27.76 28.1 20.455000000000002 130-134 23.785 27.925 27.595 20.695 135-139 23.91 27.37 28.02 20.7 140-144 23.95 27.860000000000003 27.925 20.265 145-149 24.13 27.775 27.26 20.835 150-151 24.15 27.6875 28.4125 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 1.0 25 1.0 26 0.5 27 4.0 28 8.5 29 10.5 30 12.5 31 13.0 32 20.0 33 33.0 34 42.0 35 59.5 36 78.0 37 97.0 38 127.0 39 148.5 40 185.5 41 218.0 42 253.0 43 282.0 44 285.5 45 292.0 46 294.5 47 274.5 48 251.5 49 224.5 50 182.0 51 143.5 52 112.0 53 91.5 54 71.0 55 53.5 56 38.0 57 27.5 58 17.0 59 10.5 60 9.5 61 8.0 62 4.0 63 2.5 64 3.0 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.075 4 0.1 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.03 20-24 0.005 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4271356783919598 0.8500000000000001 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.32499999999999996 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.7875000000000001 0.0 0.0 0.0 0.0 130-131 0.8999999999999999 0.0 0.0 0.0 0.0 132-133 1.0 0.0 0.0 0.0 0.0 134-135 1.1124999999999998 0.0 0.0 0.0 0.0 136-137 1.325 0.0 0.0 0.0 0.0 138-139 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697231 spots for SRR7168963.sra Written 697231 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra Read 697220 spots for SRR7168963.sra Written 697220 spots for SRR7168963.sra SRR ids: ['SRR7168963.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5mj9o_54 SRR7168963.sra spots: 13944411 blocks: [[1, 697220], [697221, 1394440], [1394441, 2091660], [2091661, 2788880], [2788881, 3486100], [3486101, 4183320], [4183321, 4880540], [4880541, 5577760], [5577761, 6274980], [6274981, 6972200], [6972201, 7669420], [7669421, 8366640], [8366641, 9063860], [9063861, 9761080], [9761081, 10458300], [10458301, 11155520], [11155521, 11852740], [11852741, 12549960], [12549961, 13247180], [13247181, 13944411]] SRR7168963 file size 4703602 SRR7168963 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168963 SRR7168963_1.fastq SRR7168963_2.fastq Input file: SRR7168963_1.fastq Paired file: SRR7168963_2.fastq trimmed: SRR7168963-trimmed-pair1.fastq, SRR7168963-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:50:44 2025 >> started Mon Feb 10 12:51:00 2025 >> done (15.221s) 13944411 read pairs processed; of these: 12491 ( 0.09%) short read pairs filtered out after trimming by size control 9348 ( 0.07%) empty read pairs filtered out after trimming by size control 13922572 (99.84%) read pairs available; of these: 5360120 (38.50%) trimmed read pairs available after processing 8562452 (61.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 10 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 5 0.00% 25 0 0.00% 26 4 0.00% 27 9 0.00% 28 3 0.00% 29 8 0.00% 30 3 0.00% 31 5 0.00% 32 6 0.00% 33 7 0.00% 34 6 0.00% 35 9 0.00% 36 8 0.00% 37 1 0.00% 38 8 0.00% 39 7 0.00% 40 3 0.00% 41 5 0.00% 42 13 0.00% 43 9 0.00% 44 9 0.00% 45 8 0.00% 46 12 0.00% 47 11 0.00% 48 24 0.00% 49 9 0.00% 50 16 0.00% 51 10 0.00% 52 13 0.00% 53 22 0.00% 54 18 0.00% 55 17 0.00% 56 24 0.00% 57 18 0.00% 58 33 0.00% 59 39 0.00% 60 39 0.00% 61 40 0.00% 62 52 0.00% 63 45 0.00% 64 56 0.00% 65 74 0.00% 66 79 0.00% 67 97 0.00% 68 93 0.00% 69 107 0.00% 70 109 0.00% 71 120 0.00% 72 140 0.00% 73 203 0.00% 74 188 0.00% 75 219 0.00% 76 221 0.00% 77 217 0.00% 78 276 0.00% 79 336 0.00% 80 387 0.00% 81 393 0.00% 82 448 0.00% 83 654 0.00% 84 1097 0.01% 85 1491 0.01% 86 1526 0.01% 87 1641 0.01% 88 1724 0.01% 89 1745 0.01% 90 1778 0.01% 91 1951 0.01% 92 2094 0.02% 93 2240 0.02% 94 2355 0.02% 95 2577 0.02% 96 2618 0.02% 97 2752 0.02% 98 2879 0.02% 99 3179 0.02% 100 3373 0.02% 101 3600 0.03% 102 4035 0.03% 103 4169 0.03% 104 4511 0.03% 105 4842 0.03% 106 5172 0.04% 107 5428 0.04% 108 5641 0.04% 109 6202 0.04% 110 6641 0.05% 111 7263 0.05% 112 7450 0.05% 113 8124 0.06% 114 8821 0.06% 115 9358 0.07% 116 9993 0.07% 117 10747 0.08% 118 11409 0.08% 119 11897 0.09% 120 12629 0.09% 121 13563 0.10% 122 14389 0.10% 123 15340 0.11% 124 16538 0.12% 125 17578 0.13% 126 18812 0.14% 127 20142 0.14% 128 21431 0.15% 129 23038 0.17% 130 24654 0.18% 131 26422 0.19% 132 28262 0.20% 133 30890 0.22% 134 33422 0.24% 135 36501 0.26% 136 39730 0.29% 137 43381 0.31% 138 48009 0.34% 139 52245 0.38% 140 57670 0.41% 141 64321 0.46% 142 71437 0.51% 143 82710 0.59% 144 96305 0.69% 145 117027 0.84% 146 144418 1.04% 147 197281 1.42% 148 297921 2.14% 149 584981 4.20% 150 2931729 21.06% 151 8562452 61.50% 13922572 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=42 prefix-density=0.26 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=41 fanout-score=148.55 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=12.6 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=10.67 fanout-score-rank=6 prefix-density=0.36 prefix-fanout=6.7 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=33 fanout-score=30.65 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=8.2 sequence=GAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCT SRR7168963 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:51:42 Started mapping on | Feb 10 12:51:43 Finished on | Feb 10 12:52:57 Mapping speed, Million of reads per hour | 677.31 Number of input reads | 13922572 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13264120 Uniquely mapped reads % | 95.27% Average mapped length | 297.34 Number of splices: Total | 12158060 Number of splices: Annotated (sjdb) | 11958047 Number of splices: GT/AG | 11996007 Number of splices: GC/AG | 127271 Number of splices: AT/AC | 9892 Number of splices: Non-canonical | 24890 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 220094 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 50157 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 450225 450225 450225 N_multimapping 220094 220094 220094 N_noFeature 333723 13095866 388764 N_ambiguous 171387 756 57679 UnstrandedReadsAssigned:12759010 PositiveStrandReadsAssigned:167498 NegativeStrandReadsAssigned:12817677 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7168963 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168963-trimmed-pair1.fastq SRR7168963-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,922,572 reads, 12,730,631 reads pseudoaligned [quant] estimated average fragment length: 276.082 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR7168963.ke.tsv 34699 SRR7168963.se.tsv 87100 total ==> SRR7168963.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.92 305 13.9462 Potri.005G024800.1.v4.1 1035 759.918 12 1.25848 Potri.004G059700.1.v4.1 961 686.036 3 0.348503 Potri.007G009000.2.v4.1 1416 1140.92 0 0 Potri.003G141000.2.v4.1 2943 2667.92 219.031 6.54281 Potri.016G087400.1.v4.1 270 62.3276 827.578 1058.18 Potri.015G069301.1.v4.1 564 296.553 0 0 Potri.010G195200.1.v4.1 1773 1497.92 20 1.06408 Potri.012G127500.1.v4.1 977 701.978 1453 164.958 ==> SRR7168963.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1894 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168963 completed mapping pipeline successfully