Starting /dee2/code/volunteer_pipeline.sh SRR7168964 current disk space = 3058616090624 free memory = 1223735156 SRR7168964 SRAfilesize ae7931f3ff286c99cf403b8bf8902124 SRR7168964.sra SRR7168964.sra file validated SRR7168964 is paired end SRR7168964 is conventional basespace SRR7168964 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168964_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.60525 34.0 34.0 34.0 33.0 34.0 2 33.72175 34.0 34.0 34.0 33.0 34.0 3 33.743 34.0 34.0 34.0 33.0 34.0 4 33.75025 34.0 34.0 34.0 33.0 34.0 5 33.729 34.0 34.0 34.0 33.0 34.0 6 37.439 38.0 38.0 38.0 37.0 38.0 7 37.6455 38.0 38.0 38.0 38.0 38.0 8 37.73575 38.0 38.0 38.0 38.0 38.0 9 37.53375 38.0 38.0 38.0 38.0 38.0 10-14 37.7022 38.0 38.0 38.0 38.0 38.0 15-19 37.73685 38.0 38.0 38.0 38.0 38.0 20-24 37.70875 38.0 38.0 38.0 38.0 38.0 25-29 37.68169999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.664750000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.605050000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.5067 38.0 38.0 38.0 38.0 38.0 45-49 37.42195 38.0 38.0 38.0 37.0 38.0 50-54 37.40990000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.35940000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.348299999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.31855 38.0 38.0 38.0 37.0 38.0 70-74 37.2813 38.0 38.0 38.0 37.0 38.0 75-79 37.17685 38.0 38.0 38.0 37.0 38.0 80-84 37.14135 38.0 38.0 38.0 36.4 38.0 85-89 37.07885 38.0 38.0 38.0 36.0 38.0 90-94 37.0117 38.0 38.0 38.0 36.0 38.0 95-99 36.97605 38.0 38.0 38.0 36.0 38.0 100-104 36.8434 38.0 38.0 38.0 35.4 38.0 105-109 36.8026 38.0 38.0 38.0 35.0 38.0 110-114 36.59525 38.0 38.0 38.0 34.6 38.0 115-119 36.519 38.0 38.0 38.0 34.2 38.0 120-124 36.344550000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.1271 38.0 37.6 38.0 33.6 38.0 130-134 35.90185 38.0 37.0 38.0 33.0 38.0 135-139 35.7833 38.0 36.6 38.0 32.6 38.0 140-144 35.55435 38.0 36.0 38.0 31.8 38.0 145-149 35.01795 38.0 36.0 38.0 30.4 38.0 150-151 31.875375 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 4.0 19 2.0 20 4.0 21 5.0 22 2.0 23 6.0 24 8.0 25 8.0 26 7.0 27 18.0 28 9.0 29 19.0 30 26.0 31 42.0 32 45.0 33 62.0 34 80.0 35 155.0 36 519.0 37 2972.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.18826773627475 13.988468287791425 8.222612183504637 36.600651792429176 2 21.030257564391096 16.029007251812956 35.90897724431108 27.031757939484873 3 18.6 22.725 27.650000000000002 31.025000000000002 4 20.95 31.424999999999997 23.775 23.849999999999998 5 22.25 34.125 24.925 18.7 6 19.55 35.35 25.174999999999997 19.925 7 15.024999999999999 25.3 41.125 18.55 8 17.474999999999998 25.6 31.175000000000004 25.75 9 16.625 24.525 34.725 24.125 10-14 20.19 29.13 27.255000000000003 23.425 15-19 19.689999999999998 28.845 27.834999999999997 23.630000000000003 20-24 19.415 29.409999999999997 27.345000000000002 23.830000000000002 25-29 19.919999999999998 29.215000000000003 26.805 24.060000000000002 30-34 19.195 29.67 27.529999999999998 23.605 35-39 19.575 29.025000000000002 27.534999999999997 23.865 40-44 20.205000000000002 28.65 27.229999999999997 23.915 45-49 19.445 29.110000000000003 27.21 24.235 50-54 19.314999999999998 29.09 27.52 24.075 55-59 20.01 28.98 27.295 23.715 60-64 19.895 29.175 27.415 23.515 65-69 19.425 29.404999999999998 27.42 23.75 70-74 19.85 29.03 27.715 23.405 75-79 19.81 28.24 28.24 23.71 80-84 20.150000000000002 28.599999999999998 27.544999999999998 23.705000000000002 85-89 20.66 28.189999999999998 27.73 23.419999999999998 90-94 20.365 28.565 27.255000000000003 23.815 95-99 20.02 28.51 27.589999999999996 23.880000000000003 100-104 20.16 28.62 27.900000000000002 23.32 105-109 20.169999999999998 28.15 27.665 24.015 110-114 20.215 28.535 27.685 23.565 115-119 19.950000000000003 28.4 27.87 23.78 120-124 20.54 28.24 27.245 23.974999999999998 125-129 19.925 28.185 27.584999999999997 24.305 130-134 20.54 28.634999999999998 27.250000000000004 23.575 135-139 20.96 28.28 27.150000000000002 23.61 140-144 20.635 28.575 27.515 23.275000000000002 145-149 20.86 28.54 27.0 23.599999999999998 150-151 21.175 28.3125 26.525 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 2.5 24 1.5 25 3.5 26 6.5 27 7.0 28 6.5 29 11.0 30 25.0 31 32.0 32 34.0 33 46.5 34 66.0 35 84.0 36 94.5 37 101.0 38 116.5 39 156.5 40 206.5 41 231.0 42 252.0 43 264.0 44 276.0 45 276.5 46 246.5 47 229.0 48 216.5 49 200.0 50 172.0 51 136.5 52 110.5 53 97.5 54 81.0 55 56.0 56 40.5 57 32.0 58 22.0 59 15.0 60 10.0 61 5.0 62 4.0 63 4.0 64 3.5 65 3.0 66 2.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.7125 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.3624999999999998 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.825 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAATCC 10 0.006830828 145.0 5 >>END_MODULE SRR7168964 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168964_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15675 34.0 33.0 34.0 33.0 34.0 2 33.195 34.0 33.0 34.0 33.0 34.0 3 33.17575 34.0 33.0 34.0 33.0 34.0 4 33.24375 34.0 33.0 34.0 33.0 34.0 5 33.183 34.0 33.0 34.0 33.0 34.0 6 37.4 38.0 38.0 38.0 38.0 38.0 7 37.416 38.0 38.0 38.0 38.0 38.0 8 37.441 38.0 38.0 38.0 38.0 38.0 9 37.43725 38.0 38.0 38.0 38.0 38.0 10-14 37.37845 38.0 38.0 38.0 38.0 38.0 15-19 37.2495 38.0 38.0 38.0 37.4 38.0 20-24 37.286500000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.292500000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.1976 38.0 38.0 38.0 37.4 38.0 35-39 37.21285 38.0 38.0 38.0 37.4 38.0 40-44 37.1369 38.0 38.0 38.0 37.0 38.0 45-49 37.1051 38.0 38.0 38.0 37.0 38.0 50-54 37.04085 38.0 38.0 38.0 37.0 38.0 55-59 37.007549999999995 38.0 38.0 38.0 37.0 38.0 60-64 36.98095 38.0 38.0 38.0 36.6 38.0 65-69 36.90185 38.0 38.0 38.0 36.4 38.0 70-74 36.840849999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.79260000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.68675 38.0 38.0 38.0 35.6 38.0 85-89 36.6183 38.0 38.0 38.0 35.2 38.0 90-94 36.467299999999994 38.0 38.0 38.0 35.0 38.0 95-99 36.2706 38.0 38.0 38.0 34.0 38.0 100-104 36.239850000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.06775 38.0 38.0 38.0 34.0 38.0 110-114 35.983799999999995 38.0 38.0 38.0 33.6 38.0 115-119 35.7663 38.0 38.0 38.0 33.0 38.0 120-124 35.1982 38.0 36.4 38.0 29.4 38.0 125-129 35.05650000000001 38.0 36.0 38.0 28.4 38.0 130-134 34.833549999999995 38.0 36.0 38.0 27.8 38.0 135-139 34.49060000000001 38.0 35.6 38.0 26.0 38.0 140-144 33.89495 38.0 34.2 38.0 22.6 38.0 145-149 32.961400000000005 38.0 33.0 38.0 15.0 38.0 150-151 28.854875 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 4.0 5 2.0 6 1.0 7 3.0 8 1.0 9 0.0 10 3.0 11 1.0 12 1.0 13 2.0 14 3.0 15 8.0 16 5.0 17 8.0 18 4.0 19 9.0 20 7.0 21 10.0 22 12.0 23 10.0 24 10.0 25 11.0 26 20.0 27 20.0 28 31.0 29 25.0 30 33.0 31 44.0 32 63.0 33 58.0 34 115.0 35 222.0 36 606.0 37 2640.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.875 22.2 12.45 25.474999999999998 2 27.025 25.5 31.6 15.875 3 19.400000000000002 28.749999999999996 31.624999999999996 20.225 4 24.375 34.75 23.375 17.5 5 24.5 37.25 20.375 17.875 6 18.475 38.1 24.6 18.825 7 20.9 21.175 37.9 20.025000000000002 8 21.9 25.35 28.775000000000002 23.974999999999998 9 20.150000000000002 24.975 30.075000000000003 24.8 10-14 23.52 29.03 26.334999999999997 21.115000000000002 15-19 23.03 27.900000000000002 28.060000000000002 21.01 20-24 22.97 28.28 27.68 21.07 25-29 23.3 28.355000000000004 27.694999999999997 20.65 30-34 22.82 27.985 28.235 20.96 35-39 22.650000000000002 28.849999999999998 28.065 20.435 40-44 22.965 28.310000000000002 28.060000000000002 20.665 45-49 23.155 28.305000000000003 28.225 20.315 50-54 23.07 28.01 28.505000000000003 20.415 55-59 23.95 27.76 27.750000000000004 20.54 60-64 23.13 27.694999999999997 28.904999999999998 20.27 65-69 23.150000000000002 27.98 28.68 20.19 70-74 23.39 28.18 27.605 20.825 75-79 22.939999999999998 28.015 28.044999999999998 21.0 80-84 22.63 28.544999999999998 28.285 20.54 85-89 24.2 27.85 27.839999999999996 20.11 90-94 23.275000000000002 27.79 28.49 20.445 95-99 23.285 28.125 28.13 20.46 100-104 23.615 28.335 27.74 20.31 105-109 23.580000000000002 27.805000000000003 28.16 20.455000000000002 110-114 24.085 27.765 27.98 20.169999999999998 115-119 23.205000000000002 27.744999999999997 28.43 20.62 120-124 24.19 27.38 27.700000000000003 20.73 125-129 23.59 27.155 28.92 20.335 130-134 23.79 28.29 27.66 20.26 135-139 24.83 27.3 27.775 20.095 140-144 24.365000000000002 27.935 27.925 19.775000000000002 145-149 24.755 27.495000000000005 27.805000000000003 19.945 150-151 24.3 27.875 27.5625 20.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.5 24 2.0 25 1.5 26 4.0 27 6.5 28 9.0 29 10.5 30 10.5 31 14.0 32 22.5 33 36.0 34 53.5 35 75.5 36 94.0 37 126.0 38 149.0 39 169.0 40 203.5 41 227.0 42 258.0 43 292.0 44 294.5 45 272.0 46 274.5 47 280.0 48 240.5 49 183.5 50 144.0 51 118.0 52 106.0 53 86.5 54 61.5 55 43.5 56 30.5 57 23.0 58 17.0 59 14.0 60 8.0 61 4.5 62 5.0 63 4.0 64 2.5 65 2.5 66 2.5 67 1.5 68 2.0 69 2.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5285678328718851 1.05 3 0.0 0.0 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.675 0.0 0.0 0.0 0.0 136-137 2.8875 0.0 0.0 0.0 0.0 138-139 3.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCTT 10 0.006830828 145.0 8 TAAAAAT 10 0.006830828 145.0 8 GAATTCC 10 0.006830828 145.0 9 >>END_MODULE Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856885 spots for SRR7168964.sra Written 856885 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra Read 856884 spots for SRR7168964.sra Written 856884 spots for SRR7168964.sra SRR ids: ['SRR7168964.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qx_q5hlg SRR7168964.sra spots: 17137681 blocks: [[1, 856884], [856885, 1713768], [1713769, 2570652], [2570653, 3427536], [3427537, 4284420], [4284421, 5141304], [5141305, 5998188], [5998189, 6855072], [6855073, 7711956], [7711957, 8568840], [8568841, 9425724], [9425725, 10282608], [10282609, 11139492], [11139493, 11996376], [11996377, 12853260], [12853261, 13710144], [13710145, 14567028], [14567029, 15423912], [15423913, 16280796], [16280797, 17137681]] SRR7168964 file size 5785697 SRR7168964 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168964 SRR7168964_1.fastq SRR7168964_2.fastq Input file: SRR7168964_1.fastq Paired file: SRR7168964_2.fastq trimmed: SRR7168964-trimmed-pair1.fastq, SRR7168964-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:43:30 2025 >> started Mon Feb 10 12:44:00 2025 >> done (29.778s) 17137681 read pairs processed; of these: 11355 ( 0.07%) short read pairs filtered out after trimming by size control 8258 ( 0.05%) empty read pairs filtered out after trimming by size control 17118068 (99.89%) read pairs available; of these: 6635046 (38.76%) trimmed read pairs available after processing 10483022 (61.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 5 0.00% 20 5 0.00% 21 5 0.00% 22 11 0.00% 23 6 0.00% 24 9 0.00% 25 6 0.00% 26 6 0.00% 27 8 0.00% 28 7 0.00% 29 9 0.00% 30 4 0.00% 31 5 0.00% 32 8 0.00% 33 8 0.00% 34 6 0.00% 35 9 0.00% 36 9 0.00% 37 13 0.00% 38 5 0.00% 39 11 0.00% 40 13 0.00% 41 7 0.00% 42 9 0.00% 43 7 0.00% 44 14 0.00% 45 11 0.00% 46 13 0.00% 47 14 0.00% 48 19 0.00% 49 19 0.00% 50 14 0.00% 51 26 0.00% 52 31 0.00% 53 29 0.00% 54 36 0.00% 55 31 0.00% 56 38 0.00% 57 39 0.00% 58 41 0.00% 59 53 0.00% 60 46 0.00% 61 54 0.00% 62 70 0.00% 63 80 0.00% 64 87 0.00% 65 106 0.00% 66 126 0.00% 67 123 0.00% 68 157 0.00% 69 202 0.00% 70 245 0.00% 71 251 0.00% 72 290 0.00% 73 332 0.00% 74 367 0.00% 75 416 0.00% 76 412 0.00% 77 426 0.00% 78 508 0.00% 79 628 0.00% 80 759 0.00% 81 797 0.00% 82 979 0.01% 83 1121 0.01% 84 1688 0.01% 85 2196 0.01% 86 2349 0.01% 87 2704 0.02% 88 2815 0.02% 89 2932 0.02% 90 3188 0.02% 91 3408 0.02% 92 3723 0.02% 93 4021 0.02% 94 4173 0.02% 95 4704 0.03% 96 4960 0.03% 97 5205 0.03% 98 5483 0.03% 99 5844 0.03% 100 6307 0.04% 101 6902 0.04% 102 7462 0.04% 103 8128 0.05% 104 8512 0.05% 105 9155 0.05% 106 9861 0.06% 107 10099 0.06% 108 10821 0.06% 109 11347 0.07% 110 11919 0.07% 111 12717 0.07% 112 13660 0.08% 113 14830 0.09% 114 15741 0.09% 115 16783 0.10% 116 17454 0.10% 117 18308 0.11% 118 19111 0.11% 119 19782 0.12% 120 20912 0.12% 121 22196 0.13% 122 23109 0.13% 123 24856 0.15% 124 26728 0.16% 125 28041 0.16% 126 29809 0.17% 127 31486 0.18% 128 32597 0.19% 129 34252 0.20% 130 36328 0.21% 131 38635 0.23% 132 41021 0.24% 133 44188 0.26% 134 47696 0.28% 135 51569 0.30% 136 55240 0.32% 137 59789 0.35% 138 63253 0.37% 139 67550 0.39% 140 72547 0.42% 141 78508 0.46% 142 86130 0.50% 143 96394 0.56% 144 110388 0.64% 145 131896 0.77% 146 159926 0.93% 147 213496 1.25% 148 325825 1.90% 149 638115 3.73% 150 3625061 21.18% 151 10483022 61.24% 17118068 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=35 prefix-density=0.19 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=273.02 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=28.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=37 prefix-density=0.40 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=267.04 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=30.9 sequence=AAGAAGAAGAAA SRR7168964 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:44:43 Started mapping on | Feb 10 12:44:44 Finished on | Feb 10 12:46:36 Mapping speed, Million of reads per hour | 550.22 Number of input reads | 17118068 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16287438 Uniquely mapped reads % | 95.15% Average mapped length | 296.55 Number of splices: Total | 15706349 Number of splices: Annotated (sjdb) | 15454239 Number of splices: GT/AG | 15473789 Number of splices: GC/AG | 187123 Number of splices: AT/AC | 12640 Number of splices: Non-canonical | 32797 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301762 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 35926 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541487 541487 541487 N_multimapping 301762 301762 301762 N_noFeature 414934 16109949 504374 N_ambiguous 160635 877 71981 UnstrandedReadsAssigned:15711869 PositiveStrandReadsAssigned:176612 NegativeStrandReadsAssigned:15711083 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168964 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168964-trimmed-pair1.fastq SRR7168964-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,118,068 reads, 15,594,642 reads pseudoaligned [quant] estimated average fragment length: 255.413 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52401 SRR7168964.ke.tsv 34699 SRR7168964.se.tsv 87100 total ==> SRR7168964.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.59 334 12.2925 Potri.005G024800.1.v4.1 1035 780.587 39 3.24291 Potri.004G059700.1.v4.1 961 706.671 3 0.275547 Potri.007G009000.2.v4.1 1416 1161.59 0 0 Potri.003G141000.2.v4.1 2943 2688.59 274.059 6.61624 Potri.016G087400.1.v4.1 270 72.7328 973.461 868.721 Potri.015G069301.1.v4.1 564 316.344 0 0 Potri.010G195200.1.v4.1 1773 1518.59 31 1.32499 Potri.012G127500.1.v4.1 977 722.624 5862 526.533 ==> SRR7168964.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1026 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168964 completed mapping pipeline successfully